Feral

RSP11205
StrainSEEK Cannabis Certification Report

Accession Date:

June 27, 2019

General Information

Strain: Feral
Sample: Merino_S_1_CSU
RSP ID: RSP11205
Grower: John McKay-Colorado State University
Accession Date: June 27, 2019
Gender: Male
Strain Seek Version: V2


What does this visualization mean?

Chemical Information*


Cannabinoid and Terpenoid information provided by our Partner Labs.

CANNABINOIDS

THC + THCA %: N/A
CBD + CBDA %: N/A
THCV + THCVA %: N/A
CBC + CBCA %: N/A
CBG + CBGA %: N/A
CBN + CBNA %: N/A

TERPENOIDS

  • α-Bisabolol %: N/A
    Borneol %: N/A
    Camphene %: N/A
    Carene %: N/A
    Caryophyllene oxide %: N/A
    β-Carophyllene %: N/A
    Fenchol %: N/A
    Geraniol %: N/A
    α-Humulene %: N/A
    Limonene %: N/A
    Linalool %: N/A
  • Myrcene %: N/A
    α-Phellandrene %: N/A
    Terpinolene %: N/A
    α-Terpineol %: N/A
    α-Terpinene %: N/A
    γ-Terpinene %: N/A
    Total Nerolidol %: N/A
    Total Ocimene %: N/A
    α-Pinene %: N/A
    β-Pinene %: N/A

Genetic Information

View this strain on the Phylotree
Percent Heterozygosity: 2.45
Download VCF file: Here
Download FastQ Files: Read 1 Read 2
Download BAM file: BAM index
Download Annotated Variants: ANNOTATED VCF index
Plant Type: Type III

Bt/Bd ALLELE COVERAGE

What does this visualization mean?


VARIANTS (SELECT GENES OF INTEREST)

Gene HGVS.c HGVS.p Annotation Annotation Impact Contig Contig Pos Ref/Alt Var Freq
PKSA-3b

UNIPROT

c.298G>Ap.Ala100Thrmissense variantMODERATEcontig7052271640

IGV:Start|Jump

C/T

NGS:0.044

C90:0.177

0.044
GPPs1

UNIPROT

c.160A>Gp.Lys54Glumissense variantMODERATEcontig676168409

IGV:Start|Jump

A/G

NGS:0.026

C90:0.000

0.026
GPPs1

UNIPROT

c.472T>Ap.Leu158Metmissense variantMODERATEcontig676168721

IGV:Start|Jump

T/A

NGS:0.020

C90:0.000

0.02
GPPs1

UNIPROT

c.744C>Gp.Asp248Glumissense variantMODERATEcontig676168993

IGV:Start|Jump

C/G

NGS:0.022

C90:0.000

0.022
GPPs1

UNIPROT

c.807_814delGCATTTTTp.His270fsframeshift variantHIGHcontig676169595

IGV:Start|Jump

GTGCATTTT/G

NGS:0.015

C90:0.000

0.015
GPPs1

UNIPROT

c.845_848delAAAGp.Glu282fsframeshift variantHIGHcontig676169629

IGV:Start|Jump

TGAAA/T

NGS:0.118

C90:0.000

0.118
GPPs1

UNIPROT

c.857_864delCGAAAGAGp.Ala286fsframeshift variantHIGHcontig676169645

IGV:Start|Jump

GGCGAAAGA/G

NGS:0.009

C90:0.000

0.009
GPPs1

UNIPROT

c.866_877delTACTAGAGCTAGp.Leu289_Glu293delinsTerstop gained&disruptive inframe deletionHIGHcontig676169655

IGV:Start|Jump

TTACTAGAGCTAG/T

NGS:0.009

C90:0.000

0.009
GPPs1

UNIPROT

c.896A>Gp.Asn299Sermissense variantMODERATEcontig676169772

IGV:Start|Jump

A/G

NGS:0.046

C90:0.000

0.046
GPPs1

UNIPROT

c.923_927+5delTTTTGGTACTp.Val308fsframeshift variant&splice donor variant&splice region variant&intron variantHIGHcontig676169798

IGV:Start|Jump

GTTTTGGTACT/G

NGS:0.009

C90:0.000

0.009
GPPs1

UNIPROT

c.931delTp.Ter311fsframeshift variant&stop lost&splice region variantHIGHcontig676169840

