Carmaleonte

RSP 11207

Grower: John McKay-Colorado State University

General Information

Sample Name
Carmal_1_2016_CSU
Accession Date
June 26, 2019
Reported Plant Sex
unknown

The strain rarity visualization shows how distant the strain is from the other cultivars in the Kannapedia database. The y-axis represents genetic distance, getting farther as you go up. The width of the visualization at any position along the y-axis shows how many strains there are in the database at that genetic distance. So, a common strain will have a more bottom-heavy shape, while uncommon and rare cultivars will have a visualization that is generally shifted towards the top.

Rarity: Rare
Most Distant Most Similar

Chemical Information

Cannabinoid and terpenoid information provided by the grower.

Cannabinoids

No information provided.

Terpenoids

No information provided.

Genetic Information

Plant Type
Type III

The bell curve in the heterozygosity visualization shows the distribution of heterozygosity levels for cannabis cultivars in the Kannapedia database. The green line shows where this particular strain fits within the distribution. Heterozygosity is associated with heterosis (aka hybrid vigor) but also leads to the production of more variable offspring. When plants have two genetically different parents, heterozygosity levels will be higher than if it has been inbred or backcrossed repeatedly.

Heterozygosity: 2.19%
Least Heterozygous Most Heterozygous

This chart represents the Illumina sequence coverage over the Bt/Bd allele. These are the three regions in the cannabis genome that impact THCA, CBDA, CBGA production. Coverage over the Active CBDAS gene is highly correlated with Type II and Type III plants as described by Etienne de Meijer. Coverage over the THCA gene is highly correlated with Type I and Type II plants but is anti-correlated with Type III plants. Type I plants require coverage over the inactive CBDA loci and no coverage over the Active CBDA gene. Lack of coverage over the Active CBDA and Active THCA allele are presumed to be Type IV plants (CBGA dominant). While deletions of entire THCAS and CBDAS genes are the most common Bt:Bd alleles observed, it is possible to have plants with these genes where functional expression of the enzyme is disrupted by deactivating point mutations (Kojoma et al. 2006).

Bt/Bd Allele Coverage

This chart represents the Illumina sequence coverage over the CBCA synthase gene.

CBCAS Coverage

Variants (THCAS, CBDAS, and CBCAS)

CBDAS c.8G>A p.Cys3Tyr missense variant moderate contig1772 2082234

IGV: Start, Jump

G/A
NGS:
0.057
C90:
0.000
CBDAS c.221C>G p.Thr74Ser missense variant moderate contig1772 2082447

IGV: Start, Jump

C/G
NGS:
0.136
C90:
0.057
CBDAS c.503A>G p.Asn168Ser missense variant moderate contig1772 2082729

IGV: Start, Jump

A/G
NGS:
0.024
C90:
0.062
CBDAS c.587A>G p.Asn196Ser missense variant moderate contig1772 2082813

IGV: Start, Jump

A/G
NGS:
0.011
C90:
0.435
CBDAS c.1420A>C p.Lys474Gln missense variant moderate contig1772 2083646

IGV: Start, Jump

A/C
NGS:
0.132
C90:
0.813
CBDAS c.1628G>A p.Arg543His missense variant moderate contig1772 2083854

IGV: Start, Jump

G/A
NGS:
0.033
C90:
0.000

Variants (Select Genes of Interest)

PKSA-3b

UniProt

c.298G>A p.Ala100Thr missense variant moderate contig705 2271640

IGV: Start, Jump

C/T
NGS:
0.044
C90:
0.177
GPPs1

UniProt

c.744C>G p.Asp248Glu missense variant moderate contig676 168993

IGV: Start, Jump

C/G
NGS:
0.022
C90:
0.000
GPPs1

UniProt

c.845_848delAAAG p.Glu282fs frameshift variant high contig676 169629

IGV: Start, Jump

TGAAA/T
NGS:
0.118
C90:
0.000
GPPs1

UniProt

c.896A>G p.Asn299Ser missense variant moderate contig676 169772

IGV: Start, Jump

A/G
NGS:
0.046
C90:
0.000
EMF1-2

UniProt

c.710A>C p.His237Pro missense variant moderate contig885 810

IGV: Start, Jump

A/C
NGS:
0.090
C90:
0.474
EMF1-2

UniProt

c.1187T>C p.Leu396Ser missense variant moderate contig885 2073

IGV: Start, Jump

T/C
NGS:
0.026
C90:
0.000
EMF1-2

UniProt

c.2256A>T p.Lys752Asn missense variant moderate contig885 3142

IGV: Start, Jump

A/T
NGS:
0.026
C90:
0.000
PHL-2 c.44G>A p.Arg15Lys missense variant moderate contig2621 337613

