RKM-2018-026

RSP11118
StrainSEEK Cannabis Certification Report

Accession Date:

October 22, 2018

General Information

Strain: RKM-2018-026
RSP ID: RSP11118
Grower: R-Kiem Seeds
Accession Date: October 22, 2018
Gender: Female
Strain Seek Version: V2


What does this visualization mean?

Chemical Information*


Cannabinoid and Terpenoid information provided by our Partner Labs.

CANNABINOIDS

THC + THCA %: N/A
CBD + CBDA %: N/A
THCV + THCVA %: N/A
CBC + CBCA %: N/A
CBG + CBGA %: N/A
CBN + CBNA %: N/A

TERPENOIDS

  • α-Bisabolol %: N/A
    Borneol %: N/A
    Camphene %: N/A
    Carene %: N/A
    Caryophyllene oxide %: N/A
    β-Carophyllene %: N/A
    Fenchol %: N/A
    Geraniol %: N/A
    α-Humulene %: N/A
    Limonene %: N/A
    Linalool %: N/A
  • Myrcene %: N/A
    α-Phellandrene %: N/A
    Terpinolene %: N/A
    α-Terpineol %: N/A
    α-Terpinene %: N/A
    γ-Terpinene %: N/A
    Total Nerolidol %: N/A
    Total Ocimene %: N/A
    α-Pinene %: N/A
    β-Pinene %: N/A

Genetic Information

View this strain on the Phylotree
Percent Heterozygosity: 1.45
Download VCF file: Here
Download FastQ Files: Read 1 Read 2
Download BAM file: BAM index
Download Annotated Variants: ANNOTATED VCF index
Plant Type: Type I

Bt/Bd ALLELE COVERAGE

What does this visualization mean?

CBCAS COVERAGE


What does this visualization mean?

Y-RATIO DISTRIBUTION


What does this visualization mean?


VARIANTS (THCAS, CBDAS, and CBCAS)

Gene HGVS.c HGVS.p Annotation Annotation Impact Contig Contig Pos Ref/Alt Var Freq
THCASc.187A>Cp.Ile63Leumissense variantMODERATEcontig7414417641

IGV:Start|Jump

T/G

NGS:0.059

C90:0.679

0.059



VARIANTS (SELECT GENES OF INTEREST)

Gene HGVS.c HGVS.p Annotation Annotation Impact Contig Contig Pos Ref/Alt Var Freq
PKSG-2a

UNIPROT

c.67T>Ap.Phe23Ilemissense variantMODERATEcontig7001945567

IGV:Start|Jump

A/T

NGS:0.825

C90:0.904

0.825
PKSG-2a

UNIPROT

c.31A>Tp.Thr11Sermissense variantMODERATEcontig7001945603

IGV:Start|Jump

T/A

NGS:0.763

C90:0.876

0.763
PKSG-2b

UNIPROT

c.1152T>Ap.Asn384Lysmissense variantMODERATEcontig7001950486

IGV:Start|Jump

A/T

NGS:0.715

C90:0.895

0.715
PKSG-2b

UNIPROT

c.1132C>Gp.Leu378Valmissense variantMODERATEcontig7001950506

IGV:Start|Jump

G/C

NGS:0.717

C90:0.000

0.717
PKSG-2b

UNIPROT

c.1117A>Gp.Ile373Valmissense variantMODERATEcontig7001950521

IGV:Start|Jump

T/C

NGS:0.807

C90:0.981

0.807
PKSG-2b

UNIPROT

c.948T>Gp.Asp316Glumissense variantMODERATEcontig7001950690

IGV:Start|Jump

A/C

NGS:0.456

C90:0.000

0.456
PKSG-2b

UNIPROT

c.945T>Gp.Ser315Argmissense variantMODERATEcontig7001950693

IGV:Start|Jump

A/C

NGS:0.454

C90:0.000

0.454
PKSG-2b

UNIPROT

c.934C>Gp.His312Aspmissense variantMODERATEcontig7001950704

IGV:Start|Jump

G/C

NGS:0.410

C90:0.000

0.41
PKSG-2b

UNIPROT

c.31A>Tp.Thr11Sermissense variantMODERATEcontig7001951851

IGV:Start|Jump

T/A

NGS:0.844

C90:0.880

0.844
aPT4

UNIPROT

c.515+41_519delTATAATATTGATTACACTTAATTAATATAATTTTCATTATCAGGATAp.Ile173fsframeshift variant&splice acceptor variant&splice region variant&intron variantHIGHcontig1212830750