IGV:Start|Jump

AT/A

NGS:0.009

C90:0.000

0.009
EMF1-2

UNIPROT

c.3G>Tp.Met1?start lostHIGHcontig885103

IGV:Start|Jump

G/T

NGS:0.007

C90:0.000

0.007
EMF1-2

UNIPROT

c.710A>Cp.His237Promissense variantMODERATEcontig885810

IGV:Start|Jump

A/C

NGS:0.090

C90:0.474

0.09
EMF1-2

UNIPROT

c.1148C>Tp.Ala383Valmissense variantMODERATEcontig8852034

IGV:Start|Jump

C/T

NGS:0.007

C90:0.000

0.007
EMF1-2

UNIPROT

c.1187T>Cp.Leu396Sermissense variantMODERATEcontig8852073

IGV:Start|Jump

T/C

NGS:0.026

C90:0.000

0.026
EMF1-2

UNIPROT

c.1189G>Ap.Ala397Thrmissense variantMODERATEcontig8852075

IGV:Start|Jump

G/A

NGS:0.007

C90:0.000

0.007
EMF1-2

UNIPROT

c.1199G>Ap.Arg400Lysmissense variantMODERATEcontig8852085

IGV:Start|Jump

G/A

NGS:0.007

C90:0.000

0.007
EMF1-2

UNIPROT

c.1409G>Ap.Arg470Lysmissense variantMODERATEcontig8852295

IGV:Start|Jump

G/A

NGS:0.007

C90:0.000

0.007
EMF1-2

UNIPROT

c.1828A>Gp.Ile610Valmissense variantMODERATEcontig8852714

IGV:Start|Jump

A/G

NGS:0.007

C90:0.000

0.007
EMF1-2

UNIPROT

c.2008C>Tp.Pro670Sermissense variantMODERATEcontig8852894

IGV:Start|Jump

C/T

NGS:0.007

C90:0.000

0.007
EMF1-2

UNIPROT

c.2256A>Tp.Lys752Asnmissense variantMODERATEcontig8853142

IGV:Start|Jump

A/T

NGS:0.026

C90:0.000

0.026
EMF1-2

UNIPROT

c.2653A>Gp.Thr885Alamissense variantMODERATEcontig8853539

IGV:Start|Jump

A/G

NGS:0.007

C90:0.000

0.007
PHL-2

UNIPROT

c.61G>Ap.Val21Ilemissense variantMODERATEcontig2621337630

IGV:Start|Jump

G/A

NGS:0.002

C90:0.000

0.002
PHL-2

UNIPROT

c.455A>Cp.Asp152Alamissense variantMODERATEcontig2621339191

IGV:Start|Jump

A/C

NGS:0.018

C90:0.507

0.018
PHL-2

UNIPROT

c.722G>Ap.Gly241Glumissense variantMODERATEcontig2621339860

IGV:Start|Jump

G/A

NGS:0.002

C90:0.000

0.002
PHL-2

UNIPROT

c.1057A>Gp.Arg353Glymissense variantMODERATEcontig2621340335

IGV:Start|Jump

A/G

NGS:0.096

C90:0.555

0.096
PHL-2

UNIPROT

c.1696T>Gp.Leu566Valmissense variantMODERATEcontig2621340974

IGV:Start|Jump

T/G

NGS:0.002

C90:0.000

0.002
PHL-2

UNIPROT

c.2564T>Ap.Phe855Tyrmissense variantMODERATEcontig2621342607

IGV:Start|Jump

T/A

NGS:0.064

C90:0.732

0.064
PHL-2

UNIPROT

c.2578T>Ap.Leu860Ilemissense variantMODERATEcontig2621342621

IGV:Start|Jump

T/A

NGS:0.068

C90:0.746

0.068
PHL-2

UNIPROT

c.2602G>Ap.Asp868Asnmissense variantMODERATEcontig2621342645

IGV:Start|Jump

G/A

NGS:0.002

C90:0.000

0.002
PHL-2

UNIPROT

c.2783G>Ap.Ser928Asnmissense variantMODERATEcontig2621342826

IGV:Start|Jump

G/A

NGS:0.107

C90:0.890

0.107
PHL-2

UNIPROT

c.3209A>Gp.Gln1070Argmissense variantMODERATEcontig2621343252

IGV:Start|Jump

A/G

NGS:0.103

C90:0.885

0.103
PHL-2

UNIPROT

c.3235G>Ap.Gly1079Sermissense variantMODERATEcontig2621343278