IGV: Start, Jump

G/A
NGS:
0.015
C90:
0.167
PHL-2 c.455A>C p.Asp152Ala missense variant moderate contig2621 339191

IGV: Start, Jump

A/C
NGS:
0.018
C90:
0.507
PHL-2 c.932T>C p.Leu311Pro missense variant moderate contig2621 340210

IGV: Start, Jump

T/C
NGS:
0.039
C90:
0.268
PHL-2 c.977A>C p.His326Pro missense variant moderate contig2621 340255

IGV: Start, Jump

A/C
NGS:
0.007
C90:
0.000
PHL-2 c.1057A>G p.Arg353Gly missense variant moderate contig2621 340335

IGV: Start, Jump

A/G
NGS:
0.096
C90:
0.555
PHL-2 c.1096G>A p.Ala366Thr missense variant moderate contig2621 340374

IGV: Start, Jump

G/A
NGS:
0.090
C90:
0.531
PHL-2 c.1837G>A p.Glu613Lys missense variant moderate contig2621 341115

IGV: Start, Jump

G/A
NGS:
0.009
C90:
0.000
PHL-2 c.2564T>A p.Phe855Tyr missense variant moderate contig2621 342607

IGV: Start, Jump

T/A
NGS:
0.064
C90:
0.732
PHL-2 c.2578T>A p.Leu860Ile missense variant moderate contig2621 342621

IGV: Start, Jump

T/A
NGS:
0.068
C90:
0.746
PHL-2 c.2624C>T p.Ser875Phe missense variant moderate contig2621 342667

IGV: Start, Jump

C/T
NGS:
0.042
C90:
0.268
PHL-2 c.2783G>A p.Ser928Asn missense variant moderate contig2621 342826

IGV: Start, Jump

G/A
NGS:
0.107
C90:
0.890
PHL-2 c.2830A>C p.Asn944His missense variant moderate contig2621 342873

IGV: Start, Jump

A/C
NGS:
0.044
C90:
0.000
PHL-2 c.2933G>T p.Arg978Leu missense variant moderate contig2621 342976

IGV: Start, Jump

G/T
NGS:
0.048
C90:
0.297
PHL-2 c.2936T>G p.Val979Gly missense variant moderate contig2621 342979

IGV: Start, Jump

T/G
NGS:
0.048
C90:
0.000
PHL-2 c.3209A>G p.Gln1070Arg missense variant moderate contig2621 343252

IGV: Start, Jump

A/G
NGS:
0.103
C90:
0.885
PHL-2 c.3467A>G p.Gln1156Arg missense variant moderate contig2621 343510

IGV: Start, Jump

A/G
NGS:
0.064
C90:
0.713
PKSG-4a

UniProt

c.49_50insTGG p.Glu16_Gly17insVal disruptive inframe insertion moderate contig700 1936744

IGV: Start, Jump

A/AGGT
NGS:
0.013
C90:
0.000
PKSG-4a

UniProt

c.261_264dupGTAC p.Met89fs frameshift variant high contig700 1937671

IGV: Start, Jump

A/AGTAC
NGS:
0.004
C90:
0.000
PKSG-4a

UniProt

c.617A>G p.Tyr206Cys missense variant moderate contig700 1938028

IGV: Start, Jump

A/G
NGS:
0.075
C90:
0.000
PKSG-4a

UniProt

c.626_628delATA p.Asn209del disruptive inframe deletion moderate contig700 1938032

IGV: Start, Jump

CAAT/C
NGS:
0.075
C90:
0.000
PKSG-4a

UniProt

c.1191_1193delTTA p.Tyr398del disruptive inframe deletion moderate contig700 1938600

