Unknown-(Cherry Wine)-(005)

RSP11272
StrainSEEK Cannabis Certification Report

Accession Date:

September 27, 2019

General Information

Strain: Unknown-(Cherry Wine)-(005)
Sample: Morning Star-005
RSP ID: RSP11272
Grower: Keaton Baker
Accession Date: September 27, 2019
Gender: Female
Strain Seek Version: V2


What does this visualization mean?

Chemical Information*


Cannabinoid and Terpenoid information provided by our Partner Labs.

CANNABINOIDS

THC + THCA %: N/A
CBD + CBDA %: N/A
THCV + THCVA %: N/A
CBC + CBCA %: N/A
CBG + CBGA %: N/A
CBN + CBNA %: N/A

TERPENOIDS

  • α-Bisabolol %: N/A
    Borneol %: N/A
    Camphene %: N/A
    Carene %: N/A
    Caryophyllene oxide %: N/A
    β-Carophyllene %: N/A
    Fenchol %: N/A
    Geraniol %: N/A
    α-Humulene %: N/A
    Limonene %: N/A
    Linalool %: N/A
  • Myrcene %: N/A
    α-Phellandrene %: N/A
    Terpinolene %: N/A
    α-Terpineol %: N/A
    α-Terpinene %: N/A
    γ-Terpinene %: N/A
    Total Nerolidol %: N/A
    Total Ocimene %: N/A
    α-Pinene %: N/A
    β-Pinene %: N/A

Genetic Information

View this strain on the Phylotree
Percent Heterozygosity: 1.76
Download VCF file: Here
Download FastQ Files: Read 1 Read 2
Download BAM file: BAM index
Download Annotated Variants: ANNOTATED VCF index
Plant Type: Type III

Bt/Bd ALLELE COVERAGE

What does this visualization mean?

CBCAS COVERAGE


What does this visualization mean?

Y-RATIO DISTRIBUTION


What does this visualization mean?


VARIANTS (THCAS, CBDAS, and CBCAS)

Gene HGVS.c HGVS.p Annotation Annotation Impact Contig Contig Pos Ref/Alt Var Freq
CBDASc.8G>Ap.Cys3Tyrmissense variantMODERATEcontig17722082234

IGV:Start|Jump

G/A

NGS:0.057

C90:0.000

0.057
CBDASc.221C>Gp.Thr74Sermissense variantMODERATEcontig17722082447

IGV:Start|Jump

C/G

NGS:0.136

C90:0.057

0.136
CBDASc.1420A>Cp.Lys474Glnmissense variantMODERATEcontig17722083646

IGV:Start|Jump

A/C

NGS:0.132

C90:0.813

0.132



VARIANTS (SELECT GENES OF INTEREST)

Gene HGVS.c HGVS.p Annotation Annotation Impact Contig Contig Pos Ref/Alt Var Freq
GPPs1