IGV:Start|Jump

G/A

NGS:0.002

C90:0.000

0.002
PKSG-4a

UNIPROT

c.37C>Gp.Gln13Glumissense variantMODERATEcontig7001936734

IGV:Start|Jump

C/G

NGS:0.031

C90:0.000

0.031
PKSG-2a

UNIPROT

c.1117A>Gp.Ile373Valmissense variantMODERATEcontig7001944273

IGV:Start|Jump

T/C

NGS:0.101

C90:0.967

0.101
PKSG-2a

UNIPROT

c.948T>Gp.Asp316Glumissense variantMODERATEcontig7001944442

IGV:Start|Jump

A/C

NGS:0.079

C90:0.000

0.079
PKSG-2a

UNIPROT

c.945T>Gp.Ser315Argmissense variantMODERATEcontig7001944445

IGV:Start|Jump

A/C

NGS:0.079

C90:0.000

0.079
PKSG-2a

UNIPROT

c.944G>Ap.Ser315Asnmissense variantMODERATEcontig7001944446

IGV:Start|Jump

C/T

NGS:0.079

C90:0.000

0.079
PKSG-2a

UNIPROT

c.934C>Gp.His312Aspmissense variantMODERATEcontig7001944456

IGV:Start|Jump

G/C

NGS:0.070

C90:0.000

0.07
PKSG-2a

UNIPROT

c.162C>Ap.Asp54Glumissense variantMODERATEcontig7001945228

IGV:Start|Jump

G/T

NGS:0.011

C90:0.000

0.011
PKSG-2b

UNIPROT

c.1117A>Gp.Ile373Valmissense variantMODERATEcontig7001950521

IGV:Start|Jump

T/C

NGS:0.807

C90:0.981

0.807
PKSG-2b

UNIPROT

c.67A>Tp.Ile23Phemissense variantMODERATEcontig7001951815

IGV:Start|Jump

T/A

NGS:0.033

C90:0.325

0.033
PKSG-4b

UNIPROT

c.544G>Tp.Gly182Trpmissense variantMODERATEcontig7002721129

IGV:Start|Jump

C/A

NGS:0.055

C90:0.000

0.055
PKSG-4b

UNIPROT

c.489delTp.Phe163fsframeshift variantHIGHcontig7002721183

IGV:Start|Jump

CA/C

NGS:0.792

C90:0.761

0.792
PKSG-4b

UNIPROT

c.353_354insCCp.Gly119fsframeshift variantHIGHcontig7002721319

IGV:Start|Jump

T/TGG

NGS:0.175

C90:0.000

0.175
PKSG-4b

UNIPROT

c.338G>Ap.Gly113Glumissense variantMODERATEcontig7002721335

IGV:Start|Jump

C/T

NGS:0.046

C90:0.000

0.046
PKSG-4b

UNIPROT

c.235_239dupAGATTp.Phe80fsframeshift variantHIGHcontig7002724195

IGV:Start|Jump

G/GAATCT

NGS:0.018

C90:0.000

0.018
PKSG-4b

UNIPROT

c.134G>Ap.Arg45Glnmissense variantMODERATEcontig7002724301

IGV:Start|Jump

C/T

NGS:0.018

C90:0.000

0.018
AAE1-1

UNIPROT

c.1481C>Tp.Ala494Valmissense variantMODERATEcontig6063242790

IGV:Start|Jump

G/A

NGS:0.002

C90:0.000

0.002
AAE1-1

UNIPROT

c.454A>Gp.Lys152Glumissense variantMODERATEcontig6063243817

IGV:Start|Jump

T/C

NGS:0.007

C90:0.000

0.007
DXR-2

UNIPROT

c.1319T>Cp.Ile440Thrmissense variantMODERATEcontig380285250

IGV:Start|Jump

A/G

NGS:0.480

C90:0.000

0.48
OAC-1

UNIPROT

c.22G>Ap.Val8Ilemissense variantMODERATEcontig931118442

IGV:Start|Jump

C/T

NGS:0.004

C90:0.000

0.004
FAD2-2

UNIPROT

c.161T>Ap.Leu54Hismissense variantMODERATEcontig831803208

IGV:Start|Jump

A/T

NGS:0.156

C90:0.000

0.156
FAD2-2

UNIPROT

c.91T>Gp.Trp31Glymissense variantMODERATEcontig831803278

IGV:Start|Jump

A/C

NGS:0.002

C90:0.000

0.002
FAD2-2

UNIPROT