IGV: Start, Jump

AATT/A
NGS:
0.167
C90:
0.000
PKSG-2a

UniProt

c.774G>A p.Met258Ile missense variant moderate contig700 1944616

IGV: Start, Jump

C/T
NGS:
0.123
C90:
0.000
PKSG-2a

UniProt

c.67T>A p.Phe23Ile missense variant moderate contig700 1945567

IGV: Start, Jump

A/T
NGS:
0.825
C90:
0.904
PKSG-2b

UniProt

c.1132C>G p.Leu378Val missense variant moderate contig700 1950506

IGV: Start, Jump

G/C
NGS:
0.717
C90:
0.000
PKSG-2b

UniProt

c.1117A>G p.Ile373Val missense variant moderate contig700 1950521

IGV: Start, Jump

T/C
NGS:
0.807
C90:
0.981
PKSG-2b

UniProt

c.31A>T p.Thr11Ser missense variant moderate contig700 1951851

IGV: Start, Jump

T/A
NGS:
0.844
C90:
0.880
PKSG-4b

UniProt

c.558-1G>A splice acceptor variant & intron variant high contig700 2715037

IGV: Start, Jump

C/T
NGS:
0.009
C90:
0.000
PKSG-4b

UniProt

c.535_545delATTGGAGTGGG p.Ile179fs frameshift variant high contig700 2721127

IGV: Start, Jump

CCCCACTCCAAT/C
NGS:
0.105
C90:
0.000
PKSG-4b

UniProt

c.523C>T p.His175Tyr missense variant moderate contig700 2721150

IGV: Start, Jump

G/A
NGS:
0.112
C90:
0.325
PKSG-4b

UniProt

c.489delT p.Phe163fs frameshift variant high contig700 2721183

IGV: Start, Jump

CA/C
NGS:
0.792
C90:
0.761
PKSG-4b

UniProt

c.353_354insCC p.Gly119fs frameshift variant high contig700 2721319

IGV: Start, Jump

T/TGG
NGS:
0.175
C90:
0.000
PKSG-4b

UniProt

c.324A>C p.Glu108Asp missense variant moderate contig700 2721349

IGV: Start, Jump

T/G
NGS:
0.094
C90:
0.000
PKSG-4b

UniProt

c.323A>G p.Glu108Gly missense variant moderate contig700 2721350

IGV: Start, Jump

T/C
NGS:
0.469
C90:
0.000
PKSG-4b

UniProt

c.316+2T>A splice donor variant & intron variant high contig700 2723818

IGV: Start, Jump

A/T
NGS:
0.070
C90:
0.689
PKSG-4b

UniProt

c.238T>C p.Phe80Leu missense variant moderate contig700 2724197

IGV: Start, Jump

A/G
NGS:
0.013
C90:
0.000
DXR-2

UniProt

c.1319T>G p.Ile440Ser missense variant moderate contig380 285250

IGV: Start, Jump

A/C
NGS:
0.004
C90:
0.000
DXR-2

UniProt

c.1319T>C p.Ile440Thr missense variant moderate contig380 285250

IGV: Start, Jump

A/G
NGS:
0.480
C90:
0.000
DXR-2

UniProt

c.431C>G p.Ala144Gly missense variant moderate contig380 287760

IGV: Start, Jump

G/C
NGS:
0.182
C90:
0.550
OAC-2

UniProt

c.260C>G p.Ser87Cys missense variant moderate contig931 109979

IGV: Start, Jump

G/C
NGS:
0.070
C90:
0.000
OAC-2

UniProt

c.185C>T p.Thr62Ile missense variant moderate contig931 110054

IGV: Start, Jump

G/A
NGS:
0.029
C90:
0.000
OAC-2

UniProt

c.175G>A p.Val59Ile missense variant moderate contig931 110064

IGV: Start, Jump

C/T
NGS:
0.024
C90:
0.000
OAC-1

UniProt

c.260C>G p.Ser87Cys missense variant moderate contig931 118104

IGV: Start, Jump

G/C
NGS:
0.053
C90:
0.000
FAD2-2

UniProt

c.161T>A p.Leu54His missense variant moderate contig83 1803208

IGV: Start, Jump

A/T
NGS:
0.156
C90:
0.000
FAD2-2

UniProt

c.126C>A p.Asp42Glu missense variant moderate contig83 1803243

IGV: Start, Jump

G/T
NGS:
0.009
C90:
0.000
FAD2-2

UniProt

c.75C>A p.His25Gln missense variant moderate contig83 1803294

IGV: Start, Jump

G/T
NGS:
0.007
C90:
0.000
ELF4

UniProt

c.144T>A p.Asp48Glu missense variant moderate contig869 622426

IGV: Start, Jump

A/T
NGS:
0.031
C90:
0.000
ELF3

UniProt

c.364_366delAAG p.Lys122del conservative inframe deletion moderate contig97 242066

