Cherry

RSP11142
StrainSEEK Cannabis Certification Report

Accession Date:

April 17, 2019

General Information

Strain: Cherry
Sample: VR3A
RSP ID: RSP11142
Grower: GHA
Accession Date: April 17, 2019
Gender: Female
Strain Seek Version: V2


What does this visualization mean?

Chemical Information*


Cannabinoid and Terpenoid information provided by our Partner Labs.

CANNABINOIDS

THC + THCA %: N/A
CBD + CBDA %: N/A
THCV + THCVA %: N/A
CBC + CBCA %: N/A
CBG + CBGA %: N/A
CBN + CBNA %: N/A

TERPENOIDS

  • α-Bisabolol %: N/A
    Borneol %: N/A
    Camphene %: N/A
    Carene %: N/A
    Caryophyllene oxide %: N/A
    β-Carophyllene %: N/A
    Fenchol %: N/A
    Geraniol %: N/A
    α-Humulene %: N/A
    Limonene %: N/A
    Linalool %: N/A
  • Myrcene %: N/A
    α-Phellandrene %: N/A
    Terpinolene %: N/A
    α-Terpineol %: N/A
    α-Terpinene %: N/A
    γ-Terpinene %: N/A
    Total Nerolidol %: N/A
    Total Ocimene %: N/A
    α-Pinene %: N/A
    β-Pinene %: N/A

Genetic Information

View this strain on the Phylotree
Percent Heterozygosity: 1.77
Download VCF file: Here
Download FastQ Files: Read 1 Read 2
Download BAM file: BAM index
Download Annotated Variants: ANNOTATED VCF index
Plant Type: Type III

Bt/Bd ALLELE COVERAGE

What does this visualization mean?

CBCAS COVERAGE


What does this visualization mean?

Y-RATIO DISTRIBUTION


What does this visualization mean?


VARIANTS (THCAS, CBDAS, and CBCAS)

Gene HGVS.c HGVS.p Annotation Annotation Impact Contig Contig Pos Ref/Alt Var Freq
CBDASc.221C>Gp.Thr74Sermissense variantMODERATEcontig17722082447

IGV:Start|Jump

C/G

NGS:0.136

C90:0.057

0.136
CBDASc.1420A>Cp.Lys474Glnmissense variantMODERATEcontig17722083646

IGV:Start|Jump

A/C

NGS:0.132

C90:0.813

0.132



VARIANTS (SELECT GENES OF INTEREST)

Gene HGVS.c HGVS.p Annotation Annotation Impact Contig Contig Pos Ref/Alt Var Freq
PKSG-2a

UNIPROT

c.67T>Ap.Phe23Ilemissense variantMODERATEcontig7001945567

IGV:Start|Jump

A/T

NGS:0.825

C90:0.904

0.825
PKSG-2a

UNIPROT

c.31A>Tp.Thr11Sermissense variantMODERATEcontig7001945603

IGV:Start|Jump

T/A

NGS:0.763

C90:0.876

0.763
PKSG-2a

UNIPROT

c.-22_2delTAAAAATTATAATAATAATAATATp.Met1delstart lost&conservative inframe deletionHIGHcontig7001945631