c.75C>Ap.His25Glnmissense variantMODERATEcontig831803294

IGV:Start|Jump

G/T

NGS:0.007

C90:0.000

0.007
ELF3

UNIPROT

c.772A>Gp.Ser258Glymissense variantMODERATEcontig97242478

IGV:Start|Jump

A/G

NGS:0.112

C90:0.000

0.112
ELF3

UNIPROT

c.812G>Cp.Gly271Alamissense variantMODERATEcontig97242518

IGV:Start|Jump

G/C

NGS:0.114

C90:0.938

0.114
ELF3

UNIPROT

c.1366T>Gp.Leu456Valmissense variantMODERATEcontig97244197

IGV:Start|Jump

T/G

NGS:0.015

C90:0.000

0.015
ELF3

UNIPROT

c.1385C>Tp.Ala462Valmissense variantMODERATEcontig97244216

IGV:Start|Jump

C/T

NGS:0.004

C90:0.000

0.004
ELF3

UNIPROT

c.1466G>Ap.Ser489Asnmissense variantMODERATEcontig97244297

IGV:Start|Jump

G/A

NGS:0.123

C90:0.000

0.123
ELF3

UNIPROT

c.1630A>Gp.Thr544Alamissense variantMODERATEcontig97244461

IGV:Start|Jump

A/G

NGS:0.103

C90:0.545

0.103
ELF3

UNIPROT

c.1966C>Gp.Pro656Alamissense variantMODERATEcontig97244797

IGV:Start|Jump

C/G

NGS:0.123

C90:0.632

0.123
ELF3

UNIPROT

c.2142_2144delTCCp.Pro715deldisruptive inframe deletionMODERATEcontig97244965

IGV:Start|Jump

GCTC/G

NGS:0.002

C90:0.000

0.002
ELF3

UNIPROT

c.2198delGp.Arg733fsframeshift variantHIGHcontig97245028

IGV:Start|Jump

CG/C

NGS:0.002

C90:0.612

0.002
ELF3

UNIPROT

c.2198G>Tp.Arg733Leumissense variantMODERATEcontig97245029

IGV:Start|Jump

G/T

NGS:0.125

C90:0.531

0.125
ELF3

UNIPROT

c.2200_2204delCATCAp.His734fsframeshift variantHIGHcontig97245030

IGV:Start|Jump

TCATCA/T

NGS:0.002

C90:0.000

0.002
ELF3

UNIPROT

c.2218G>Ap.Asp740Asnmissense variantMODERATEcontig97245049

IGV:Start|Jump

G/A

NGS:0.002

C90:0.000

0.002
aPT4

UNIPROT

c.80A>Gp.Lys27Argmissense variantMODERATEcontig1212828736

IGV:Start|Jump

A/G

NGS:0.061

C90:0.000

0.061
aPT4

UNIPROT

c.202T>Ap.Leu68Ilemissense variantMODERATEcontig1212828858

IGV:Start|Jump

T/A

NGS:0.068

C90:0.000

0.068
aPT4

UNIPROT

c.916C>Tp.His306Tyrmissense variant&splice region variantMODERATEcontig1212832711

IGV:Start|Jump

C/T

NGS:0.015

C90:0.000

0.015
aPT4

UNIPROT

c.1168T>Cp.Tyr390Hismissense variantMODERATEcontig1212833503

IGV:Start|Jump

T/C

NGS:0.546

C90:0.000

0.546
aPT1

UNIPROT

c.160A>Cp.Thr54Promissense variantMODERATEcontig1212835867

IGV:Start|Jump

A/C

NGS:0.086

C90:0.048

0.086
aPT1

UNIPROT

c.670T>Ap.Ser224Thrmissense variantMODERATEcontig1212840278

IGV:Start|Jump

T/A

NGS:0.077

C90:0.000

0.077
aPT1

UNIPROT

c.727G>Tp.Glu243*stop gainedHIGHcontig1212841362

IGV:Start|Jump

G/T

NGS:0.127

C90:0.100

0.127
aPT1

UNIPROT

c.864C>Gp.Asn288Lysmissense variantMODERATEcontig1212842407

IGV:Start|Jump

C/G

NGS:0.075

C90:0.062

0.075
HDS-2

UNIPROT

c.82_93delGTAACCGGAACTp.Val28_Thr31delconservative inframe deletionMODERATEcontig951989748