IGV: Start, Jump

AAAG/A
NGS:
0.004
C90:
0.000
ELF3

UniProt

c.757C>T p.Pro253Ser missense variant moderate contig97 242463

IGV: Start, Jump

C/T
NGS:
0.020
C90:
0.048
ELF3

UniProt

c.772A>G p.Ser258Gly missense variant moderate contig97 242478

IGV: Start, Jump

A/G
NGS:
0.112
C90:
0.000
ELF3

UniProt

c.812G>C p.Gly271Ala missense variant moderate contig97 242518

IGV: Start, Jump

G/C
NGS:
0.114
C90:
0.938
ELF3

UniProt

c.1229+2T>C splice donor variant & intron variant high contig97 243389

IGV: Start, Jump

T/C
NGS:
0.011
C90:
0.000
ELF3

UniProt

c.1366T>G p.Leu456Val missense variant moderate contig97 244197

IGV: Start, Jump

T/G
NGS:
0.015
C90:
0.000
ELF3

UniProt

c.1435G>C p.Ala479Pro missense variant moderate contig97 244266

IGV: Start, Jump

G/C
NGS:
0.004
C90:
0.000
ELF3

UniProt

c.1466G>A p.Ser489Asn missense variant moderate contig97 244297

IGV: Start, Jump

G/A
NGS:
0.123
C90:
0.000
ELF3

UniProt

c.1630A>G p.Thr544Ala missense variant moderate contig97 244461

IGV: Start, Jump

A/G
NGS:
0.103
C90:
0.545
ELF3

UniProt

c.1966C>G p.Pro656Ala missense variant moderate contig97 244797

IGV: Start, Jump

C/G
NGS:
0.123
C90:
0.632
ELF3

UniProt

c.2140C>T p.Pro714Ser missense variant moderate contig97 244971

IGV: Start, Jump

C/T
NGS:
0.018
C90:
0.038
ELF3

UniProt

c.2141C>G p.Pro714Arg missense variant moderate contig97 244972

IGV: Start, Jump

C/G
NGS:
0.088
C90:
0.335
ELF3

UniProt

c.2198G>T p.Arg733Leu missense variant moderate contig97 245029

IGV: Start, Jump

G/T
NGS:
0.125
C90:
0.531
ELF5

UniProt

c.520A>G p.Thr174Ala missense variant moderate contig382 880382

IGV: Start, Jump

A/G
NGS:
0.015
C90:
0.048
aPT4

UniProt

c.97T>C p.Tyr33His missense variant moderate contig121 2828753

IGV: Start, Jump

T/C
NGS:
0.439
C90:
0.000
aPT4

UniProt

c.153A>C p.Lys51Asn missense variant moderate contig121 2828809

IGV: Start, Jump

A/C
NGS:
0.375
C90:
0.000
aPT4

UniProt

c.198A>C p.Lys66Asn missense variant moderate contig121 2828854

IGV: Start, Jump

A/C
NGS:
0.044
C90:
0.000
aPT4

UniProt

c.235_236delGT p.Val79fs frameshift variant high contig121 2829030

IGV: Start, Jump

ATG/A
NGS:
0.417
C90:
0.000
aPT4

UniProt

c.238delT p.Ser80fs frameshift variant high contig121 2829034

IGV: Start, Jump

AT/A
NGS:
0.421
C90:
0.000
aPT1

UniProt

c.95_97delGTT p.Cys32del disruptive inframe deletion moderate contig121 2835800

IGV: Start, Jump

ATGT/A
NGS:
0.118
C90:
0.311
aPT1

UniProt

c.406A>G p.Ile136Val missense variant moderate contig121 2839605

IGV: Start, Jump

A/G
NGS:
0.579
C90:
0.761
HDS-2

UniProt

c.82_93delGTAACCGGAACT p.Val28_Thr31del conservative inframe deletion moderate contig95 1989748

