KYRG-151

RSP11052
StrainSEEK Cannabis Certification Report

Accession Date:

February 6, 2018

General Information

Strain: KYRG-151
Sample: Kyrgyz-MS
RSP ID: RSP11052
Grower: Landrace kyrgyzstan
Accession Date: February 6, 2018
Gender: -
Strain Seek Version: V2


What does this visualization mean?

Chemical Information*


Cannabinoid and Terpenoid information provided by our Partner Labs.

CANNABINOIDS

THC + THCA %: N/A
CBD + CBDA %: N/A
THCV + THCVA %: N/A
CBC + CBCA %: N/A
CBG + CBGA %: N/A
CBN + CBNA %: N/A

TERPENOIDS

  • α-Bisabolol %: N/A
    Borneol %: N/A
    Camphene %: N/A
    Carene %: N/A
    Caryophyllene oxide %: N/A
    β-Carophyllene %: N/A
    Fenchol %: N/A
    Geraniol %: N/A
    α-Humulene %: N/A
    Limonene %: N/A
    Linalool %: N/A
  • Myrcene %: N/A
    α-Phellandrene %: N/A
    Terpinolene %: N/A
    α-Terpineol %: N/A
    α-Terpinene %: N/A
    γ-Terpinene %: N/A
    Total Nerolidol %: N/A
    Total Ocimene %: N/A
    α-Pinene %: N/A
    β-Pinene %: N/A

Genetic Information

View this strain on the Phylotree
Percent Heterozygosity: 1.24
Download VCF file: Here
Download FastQ Files: Read 1 Read 2
Download BAM file: BAM index
Download Annotated Variants: ANNOTATED VCF index
Plant Type: Type II

Bt/Bd ALLELE COVERAGE

What does this visualization mean?

CBCAS COVERAGE


What does this visualization mean?

Y-RATIO DISTRIBUTION


What does this visualization mean?


VARIANTS (THCAS, CBDAS, and CBCAS)

Gene HGVS.c HGVS.p Annotation Annotation Impact Contig Contig Pos Ref/Alt Var Freq



VARIANTS (SELECT GENES OF INTEREST)

Gene HGVS.c HGVS.p Annotation Annotation Impact Contig Contig Pos Ref/Alt Var Freq
PKSG-2a

UNIPROT

c.67T>Ap.Phe23Ilemissense variantMODERATEcontig7001945567

IGV:Start|Jump

A/T

NGS:0.825

C90:0.904

0.825
PKSG-2a

UNIPROT

c.31A>Tp.Thr11Sermissense variantMODERATEcontig7001945603

IGV:Start|Jump

T/A

NGS:0.763

C90:0.876

0.763
PKSG-2b

UNIPROT

c.31A>Tp.Thr11Sermissense variantMODERATEcontig7001951851

IGV:Start|Jump

T/A

NGS:0.844

C90:0.880

0.844
PKSG-4b

UNIPROT

c.535_545delATTGGAGTGGGp.Ile179fsframeshift variantHIGHcontig7002721127

IGV:Start|Jump

CCCCACTCCAAT/C

NGS:0.105

C90:0.000

0.105
PKSG-4b

UNIPROT

c.523C>Tp.His175Tyrmissense variantMODERATEcontig7002721150

IGV:Start|Jump

G/A

NGS:0.112

C90:0.325

0.112
PKSG-4b

UNIPROT

c.509_510insTAAAAATTAACCCAAATTTCAATATTTTTGTAAGTTTCCCp.Glu172fsframeshift variant&stop gainedHIGHcontig7002721163

IGV:Start|Jump

T/TGGGAAACTTACAAAAATATTGAAATTTGGGTTAATTTTTA

NGS:0.002

C90:0.000

0.002
PKSG-4b

UNIPROT

c.496A>Gp.Lys166Glumissense variantMODERATEcontig7002721177

IGV:Start|Jump

T/C

NGS:0.651

C90:0.684

0.651
PKSG-4b

UNIPROT

c.489delTp.Phe163fsframeshift variantHIGHcontig7002721183

IGV:Start|Jump

CA/C

NGS:0.792

C90:0.761

0.792
PKSG-4b

UNIPROT

c.485A>Gp.Lys162Argmissense variantMODERATEcontig7002721188

IGV:Start|Jump

T/C

NGS:0.643

C90:0.301

0.643
aPT4

UNIPROT

c.474_475insTATGAAACAp.Cys158_Thr159insTyrGluThrconservative inframe insertionMODERATEcontig1212830669

IGV:Start|Jump

T/TTATGAAACA

NGS:0.002

C90:0.000

0.002
aPT4

UNIPROT

c.517A>Tp.Ile173Leumissense variant&splice region variantMODERATEcontig1212830795

IGV:Start|Jump

A/T

NGS:0.022

C90:0.000

0.022
aPT1

UNIPROT

c.629C>Tp.Thr210Ilemissense variantMODERATEcontig1212840237

IGV:Start|Jump

C/T

NGS:0.561

C90:0.598

0.561


NEAREST GENETIC RELATIVES TO KYRG-151:
# Relative Genetic Distance
1 RSP10661-Fedora 17 5.6
2 RSP11054-Kyrgyz Gold 5.62
3 RSP10665-Santhica 27 5.73
4 RSP11053-KYRG-21 5.87
5 RSP10659-Tisza 6.1
6 RSP10658-Lovrin 6.13
7 RSP10653-Jiangji 6.21
8 RSP11044-Tisza 6.27
9 RSP11045-Tisza 6.37
10 RSP10983-USO 31 6.39
11 RSP10981-USO 31 6.39
12 RSP11051-KYRG-11 6.41
13 RSP10664-Futura 75 6.44
14 RSP11203-Fedora 17 6.45
15 RSP10241-Monoica 6.51
16 RSP10056-Santhica27 6.52
17 RSP10667-Tygra 6.57
18 RSP11046-Santhica27 6.61
19 RSP11047-Santhica27 6.74
20 RSP11204-Carmagnola USO 31 6.8
NEAREST GENETIC RELATIVES TO BASE TREE:
# Relative Genetic Distance
1 RSP11054-Kyrgyz Gold 5.77
2 RSP10661-Fedora 17 5.79
3 RSP10659-Tisza 6.21
4 RSP10658-Lovrin 6.3
5 RSP11044-Tisza 6.34
6 RSP11051-KYRG-11 6.42
7 RSP10653-Jiangji 6.5
8 RSP10981-USO 31 6.73
9 RSP10241-Monoica 6.76
10 RSP10664-Futura 75 6.81
11 RSP10667-Tygra 6.91
12 RSP11047-Santhica27 6.99
13 RSP10890-Feral 7.25
14 RSP10668-Ivory 7.29
15 RSP10997-Kimbo Slice 7.29
16 RSP10755-Recon 7.4
17 RSP10979-Carmagnola 7.44
18 RSP10684-Blueberry Cheesecake 7.46
19 RSP11037-Carmagnola 7.61
20 RSP11121-RKM-2018-029 7.77
NEAREST GENETIC RELATIVES IN PHYLOS DATASET:
Phylos Strain Number of Overlapping SNPs Concordance
SRR4448770 90 66

Blockchain Registration Information:

Transaction ID: 7ab16af94390316560b5d05b5c9a3dcc97f63d890786d84195141b601d3df41b
Stamping Certificate: PDF
SHASUM Hash: e0e0a21f8b35628034519e87d379664ffc6c30cf7663426d5a6953928b75e85a