IGV:Start|Jump

CGTAACCGGAACT/C

NGS:0.805

C90:0.000

0.805
AAE1-2

UNIPROT

c.331A>Gp.Asn111Aspmissense variantMODERATEcontig81209293

IGV:Start|Jump

A/G

NGS:0.123

C90:0.000

0.123
AAE1-2

UNIPROT

c.525G>Cp.Met175Ilemissense variantMODERATEcontig81209487

IGV:Start|Jump

G/C

NGS:0.002

C90:0.000

0.002
AAE1-2

UNIPROT

c.948_949insAp.Asp317fsframeshift variantHIGHcontig81209910

IGV:Start|Jump

C/CA

NGS:0.050

C90:0.000

0.05
AAE1-2

UNIPROT

c.952delCp.Gln318fsframeshift variantHIGHcontig81209912

IGV:Start|Jump

AC/A

NGS:0.050

C90:0.000

0.05
AAE1-2

UNIPROT

c.953A>Gp.Gln318Argmissense variantMODERATEcontig81209915

IGV:Start|Jump

A/G

NGS:0.050

C90:0.000

0.05
AAE1-2

UNIPROT

c.955C>Tp.Arg319Cysmissense variantMODERATEcontig81209917

IGV:Start|Jump

C/T

NGS:0.050

C90:0.000

0.05
AAE1-2

UNIPROT

c.1006A>Gp.Lys336Glumissense variantMODERATEcontig81209968

IGV:Start|Jump

A/G

NGS:0.116

C90:0.000

0.116
PHL-1

UNIPROT

c.2623A>Gp.Thr875Alamissense variantMODERATEcontig14391487174

IGV:Start|Jump

T/C

NGS:0.123

C90:0.000

0.123
PHL-1

UNIPROT

c.2551A>Gp.Thr851Alamissense variantMODERATEcontig14391487246

IGV:Start|Jump

T/C

NGS:0.116

C90:0.890

0.116
PHL-1

UNIPROT

c.1387A>Gp.Thr463Alamissense variantMODERATEcontig14391489811

IGV:Start|Jump

T/C

NGS:0.107

C90:0.904

0.107
PHL-1

UNIPROT

c.407G>Ap.Arg136Glnmissense variantMODERATEcontig14391491441

IGV:Start|Jump

C/T

NGS:0.024

C90:0.139

0.024
PHL-1

UNIPROT

c.176G>Ap.Gly59Glumissense variantMODERATEcontig14391492817

IGV:Start|Jump

C/T

NGS:0.024

C90:0.000

0.024
PHL-1

UNIPROT

c.175G>Ap.Gly59Argmissense variantMODERATEcontig14391492818

IGV:Start|Jump

C/T

NGS:0.024

C90:0.144

0.024
TFL1

UNIPROT

c.413G>Tp.Ser138Ilemissense variantMODERATEcontig1636520504

IGV:Start|Jump

C/A

NGS:0.002

C90:0.010

0.002
TFL1

UNIPROT

c.314_315delCAp.Thr105fsframeshift variantHIGHcontig1636520601

IGV:Start|Jump

CTG/C

NGS:0.004

C90:0.057

0.004
TFL1

UNIPROT

c.302-1G>Asplice acceptor variant&intron variantHIGHcontig1636520616

IGV:Start|Jump

C/T

NGS:0.103

C90:0.794

0.103
HDS-1

UNIPROT

c.1618A>Gp.Ile540Valmissense variantMODERATEcontig1891885936

IGV:Start|Jump

T/C

NGS:0.099

C90:0.861

0.099
HDS-1

UNIPROT

c.1378G>Ap.Val460Ilemissense variantMODERATEcontig1891886370

IGV:Start|Jump

C/T

NGS:0.167

C90:0.000

0.167
HDS-1

UNIPROT

c.136G>Ap.Val46Ilemissense variantMODERATEcontig1891889256

IGV:Start|Jump

C/T

NGS:0.088

C90:0.593

0.088
HDS-1

UNIPROT

c.56C>Gp.Ala19Glymissense variantMODERATEcontig1891889336

IGV:Start|Jump

G/C

NGS:0.125

C90:0.943

0.125
HDS-1

UNIPROT

c.35G>Ap.Cys12Tyrmissense variantMODERATEcontig1891889357

IGV:Start|Jump

C/T

NGS:0.094

C90:0.646

0.094
HDS-1

UNIPROT

c.-108+1_-108+2insGsplice donor variant&intron variantHIGHcontig1891889975

IGV:Start|Jump

A/AC

NGS:0.217

C90:0.000

0.217
FAD2

UNIPROT

c.148G>Ap.Val50Ilemissense variantMODERATEcontig14601084112

IGV:Start|Jump

C/T

NGS:0.004

C90:0.000

0.004
FAD2

UNIPROT

c.124C>Ap.Pro42Thrmissense variantMODERATEcontig14601084136

IGV:Start|Jump

G/T

NGS:0.007

C90:0.000

0.007
FAD2

UNIPROT

c.94A>Gp.Thr32Alamissense variantMODERATEcontig14601084166

IGV:Start|Jump

T/C

NGS:0.015

C90:0.000

0.015
PIE1-2

UNIPROT

c.6653A>Gp.Asn2218Sermissense variantMODERATEcontig14601184434

IGV:Start|Jump

T/C

NGS:0.059

C90:0.928

0.059
PIE1-2

UNIPROT

c.5932A>Gp.Ile1978Valmissense variantMODERATEcontig14601185552

IGV:Start|Jump

T/C

NGS:0.061

C90:0.268

0.061
PIE1-2

UNIPROT

c.2083_2085delGTCp.Val695delconservative inframe deletionMODERATEcontig14601189954