IGV: Start, Jump

CGTAACCGGAACT/C
NGS:
0.805
C90:
0.000
HDS-2

UniProt

c.127T>G p.Ser43Ala missense variant moderate contig95 1989794

IGV: Start, Jump

T/G
NGS:
0.721
C90:
0.000
HDS-2

UniProt

c.679G>C p.Gly227Arg missense variant moderate contig95 1990632

IGV: Start, Jump

G/C
NGS:
0.037
C90:
0.000
AAE1-2

UniProt

c.331A>G p.Asn111Asp missense variant moderate contig81 209293

IGV: Start, Jump

A/G
NGS:
0.123
C90:
0.000
AAE1-2

UniProt

c.1006A>G p.Lys336Glu missense variant moderate contig81 209968

IGV: Start, Jump

A/G
NGS:
0.116
C90:
0.000
AAE1-2

UniProt

c.1415G>A p.Ser472Asn missense variant moderate contig81 210377

IGV: Start, Jump

G/A
NGS:
0.070
C90:
0.000
AAE1-2

UniProt

c.1417A>G p.Thr473Ala missense variant moderate contig81 210379

IGV: Start, Jump

A/G
NGS:
0.070
C90:
0.000
AAE1-2

UniProt

c.1434G>T p.Glu478Asp missense variant moderate contig81 210396

IGV: Start, Jump

G/T
NGS:
0.075
C90:
0.000
AAE1-2

UniProt

c.1541T>C p.Val514Ala missense variant moderate contig81 210503

IGV: Start, Jump

T/C
NGS:
0.050
C90:
0.000
PHL-1

UniProt

c.2623A>G p.Thr875Ala missense variant moderate contig1439 1487174

IGV: Start, Jump

T/C
NGS:
0.123
C90:
0.000
PHL-1

UniProt

c.2551A>G p.Thr851Ala missense variant moderate contig1439 1487246

IGV: Start, Jump

T/C
NGS:
0.116
C90:
0.890
PHL-1

UniProt

c.1387A>G p.Thr463Ala missense variant moderate contig1439 1489811

IGV: Start, Jump

T/C
NGS:
0.107
C90:
0.904
PHL-1

UniProt

c.489A>T p.Lys163Asn missense variant moderate contig1439 1490874

IGV: Start, Jump

T/A
NGS:
0.002
C90:
0.000
Edestin

UniProt

c.16T>C p.Ser6Pro missense variant moderate contig850 3065274

IGV: Start, Jump

A/G
NGS:
0.059
C90:
0.000
TFL1

UniProt

c.302-1G>A splice acceptor variant & intron variant high contig1636 520616

IGV: Start, Jump

C/T
NGS:
0.103
C90:
0.794
FAD4

UniProt

c.121G>T p.Val41Phe missense variant moderate contig784 1690873

IGV: Start, Jump

G/T
NGS:
0.044
C90:
0.000
FAD4

UniProt

c.220C>G p.Arg74Gly missense variant moderate contig784 1690972

IGV: Start, Jump

C/G
NGS:
0.026
C90:
0.000
HDS-1

UniProt

c.1618A>G p.Ile540Val missense variant moderate contig1891 885936

IGV: Start, Jump

T/C
NGS:
0.099
C90:
0.861
HDS-1

UniProt

c.136G>A p.Val46Ile missense variant moderate contig1891 889256

IGV: Start, Jump

C/T
NGS:
0.088
C90:
0.593
HDS-1

UniProt

c.56C>G p.Ala19Gly missense variant moderate contig1891 889336

IGV: Start, Jump

G/C
NGS:
0.125
C90:
0.943
HDS-1

UniProt

c.35G>A p.Cys12Tyr missense variant moderate contig1891 889357

IGV: Start, Jump

C/T
NGS:
0.094
C90:
0.646
HDS-1

UniProt

c.-108+1_-108+2insG splice donor variant & intron variant high contig1891 889975

IGV: Start, Jump

A/AC
NGS:
0.217
C90:
0.000
PIE1-2

UniProt

c.6817G>A p.Glu2273Lys missense variant moderate contig1460 1184270

IGV: Start, Jump

C/T
NGS:
0.002
C90:
0.000
PIE1-2

UniProt

c.6653A>G p.Asn2218Ser missense variant moderate contig1460 1184434

IGV: Start, Jump

T/C
NGS:
0.059
C90:
0.928
PIE1-2

UniProt

c.5932A>G p.Ile1978Val missense variant moderate contig1460 1185552

IGV: Start, Jump

T/C
NGS:
0.061
C90:
0.268
PIE1-2

UniProt

c.2083_2085delGTC p.Val695del conservative inframe deletion moderate contig1460 1189954

IGV: Start, Jump

GGAC/G
NGS:
0.046
C90:
0.880
PIE1-2

UniProt

c.2072A>G p.His691Arg missense variant moderate contig1460 1189968

IGV: Start, Jump

T/C
NGS:
0.046
C90:
0.789
PIE1-2

UniProt

c.1872T>A p.Asp624Glu missense variant moderate contig1460 1190252

IGV: Start, Jump

A/T
NGS:
0.086
C90:
0.990
PIE1-2

UniProt

c.1630G>C p.Ala544Pro missense variant moderate contig1460 1191600

IGV: Start, Jump

C/G
NGS:
0.070
C90:
0.933
PIE1-2

UniProt

c.1289A>G p.Asp430Gly missense variant moderate contig1460 1192109

IGV: Start, Jump

T/C
NGS:
0.079
C90:
0.000
PIE1-2

UniProt

c.1019_1048dupATGTGGGTGAACCAACCCAGATGGAGGATA p.Asn340_Asp349dup conservative inframe insertion moderate contig1460 1192349