IGV:Start|Jump

CTATAATATTGATTACACTTAATTAATATAATTTTCATTATCAGGATA/C

NGS:0.002

C90:0.000

0.002
aPT1

UNIPROT

c.629C>Tp.Thr210Ilemissense variantMODERATEcontig1212840237

IGV:Start|Jump

C/T

NGS:0.561

C90:0.598

0.561
HDS-2

UNIPROT

c.82_93delGTAACCGGAACTp.Val28_Thr31delconservative inframe deletionMODERATEcontig951989748

IGV:Start|Jump

CGTAACCGGAACT/C

NGS:0.805

C90:0.000

0.805
HDS-2

UNIPROT

c.127T>Gp.Ser43Alamissense variantMODERATEcontig951989794

IGV:Start|Jump

T/G

NGS:0.721

C90:0.000

0.721


NEAREST GENETIC RELATIVES TO RKM-2018-026:
# Relative Genetic Distance
1 RSP10837-Skywalker OG 4.18
2 RSP11072-SFVxTK 4.22
3 RSP11353-Rugburn OG 4.38
4 RSP11190-Red Eye OG 4.72
5 RSP11104-RKM-2018-013 4.93
6 RSP11341-Garlic 5.35
7 RSP11103-RKM-2018-012 5.83
8 RSP11231-Gorilla Cookies 5.92
9 RSP11241-501st OG 5.94
10 RSP11073-Pie Hoe 5.95
11 RSP11050-Hermaphrodite ResearchSample2 6.09
12 RSP10680-Blueberry Cheesecake 6.13
13 RSP11126-RKM-2018-034 6.15
14 RSP11352-Star Dawg 6.28
15 RSP11099-RKM-2018-008 6.4
16 RSP11071-Sunday Driver 6.58
17 RSP11180-Grape Stomper 6.63
18 RSP10988-The Gift 6.69
19 RSP11362-NSPM1 6.77
20 RSP11043-Hermaphrodite ResearchSample2 6.83
NEAREST GENETIC RELATIVES TO BASE TREE:
# Relative Genetic Distance
1 RSP10837-Skywalker OG 4.23
2 RSP11073-Pie Hoe 6.09
3 RSP11050-Hermaphrodite ResearchSample2 6.22
4 RSP11126-RKM-2018-034 6.25
5 RSP10680-Blueberry Cheesecake 6.3
6 RSP10988-The Gift 6.51
7 RSP11125-RKM-2018-033 6.94
8 RSP11124-RKM-2018-032 7.05
9 RSP11112-RKM-2018-020 7.18
10 RSP11096-RKM-2018-005 7.47
11 RSP11093-RKM-2018-002 7.55
12 RSP10997-Kimbo Slice 7.85
13 RSP11100-RKM-2018-009 8
14 RSP11128-Kush Hemp E1 8.27
15 RSP10551-Sour Raspberry 8.66
16 RSP10684-Blueberry Cheesecake 8.73
17 RSP11121-RKM-2018-029 9.25
18 RSP11014-Durban Poison 9.34
19 RSP11048-Gold Cracker 9.36
20 RSP11054-Kyrgyz Gold 9.36
NEAREST GENETIC RELATIVES IN PHYLOS DATASET:
Phylos Strain Number of Overlapping SNPs Concordance
SRR8346878 79 60

Blockchain Registration Information:

Transaction ID: 260e497261b87418e63b1823c470a65b918e192f7bd79d953a91e78d3e868a18
Stamping Certificate: PDF
SHASUM Hash: c3e901c609b3abec48cb191b3e6f74b7a46b49015724dae6b5bf5453575b223f