IGV:Start|Jump

GGAC/G

NGS:0.046

C90:0.880

0.046
PIE1-2

UNIPROT

c.2072A>Gp.His691Argmissense variantMODERATEcontig14601189968

IGV:Start|Jump

T/C

NGS:0.046

C90:0.789

0.046
PIE1-2

UNIPROT

c.1872T>Ap.Asp624Glumissense variantMODERATEcontig14601190252

IGV:Start|Jump

A/T

NGS:0.086

C90:0.990

0.086
PIE1-2

UNIPROT

c.1652C>Tp.Ala551Valmissense variantMODERATEcontig14601191578

IGV:Start|Jump

G/A

NGS:0.004

C90:0.000

0.004
PIE1-2

UNIPROT

c.1630G>Cp.Ala544Promissense variantMODERATEcontig14601191600

IGV:Start|Jump

C/G

NGS:0.070

C90:0.933

0.07
PIE1-2

UNIPROT

c.1289A>Gp.Asp430Glymissense variantMODERATEcontig14601192109

IGV:Start|Jump

T/C

NGS:0.079

C90:0.000

0.079
PIE1-2

UNIPROT

c.1156T>Gp.Trp386Glymissense variantMODERATEcontig14601192242

IGV:Start|Jump

A/C

NGS:0.009

C90:0.976

0.009
PIE1-2

UNIPROT

c.982G>Ap.Glu328Lysmissense variantMODERATEcontig14601192416

IGV:Start|Jump

C/T

NGS:0.050

C90:0.976

0.05
PIE1-2

UNIPROT

c.902-2A>Tsplice acceptor variant&intron variantHIGHcontig14601192498

IGV:Start|Jump

T/A

NGS:0.002

C90:0.000

0.002
PIE1-2

UNIPROT

c.710C>Tp.Pro237Leumissense variantMODERATEcontig14601193804

IGV:Start|Jump

G/A

NGS:0.072

C90:0.866

0.072
PIE1-2

UNIPROT

c.706T>Cp.Tyr236Hismissense variantMODERATEcontig14601193808

IGV:Start|Jump

A/G

NGS:0.059

C90:0.737

0.059
PIE1-2

UNIPROT

c.637T>Ap.Ser213Thrmissense variantMODERATEcontig14601194421

IGV:Start|Jump

A/T

NGS:0.079

C90:0.885

0.079
EMF2

UNIPROT

c.434C>Tp.Ser145Phemissense variantMODERATEcontig9543049270

IGV:Start|Jump

C/T

NGS:0.018

C90:0.057

0.018
EMF2

UNIPROT

c.1772A>Gp.Gln591Argmissense variantMODERATEcontig9543059929

IGV:Start|Jump

A/G

NGS:0.092

C90:0.876

0.092
EMF1-1

UNIPROT

c.62C>Gp.Thr21Sermissense variantMODERATEcontig883268910

IGV:Start|Jump

C/G

NGS:0.007

C90:0.000

0.007
EMF1-1

UNIPROT

c.389G>Ap.Arg130Glnmissense variantMODERATEcontig883269878

IGV:Start|Jump

G/A

NGS:0.007

C90:0.000

0.007
EMF1-1

UNIPROT

c.476A>Tp.Asn159Ilemissense variantMODERATEcontig883269965

IGV:Start|Jump

A/T

NGS:0.007

C90:0.000

0.007
EMF1-1

UNIPROT

c.590A>Tp.Lys197Ilemissense variantMODERATEcontig883270079

IGV:Start|Jump

A/T

NGS:0.007

C90:0.000

0.007
FT

UNIPROT

c.13C>Gp.Leu5Valmissense variantMODERATEcontig15613124437

IGV:Start|Jump

C/G

NGS:0.031

C90:0.153

0.031
FT

UNIPROT

c.41_43dupATAp.Asn14dupdisruptive inframe insertionMODERATEcontig15613124441

IGV:Start|Jump

T/TTAA

NGS:0.020

C90:0.000

0.02
FT

UNIPROT

c.43_44insATAATAATAATAATAATAATAATAATAATAATAp.Asn14_Ser15insAsnAsnAsnAsnAsnAsnAsnAsnAsnAsnAsndisruptive inframe insertionMODERATEcontig15613124441

IGV:Start|Jump

T/TTAATAATAATAATAATAATAATAATAATAATAA

NGS:0.004

C90:0.000

0.004
FT

UNIPROT

c.43_44insATAATAATAATAATAATAATAATAATAATAATAATAp.Asn14_Ser15insAsnAsnAsnAsnAsnAsnAsnAsnAsnAsnAsnAsndisruptive inframe insertionMODERATEcontig15613124441

IGV:Start|Jump

T/TTAATAATAATAATAATAATAATAATAATAATAATAA

NGS:0.004

C90:0.000

0.004
FT

UNIPROT

c.175C>Gp.Leu59Valmissense variantMODERATEcontig15613124599

IGV:Start|Jump

C/G

NGS:0.004

C90:0.000

0.004
FT

UNIPROT

c.196A>Gp.Ile66Valmissense variantMODERATEcontig15613124620

IGV:Start|Jump

A/G

NGS:0.004

C90:0.033

0.004
FT

UNIPROT

c.205C>Gp.Gln69Glumissense variantMODERATEcontig15613124629

IGV:Start|Jump

C/G

NGS:0.002

C90:0.000

0.002
FT

UNIPROT

c.240C>Gp.Asn80Lysmissense variantMODERATEcontig15613124664

IGV:Start|Jump

C/G

NGS:0.075

C90:0.000

0.075
FT

UNIPROT

c.260-1G>Asplice acceptor variant&intron variantHIGHcontig15613125000

IGV:Start|Jump

G/A

NGS:0.002

C90:0.000

0.002
FT

UNIPROT

c.276_277insGGTGTCCCTAAp.Met93fsframeshift variant&splice region variantHIGHcontig15613125016