IGV: Start, Jump

C/CTATCCTCCATCTGGGTTGGTTCACCCACAT
NGS:
0.009
C90:
0.000
PIE1-2

UniProt

c.982G>A p.Glu328Lys missense variant moderate contig1460 1192416

IGV: Start, Jump

C/T
NGS:
0.050
C90:
0.976
PIE1-2

UniProt

c.710C>T p.Pro237Leu missense variant moderate contig1460 1193804

IGV: Start, Jump

G/A
NGS:
0.072
C90:
0.866
PIE1-2

UniProt

c.706T>C p.Tyr236His missense variant moderate contig1460 1193808

IGV: Start, Jump

A/G
NGS:
0.059
C90:
0.737
PIE1-2

UniProt

c.637T>A p.Ser213Thr missense variant moderate contig1460 1194421

IGV: Start, Jump

A/T
NGS:
0.079
C90:
0.885
EMF2

UniProt

c.722C>T p.Thr241Ile missense variant moderate contig954 3050302

IGV: Start, Jump

C/T
NGS:
0.018
C90:
0.062
EMF2

UniProt

c.1205C>T p.Ala402Val missense variant & splice region variant moderate contig954 3055694

IGV: Start, Jump

C/T
NGS:
0.015
C90:
0.053
EMF2

UniProt

c.1228A>G p.Ser410Gly missense variant moderate contig954 3055717

IGV: Start, Jump

A/G
NGS:
0.015
C90:
0.000
EMF2

UniProt

c.1315G>C p.Ala439Pro missense variant moderate contig954 3055804

IGV: Start, Jump

G/C
NGS:
0.015
C90:
0.053
EMF2

UniProt

c.1772A>G p.Gln591Arg missense variant moderate contig954 3059929

IGV: Start, Jump

A/G
NGS:
0.092
C90:
0.876
EMF1-1

UniProt

c.242A>G p.Lys81Arg missense variant moderate contig883 269731

IGV: Start, Jump

A/G
NGS:
0.022
C90:
0.053
FT

UniProt

c.29_43dupATAATAATAATAATA p.Asn10_Asn14dup disruptive inframe insertion moderate contig1561 3124441

IGV: Start, Jump

T/TTAATAATAATAATAA
NGS:
0.026
C90:
0.000
FT

UniProt

c.26_43dupATAATAATAATAATAATA p.Asn9_Asn14dup disruptive inframe insertion moderate contig1561 3124441

IGV: Start, Jump

T/TTAATAATAATAATAATAA
NGS:
0.004
C90:
0.000
FLD

UniProt

c.2981T>C p.Met994Thr missense variant moderate contig1450 2044012

IGV: Start, Jump

A/G
NGS:
0.064
C90:
0.478
FLD

UniProt

c.2964C>A p.Asp988Glu missense variant moderate contig1450 2044029

IGV: Start, Jump

G/T
NGS:
0.057
C90:
0.464
FLD

UniProt

c.2953G>A p.Ala985Thr missense variant moderate contig1450 2044040

IGV: Start, Jump

C/T
NGS:
0.002
C90:
0.000
FLD

UniProt

c.2869C>T p.His957Tyr missense variant moderate contig1450 2044163

IGV: Start, Jump

G/A
NGS:
0.011
C90:
0.000
FLD

UniProt

c.2831A>G p.Glu944Gly missense variant moderate contig1450 2044201

IGV: Start, Jump

T/C
NGS:
0.011
C90:
0.000
FLD

UniProt

c.2686G>A p.Ala896Thr missense variant moderate contig1450 2044848

IGV: Start, Jump

C/T
NGS:
0.035
C90:
0.225
FLD

UniProt

c.2681T>C p.Ile894Thr missense variant moderate contig1450 2044853

IGV: Start, Jump

A/G
NGS:
0.020
C90:
0.144
AAE1-3

UniProt

c.715G>A p.Val239Ile missense variant moderate contig976 1083139

IGV: Start, Jump

C/T
NGS:
0.002
C90:
0.000
AAE1-3

UniProt

c.655C>T p.Pro219Ser missense variant moderate contig976 1083199

IGV: Start, Jump

G/A
NGS:
0.007
C90:
0.000
AAE1-3

UniProt

c.635G>A p.Gly212Asp missense variant moderate contig976 1083219

IGV: Start, Jump

C/T
NGS:
0.007
C90:
0.000
AAE1-3

UniProt

c.634G>C p.Gly212Arg missense variant moderate contig976 1083220

IGV: Start, Jump

C/G
NGS:
0.116
C90:
0.000
AAE1-3

UniProt

c.483_484insACT p.Thr161dup conservative inframe insertion moderate contig976 1083541