IGV:Start|Jump

CATATTATTATTATTATAATTTTTA/C

NGS:0.013

C90:0.000

0.013
PKSG-2b

UNIPROT

c.1152T>Ap.Asn384Lysmissense variantMODERATEcontig7001950486

IGV:Start|Jump

A/T

NGS:0.715

C90:0.895

0.715
PKSG-2b

UNIPROT

c.1132C>Gp.Leu378Valmissense variantMODERATEcontig7001950506

IGV:Start|Jump

G/C

NGS:0.717

C90:0.000

0.717
PKSG-2b

UNIPROT

c.1117A>Gp.Ile373Valmissense variantMODERATEcontig7001950521

IGV:Start|Jump

T/C

NGS:0.807

C90:0.981

0.807
PKSG-2b

UNIPROT

c.948T>Gp.Asp316Glumissense variantMODERATEcontig7001950690

IGV:Start|Jump

A/C

NGS:0.456

C90:0.000

0.456
PKSG-2b

UNIPROT

c.945T>Gp.Ser315Argmissense variantMODERATEcontig7001950693

IGV:Start|Jump

A/C

NGS:0.454

C90:0.000

0.454
PKSG-2b

UNIPROT

c.944G>Ap.Ser315Asnmissense variantMODERATEcontig7001950694

IGV:Start|Jump

C/T

NGS:0.445

C90:0.000

0.445
PKSG-2b

UNIPROT

c.934C>Gp.His312Aspmissense variantMODERATEcontig7001950704

IGV:Start|Jump

G/C

NGS:0.410

C90:0.000

0.41
PKSG-2b

UNIPROT

c.31A>Tp.Thr11Sermissense variantMODERATEcontig7001951851

IGV:Start|Jump

T/A

NGS:0.844

C90:0.880

0.844
PKSG-4b

UNIPROT

c.496A>Gp.Lys166Glumissense variantMODERATEcontig7002721177

IGV:Start|Jump

T/C

NGS:0.651

C90:0.684

0.651
PKSG-4b

UNIPROT

c.489delTp.Phe163fsframeshift variantHIGHcontig7002721183

IGV:Start|Jump

CA/C

NGS:0.792

C90:0.761

0.792
PKSG-4b

UNIPROT

c.485A>Gp.Lys162Argmissense variantMODERATEcontig7002721188

IGV:Start|Jump

T/C

NGS:0.643

C90:0.301

0.643
PKSG-4b

UNIPROT

c.431T>Gp.Val144Glymissense variantMODERATEcontig7002721242

IGV:Start|Jump

A/C

NGS:0.575

C90:0.679

0.575
HDS-2

UNIPROT

c.82_93delGTAACCGGAACTp.Val28_Thr31delconservative inframe deletionMODERATEcontig951989748

IGV:Start|Jump

CGTAACCGGAACT/C

NGS:0.805

C90:0.000

0.805
HDS-2

UNIPROT

c.127T>Gp.Ser43Alamissense variantMODERATEcontig951989794

IGV:Start|Jump

T/G

NGS:0.721

C90:0.000

0.721


NEAREST GENETIC RELATIVES TO Cherry:
# Relative Genetic Distance
1 RSP11267-Cherry Wine 6.84
2 RSP11272-Unknown- Cherry Wine - 005 7.62
3 RSP11184-Domnesia 7.75
4 RSP10996-Durban Poison 1 7.79
5 RSP11313-Cherry Blossom 7.89
6 RSP11013-Durban Poison 1 8.01
7 RSP11333-Cherry Blossom 8.25
8 RSP11317-Cherry Blossom 8.26
9 RSP11014-Durban Poison 8.3
10 RSP11332-Cherry Blossom 8.55
11 RSP11179-Saint Jack 8.57
12 RSP11356-Strawberry Cough 8.58
13 RSP11302-Cherry Blossom 8.59
14 RSP11243-Doug's Varin 8.67
15 RSP11314-Cherry Blossom 8.68
16 RSP11226-Durban Poison 8.72
17 RSP10998-Durban Poison 8.74
18 RSP11141-2nd Gen Cherry 8.78
19 RSP11004-Blue Dream 8.83
20 RSP11305-Cherry Wine 8.83
NEAREST GENETIC RELATIVES TO BASE TREE:
# Relative Genetic Distance
1 RSP11014-Durban Poison 8.53
2 RSP10755-Recon 9.06
3 RSP11143-Cherry 9.08
4 RSP10684-Blueberry Cheesecake 9.4
5 RSP11000-Liberty Haze 9.45
6 RSP10672-Blueberry Cheesecake 9.6
7 RSP10989-UP Sunrise 9.62
8 RSP11111-RKM-2018-019 9.66
9 RSP11048-Gold Cracker 9.68
10 RSP10659-Tisza 9.71
11 RSP11002-CST 9.76
12 RSP10658-Lovrin 9.88
13 RSP11123-RKM-2018-031 9.9
14 RSP11044-Tisza 9.9
15 RSP11119-RKM-2018-027 9.92
16 RSP11051-KYRG-11 9.96
17 RSP10653-Jiangji 10.01
18 RSP11050-Hermaphrodite ResearchSample2 10.01
19 RSP11114-RKM-2018-022 10.11
20 RSP11054-Kyrgyz Gold 10.15
NEAREST GENETIC RELATIVES IN PHYLOS DATASET:
Phylos Strain Number of Overlapping SNPs Concordance
SRR8349055 86 57
NEAREST GENETIC RELATIVES IN LYNCH DATASET:
Nearest Lynch Strain Number of Overlapping SNPs Concordance
SRR3495168 8 7

Blockchain Registration Information:

Transaction ID: a6bf0be07e288de40d8912e75f35b79974058666ce660030cc1738b99a8057de
Stamping Certificate: PDF
SHASUM Hash: 166d25434004a5180f66e408616f935994ee6bebb1efe0e6da4ff8f61118914e