IGV:Start|Jump

T/TAGGTGTCCCTA

NGS:0.002

C90:0.000

0.002
FT

UNIPROT

c.278+1G>Tsplice donor variant&intron variantHIGHcontig15613125020

IGV:Start|Jump

G/T

NGS:0.002

C90:0.000

0.002
FT

UNIPROT

c.420C>Ap.Ser140Argmissense variantMODERATEcontig15613126659

IGV:Start|Jump

C/A

NGS:0.004

C90:0.000

0.004
FLD

UNIPROT

c.2981T>Cp.Met994Thrmissense variantMODERATEcontig14502044012

IGV:Start|Jump

A/G

NGS:0.064

C90:0.478

0.064
FLD

UNIPROT

c.2964C>Ap.Asp988Glumissense variantMODERATEcontig14502044029

IGV:Start|Jump

G/T

NGS:0.057

C90:0.464

0.057
FLD

UNIPROT

c.2929T>Cp.Phe977Leumissense variantMODERATEcontig14502044103

IGV:Start|Jump

A/G

NGS:0.026

C90:0.349

0.026
FLD

UNIPROT

c.2869C>Tp.His957Tyrmissense variantMODERATEcontig14502044163

IGV:Start|Jump

G/A

NGS:0.011

C90:0.000

0.011
FLD

UNIPROT

c.2831A>Gp.Glu944Glymissense variantMODERATEcontig14502044201

IGV:Start|Jump

T/C

NGS:0.011

C90:0.000

0.011
FLD

UNIPROT

c.125G>Ap.Ser42Asnmissense variantMODERATEcontig14502047909

IGV:Start|Jump

C/T

NGS:0.037

C90:0.388

0.037
AAE1-3

UNIPROT

c.667G>Ap.Val223Ilemissense variantMODERATEcontig9761083187

IGV:Start|Jump

C/T

NGS:0.048

C90:0.000

0.048
AAE1-3

UNIPROT

c.634G>Cp.Gly212Argmissense variantMODERATEcontig9761083220

IGV:Start|Jump

C/G

NGS:0.116

C90:0.000

0.116
AAE1-3

UNIPROT

c.475G>Ap.Gly159Argmissense variantMODERATEcontig9761083550

IGV:Start|Jump

C/T

NGS:0.048

C90:0.000

0.048
AAE1-3

UNIPROT

c.416T>Cp.Leu139Promissense variantMODERATEcontig9761083609

IGV:Start|Jump

A/G

NGS:0.061

C90:0.000

0.061
AAE1-3

UNIPROT

c.382T>Cp.Tyr128Hismissense variantMODERATEcontig9761083643

IGV:Start|Jump

A/G

NGS:0.072

C90:0.000

0.072
AAE1-3

UNIPROT

c.296C>Tp.Pro99Leumissense variantMODERATEcontig9761083729

IGV:Start|Jump

G/A

NGS:0.046

C90:0.000

0.046
AAE1-3

UNIPROT

c.293A>Gp.Asp98Glymissense variantMODERATEcontig9761083732

IGV:Start|Jump

T/C

NGS:0.068

C90:0.000

0.068
AAE1-3

UNIPROT

c.284A>Tp.Glu95Valmissense variantMODERATEcontig9761083741

IGV:Start|Jump

T/A

NGS:0.053

C90:0.000

0.053
AAE1-3

UNIPROT

c.181G>Ap.Val61Ilemissense variantMODERATEcontig9761083894

IGV:Start|Jump

C/T

NGS:0.055

C90:0.000

0.055
AAE1-3

UNIPROT

c.167A>Gp.Glu56Glymissense variantMODERATEcontig9761083908

IGV:Start|Jump

T/C

NGS:0.070

C90:0.000

0.07
AAE1-3

UNIPROT

c.125A>Gp.Glu42Glymissense variantMODERATEcontig9761083950

IGV:Start|Jump

T/C

NGS:0.064

C90:0.000

0.064
AAE1-3

UNIPROT

c.79A>Gp.Thr27Alamissense variantMODERATEcontig9761083996

IGV:Start|Jump

T/C

NGS:0.068

C90:0.000

0.068
AAE1-3

UNIPROT

c.52G>Ap.Gly18Sermissense variantMODERATEcontig9761084023

IGV:Start|Jump

C/T

NGS:0.064

C90:0.000

0.064
AAE1-3

UNIPROT

c.3G>Ap.Met1?start lostHIGHcontig9761084072

IGV:Start|Jump

C/T

NGS:0.046

C90:0.416

0.046
FAD7A-1

UNIPROT

c.*341_*343-7delATATATATATATATATAGsplice donor variant&splice region variant&3 prime UTR variant&intron variantHIGHcontig51071468

IGV:Start|Jump

TATATATATATATATATAG/T

NGS:0.013

C90:0.000

0.013
PIE1-1

UNIPROT

c.773A>Gp.Asn258Sermissense variant&splice region variantMODERATEcontig12252279897

IGV:Start|Jump

A/G

NGS:0.033

C90:0.895

0.033
PIE1-1

UNIPROT

c.811T>Cp.Tyr271Hismissense variantMODERATEcontig12252279935

IGV:Start|Jump

T/C

NGS:0.026

C90:0.742

0.026
PIE1-1

UNIPROT

c.815C>Tp.Pro272Leumissense variantMODERATEcontig12252279939

IGV:Start|Jump

C/T

NGS:0.029

C90:0.885

0.029
PIE1-1

UNIPROT

c.1007-2A>Tsplice acceptor variant&intron variantHIGHcontig12252281265

IGV:Start|Jump

A/T

NGS:0.002

C90:0.000

0.002
PIE1-1

UNIPROT

c.1124_1153dupATGTGGGTGAACCAACCCAGATGGAGGATAp.Asn375_Asp384dupdisruptive inframe insertionMODERATEcontig12252281360