IGV: Start, Jump

C/CAGT
NGS:
0.002
C90:
0.000
AAE1-3

UniProt

c.480_481insCACGTAAAAATCCTCCTCTTAATTTCTTACAGCTCTTTAATCTTTTACTATTTTATTGGTTGCTGAAAACCTCGGTCA p.Asn160_Thr161insHisValLysIleLeuLeuLeuIleSerTyrSerSerLeuIlePheTyrTyrPheIleGlyCysTerLysProArgSer stop gained & conservative inframe insertion high contig976 1083544

IGV: Start, Jump

T/TTGACCGAGGTTTTCAGCAACCAATAAAATAGTAAAAGATTAAAGAGCTGTAAGAAATTAAGAGGAGGATTTTTACGTG
NGS:
0.002
C90:
0.000
AAE1-3

UniProt

c.425T>C p.Leu142Pro missense variant moderate contig976 1083600

IGV: Start, Jump

A/G
NGS:
0.002
C90:
0.000
AAE1-3

UniProt

c.416T>C p.Leu139Pro missense variant moderate contig976 1083609

IGV: Start, Jump

A/G
NGS:
0.061
C90:
0.000
AAE1-3

UniProt

c.403G>T p.Asp135Tyr missense variant moderate contig976 1083622

IGV: Start, Jump

C/A
NGS:
0.007
C90:
0.000
AAE1-3

UniProt

c.382T>C p.Tyr128His missense variant moderate contig976 1083643

IGV: Start, Jump

A/G
NGS:
0.072
C90:
0.000
AAE1-3

UniProt

c.367C>T p.Arg123Trp missense variant moderate contig976 1083658

IGV: Start, Jump

G/A
NGS:
0.007
C90:
0.000
AAE1-3

UniProt

c.293A>G p.Asp98Gly missense variant moderate contig976 1083732

IGV: Start, Jump

T/C
NGS:
0.068
C90:
0.000
AAE1-3

UniProt

c.267T>G p.His89Gln missense variant moderate contig976 1083758

IGV: Start, Jump

A/C
NGS:
0.007
C90:
0.000
AAE1-3

UniProt

c.224C>T p.Pro75Leu missense variant moderate contig976 1083851

IGV: Start, Jump

G/A
NGS:
0.007
C90:
0.000
AAE1-3

UniProt

c.208G>C p.Ala70Pro missense variant moderate contig976 1083867

IGV: Start, Jump

C/G
NGS:
0.007
C90:
0.000
AAE1-3

UniProt

c.167A>G p.Glu56Gly missense variant moderate contig976 1083908

IGV: Start, Jump

T/C
NGS:
0.070
C90:
0.000
AAE1-3

UniProt

c.154G>A p.Val52Ile missense variant moderate contig976 1083921

IGV: Start, Jump

C/T
NGS:
0.007
C90:
0.000
AAE1-3

UniProt

c.101A>G p.Tyr34Cys missense variant moderate contig976 1083974

IGV: Start, Jump

T/C
NGS:
0.007
C90:
0.000
AAE1-3

UniProt

c.79A>G p.Thr27Ala missense variant moderate contig976 1083996

IGV: Start, Jump

T/C
NGS:
0.068
C90:
0.000
AAE1-3

UniProt

c.12G>A p.Met4Ile missense variant moderate contig976 1084063

IGV: Start, Jump

C/T
NGS:
0.007
C90:
0.000
AAE1-3

UniProt

c.11T>C p.Met4Thr missense variant moderate contig976 1084064

IGV: Start, Jump

A/G
NGS:
0.007
C90:
0.000
FAD7A-1

UniProt

c.*320_*342+3delTCTCTCTCTCTCTCTCTCTCTATATA splice donor variant & splice region variant & 3 prime UTR variant & intron variant high contig510 71447

IGV: Start, Jump

CTCTCTCTCTCTCTCTCTCTCTATATA/C
NGS:
0.002
C90:
0.000
FAD7A-1

UniProt

c.*342+1A>C splice donor variant & intron variant high contig510 71471

IGV: Start, Jump

A/C
NGS:
0.004
C90:
0.000
PIE1-1

UniProt

c.773A>G p.Asn258Ser missense variant & splice region variant moderate contig1225 2279897

IGV: Start, Jump

A/G
NGS:
0.033
C90:
0.895
PIE1-1

UniProt

c.811T>C p.Tyr271His missense variant moderate contig1225 2279935

IGV: Start, Jump

T/C
NGS:
0.026
C90:
0.742
PIE1-1

UniProt

c.1124_1153dupATGTGGGTGAACCAACCCAGATGGAGGATA p.Asn375_Asp384dup disruptive inframe insertion moderate contig1225 2281360

IGV: Start, Jump

A/ATGAACCAACCCAGATGGAGGATAATGTGGG
NGS:
0.011
C90:
0.000
PIE1-1

UniProt

c.1222C>G p.Gln408Glu missense variant moderate contig1225 2281482

IGV: Start, Jump

C/G
NGS:
0.096
C90:
0.852
PIE1-1

UniProt

c.3619G>A p.Val1207Met missense variant moderate contig1225 2285234

IGV: Start, Jump

G/A
NGS:
0.042
C90:
0.000
GGR

UniProt

c.32C>A p.Thr11Lys missense variant moderate contig2282 549024

IGV: Start, Jump

C/A
NGS:
0.009
C90:
0.000
GGR

UniProt

c.317C>T p.Pro106Leu missense variant moderate contig2282 549309

IGV: Start, Jump

C/T
NGS:
0.035
C90:
0.220
GGR

UniProt

c.358_359delGC p.Ala120fs frameshift variant high contig2282 549348

IGV: Start, Jump

ACG/A
NGS:
0.009
C90:
0.000
GGR

UniProt

c.362A>T p.Tyr121Phe missense variant moderate contig2282 549354

IGV: Start, Jump

A/T
NGS:
0.029
C90:
0.000
GGR

UniProt

c.382C>T p.Leu128Phe missense variant moderate contig2282 549374

IGV: Start, Jump

C/T
NGS:
0.024
C90:
0.000
GGR

UniProt

c.456T>A p.His152Gln missense variant moderate contig2282 549448

IGV: Start, Jump

T/A
NGS:
0.068
C90:
0.000
GGR

UniProt

c.460G>A p.Asp154Asn missense variant moderate contig2282 549452

IGV: Start, Jump

G/A
NGS:
0.070
C90:
0.000
GGR

UniProt

c.541G>A p.Val181Ile missense variant moderate contig2282 549533

IGV: Start, Jump

G/A
NGS:
0.009
C90:
0.000
GGR

UniProt

c.704A>T p.His235Leu missense variant moderate contig2282 549696

IGV: Start, Jump

A/T
NGS:
0.121
C90:
0.000
PKSB-3

UniProt

c.509T>C p.Val170Ala missense variant & splice region variant moderate contig93 3336743

IGV: Start, Jump

T/C
NGS:
0.011
C90:
0.000
PKSB-3

UniProt

c.1490C>T p.Ala497Val missense variant moderate contig93 3339597

IGV: Start, Jump

C/T
NGS:
0.011
C90:
0.000
PKSB-3

UniProt

c.1652A>G p.Glu551Gly missense variant moderate contig93 3339759

IGV: Start, Jump

A/G
NGS:
0.088
C90:
0.000
PKSB-3

UniProt

c.1848G>A p.Met616Ile missense variant moderate contig93 3339955

IGV: Start, Jump

G/A
NGS:
0.009
C90:
0.000

Nearest genetic relative in Phylos dataset

Phylos Strain SRR4448780
Overlapping SNPs:
43
Concordance:
32

Nearest genetic relative in Lynch dataset

Lynch Strain SRR3495250
Overlapping SNPs:
2
Concordance:
2

Blockchain Registration Information

Transaction ID
45ff8e8575eb5ea2f4ab0fe44cde6335a43ae74fe6bd86c0a6f837d696c0e416
Stamping Certificate
Download PDF (857.9 KB)
SHASUM Hash
404a96e1ef5f11a615c3b64929b3695336890a458eebf34e33e5247f2e22b837
QR code for RSP11207

Kannapedia uses cookies

By clicking Allow All, you agree to the storing of cookies on your device to enhance site navigation, analyze site usage, and assist in our marketing efforts.

Customize Settings