IGV:Start|Jump

A/ATGAACCAACCCAGATGGAGGATAATGTGGG

NGS:0.011

C90:0.000

0.011
PIE1-1

UNIPROT

c.1222C>Gp.Gln408Glumissense variantMODERATEcontig12252281482

IGV:Start|Jump

C/G

NGS:0.096

C90:0.852

0.096
PIE1-1

UNIPROT

c.1754C>Tp.Ala585Valmissense variantMODERATEcontig12252282182

IGV:Start|Jump

C/T

NGS:0.004

C90:0.000

0.004
PIE1-1

UNIPROT

c.3442C>Tp.Arg1148Cysmissense variantMODERATEcontig12252285057

IGV:Start|Jump

C/T

NGS:0.002

C90:0.000

0.002
PIE1-1

UNIPROT

c.3619G>Ap.Val1207Metmissense variantMODERATEcontig12252285234

IGV:Start|Jump

G/A

NGS:0.042

C90:0.000

0.042
GGR

UNIPROT

c.32C>Ap.Thr11Lysmissense variantMODERATEcontig2282549024

IGV:Start|Jump

C/A

NGS:0.009

C90:0.000

0.009
GGR

UNIPROT

c.317C>Tp.Pro106Leumissense variantMODERATEcontig2282549309

IGV:Start|Jump

C/T

NGS:0.035

C90:0.220

0.035
GGR

UNIPROT

c.358_359delGCp.Ala120fsframeshift variantHIGHcontig2282549348

IGV:Start|Jump

ACG/A

NGS:0.009

C90:0.000

0.009
GGR

UNIPROT

c.382C>Tp.Leu128Phemissense variantMODERATEcontig2282549374

IGV:Start|Jump

C/T

NGS:0.024

C90:0.000

0.024
GGR

UNIPROT

c.456T>Ap.His152Glnmissense variantMODERATEcontig2282549448

IGV:Start|Jump

T/A

NGS:0.068

C90:0.000

0.068
GGR

UNIPROT

c.460G>Ap.Asp154Asnmissense variantMODERATEcontig2282549452

IGV:Start|Jump

G/A

NGS:0.070

C90:0.000

0.07
GGR

UNIPROT

c.514A>Tp.Ile172Phemissense variantMODERATEcontig2282549506

IGV:Start|Jump

A/T

NGS:0.004

C90:0.000

0.004
GGR

UNIPROT

c.541G>Ap.Val181Ilemissense variantMODERATEcontig2282549533

IGV:Start|Jump

G/A

NGS:0.009

C90:0.000

0.009
GGR

UNIPROT

c.704A>Tp.His235Leumissense variantMODERATEcontig2282549696

IGV:Start|Jump

A/T

NGS:0.121

C90:0.000

0.121
PKSB-3

UNIPROT

c.1880_1891delATGGCCATGGCCp.His627_Gly630deldisruptive inframe deletionMODERATEcontig933339981

IGV:Start|Jump

CTGGCCATGGCCA/C

NGS:0.004

C90:0.000

0.004
PKSB-3

UNIPROT

c.1901C>Gp.Ala634Glymissense variantMODERATEcontig933340008

IGV:Start|Jump

C/G

NGS:0.059

C90:0.000

0.059


NEAREST GENETIC RELATIVES TO Feral:
# Relative Genetic Distance
1 RSP10892-Feral 3.79
2 RSP10891-Feral 4.66
3 RSP10890-Feral 5.25
4 RSP11206-Feral 7.08
5 RSP11039-Carmagnola 7.11
6 RSP11210-Tiborszallasie 7.27
7 RSP10981-USO 31 7.31
8 RSP11044-Tisza 7.35
9 RSP11037-Carmagnola 7.38
10 RSP10977-Carmagnola 7.38
11 RSP11209-Eletta Campana 7.4
12 RSP11045-Tisza 7.42
13 RSP10983-USO 31 7.46
14 RSP11204-Carmagnola USO 31 7.46
15 RSP10658-Lovrin 7.49
16 RSP10664-Futura 75 7.54
17 RSP10661-Fedora 17 7.58
18 RSP10668-Ivory 7.66
19 RSP10056-Santhica27 7.7
20 RSP11052-KYRG-151 7.71
NEAREST GENETIC RELATIVES TO BASE TREE:
# Relative Genetic Distance
1 RSP10890-Feral 5.28
2 RSP11044-Tisza 7.37
3 RSP11037-Carmagnola 7.45
4 RSP10981-USO 31 7.49
5 RSP10668-Ivory 7.57
6 RSP10661-Fedora 17 7.7
7 RSP10658-Lovrin 7.75
8 RSP10664-Futura 75 7.76
9 RSP10241-Monoica 7.88
10 RSP10659-Tisza 7.89
11 RSP11047-Santhica27 7.91
12 RSP10979-Carmagnola 8.05
13 RSP11051-KYRG-11 8.34
14 RSP10667-Tygra 8.46
15 RSP11054-Kyrgyz Gold 8.46
16 RSP10653-Jiangji 8.95
17 RSP10997-Kimbo Slice 9.6
18 RSP10837-Skywalker OG 9.82
19 RSP11121-RKM-2018-029 9.83
20 RSP10755-Recon 9.86
NEAREST GENETIC RELATIVES IN PHYLOS DATASET:
Phylos Strain Number of Overlapping SNPs Concordance
SRR8346962 95 57

Blockchain Registration Information:

Transaction ID: 5e348673058ffe6151230e1086303bed32130270bc0eb23f4d32da11fe2138b0
Stamping Certificate: PDF
SHASUM Hash: 970e023c274bc755591a7b8b40091d3805ea11f1a3701e8ff660035062ca6c2f