UNIPROT

c.845_848delAAAGp.Glu282fsframeshift variantHIGHcontig676169629

IGV:Start|Jump

TGAAA/T

NGS:0.118

C90:0.000

0.118
PKSG-4a

UNIPROT

c.493G>Ap.Gly165Sermissense variantMODERATEcontig7001937904

IGV:Start|Jump

G/A

NGS:0.103

C90:0.000

0.103
PKSG-4a

UNIPROT

c.1191_1193delTTAp.Tyr398deldisruptive inframe deletionMODERATEcontig7001938600

IGV:Start|Jump

AATT/A

NGS:0.167

C90:0.000

0.167
PKSG-2a

UNIPROT

c.67T>Ap.Phe23Ilemissense variantMODERATEcontig7001945567

IGV:Start|Jump

A/T

NGS:0.825

C90:0.904

0.825
PKSG-2a

UNIPROT

c.31A>Tp.Thr11Sermissense variantMODERATEcontig7001945603

IGV:Start|Jump

T/A

NGS:0.763

C90:0.876

0.763
PKSG-2b

UNIPROT

c.1117A>Gp.Ile373Valmissense variantMODERATEcontig7001950521

IGV:Start|Jump

T/C

NGS:0.807

C90:0.981

0.807
PKSG-2b

UNIPROT

c.774G>Ap.Met258Ilemissense variantMODERATEcontig7001950864

IGV:Start|Jump

C/T

NGS:0.366

C90:0.947

0.366
PKSG-2b

UNIPROT

c.31A>Tp.Thr11Sermissense variantMODERATEcontig7001951851

IGV:Start|Jump

T/A

NGS:0.844

C90:0.880

0.844
PKSG-4b

UNIPROT

c.496A>Gp.Lys166Glumissense variantMODERATEcontig7002721177

IGV:Start|Jump

T/C

NGS:0.651

C90:0.684

0.651
PKSG-4b

UNIPROT

c.489delTp.Phe163fsframeshift variantHIGHcontig7002721183

IGV:Start|Jump

CA/C

NGS:0.792

C90:0.761

0.792
PKSG-4b

UNIPROT

c.485A>Gp.Lys162Argmissense variantMODERATEcontig7002721188

IGV:Start|Jump

T/C

NGS:0.643

C90:0.301

0.643
PKSG-4b

UNIPROT

c.431T>Gp.Val144Glymissense variantMODERATEcontig7002721242

IGV:Start|Jump

A/C

NGS:0.575

C90:0.679

0.575
PKSG-4b

UNIPROT

c.419A>Gp.Asp140Glymissense variantMODERATEcontig7002721254

IGV:Start|Jump

T/C

NGS:0.430

C90:0.440

0.43
PKSG-4b

UNIPROT

c.352_355delACAGp.Thr118fsframeshift variantHIGHcontig7002721317

IGV:Start|Jump

CCTGT/C

NGS:0.529

C90:0.000

0.529
PKSG-4b

UNIPROT

c.324A>Cp.Glu108Aspmissense variantMODERATEcontig7002721349

IGV:Start|Jump

T/G

NGS:0.094

C90:0.000

0.094
PKSG-4b

UNIPROT

c.323A>Gp.Glu108Glymissense variantMODERATEcontig7002721350

IGV:Start|Jump

T/C

NGS:0.469

C90:0.000

0.469
DXR-2

UNIPROT

c.1319T>Cp.Ile440Thrmissense variantMODERATEcontig380285250

IGV:Start|Jump

A/G

NGS:0.480

C90:0.000

0.48
aPT4

UNIPROT

c.97T>Cp.Tyr33Hismissense variantMODERATEcontig1212828753

IGV:Start|Jump

T/C

NGS:0.439

C90:0.000

0.439
aPT4

UNIPROT

c.153A>Cp.Lys51Asnmissense variantMODERATEcontig1212828809

IGV:Start|Jump

A/C

NGS:0.375

C90:0.000

0.375
aPT4

UNIPROT

c.235_236delGTp.Val79fsframeshift variantHIGHcontig1212829030

IGV:Start|Jump

ATG/A

NGS:0.417

C90:0.000

0.417
aPT4

UNIPROT

c.238delTp.Ser80fsframeshift variantHIGHcontig1212829034

IGV:Start|Jump

AT/A

NGS:0.421

C90:0.000

0.421
aPT4

UNIPROT

c.302A>Gp.Asn101Sermissense variantMODERATEcontig1212829099

IGV:Start|Jump

A/G

NGS:0.349

C90:0.000

0.349
aPT4

UNIPROT

c.744+1_744+19delGTAATTTATTTTATTATAAsplice donor variant&splice region variant&intron variantHIGHcontig1212831022

IGV:Start|Jump

GGTAATTTATTTTATTATAA/G

NGS:0.096

C90:0.000

0.096
HDS-2

UNIPROT

c.82_93delGTAACCGGAACTp.Val28_Thr31delconservative inframe deletionMODERATEcontig951989748

IGV:Start|Jump

CGTAACCGGAACT/C

NGS:0.805

C90:0.000

0.805
HDS-2

UNIPROT

c.127T>Gp.Ser43Alamissense variantMODERATEcontig951989794

IGV:Start|Jump

T/G

NGS:0.721

C90:0.000

0.721


NEAREST GENETIC RELATIVES TO Unknown-(Cherry Wine)-(005):
# Relative Genetic Distance
1 RSP11332-Cherry Blossom 2.29
2 RSP11320-Cherry Blossom 3.46
3 RSP11313-Cherry Blossom 3.77
4 RSP11299-Cherry Blossom 4.1
5 RSP11322-Cherry Blossom 4.59
6 RSP11304-Cherry Blossom 4.62
7 RSP11325-Cherry Blossom 4.63
8 RSP11330-Cherry Blossom 4.95
9 RSP11317-Cherry Blossom 5.14
10 RSP11324-Cherry Blossom 5.15
11 RSP11315-Cherry Blossom 5.21
12 RSP11309-Cherry Blossom 5.24
13 RSP11310-Cherry Blossom 5.31
14 RSP11307-Cherry Wine 5.33
15 RSP11305-Cherry Wine 5.37
16 RSP11327-Cherry Blossom 5.5
17 RSP11303-Cherry Blossom CBG 5.63
18 RSP11301-Cherry Blossom 5.69
19 RSP11333-Cherry Blossom 5.69
20 RSP11306-Cherry Blossom 5.74
NEAREST GENETIC RELATIVES TO BASE TREE:
# Relative Genetic Distance
1 RSP10989-UP Sunrise 7.81
2 RSP11000-Liberty Haze 7.94
3 RSP11142-Cherry 8.02
4 RSP11129-Cbot-2019-001 8.04
5 RSP10684-Blueberry Cheesecake 8.39
6 RSP11014-Durban Poison 8.87
7 RSP10755-Recon 9.09
8 RSP11143-Cherry 9.17
9 RSP10105-QUEEN JESUS 9.39
10 RSP11123-RKM-2018-031 9.5
11 RSP11002-CST 9.81
12 RSP11132-Cbot-2019-004 9.9
13 RSP10672-Blueberry Cheesecake 9.99
14 RSP11133-Cbot-2019-005 10.07
15 RSP11112-RKM-2018-020 10.1
16 RSP10659-Tisza 10.11
17 RSP11094-RKM-2018-003 10.17
18 RSP11097-RKM-2018-006 10.28
19 RSP10667-Tygra 10.4
20 RSP10997-Kimbo Slice 10.47
MOST GENETICALLY DISTANT STRAINS FROM Unknown-(Cherry Wine)-(005):
# Strain Genetic Distance
1 RSP11093-RKM-2018-002 13.62
2 RSP11352-Star Dawg 13.36
3 RSP11118-RKM-2018-026 13.35
4 RSP11185-Chem 91 13.3
5 RSP11266-Abacus 13.05
6 RSP11225-New York City Deisel 12.95
7 RSP11075-JL yellow 12.87
8 RSP11190-Red Eye OG 12.71
9 RSP11336-White Label 1 12.56
10 RSP11128-Kush Hemp E1 12.53
11 RSP11343-Sour D 12.53
12 RSP11194-JL 4th Gen 2 12.51
13 RSP11199-JL 4th Gen 5 12.49
14 RSP11353-Rugburn OG 12.48
15 RSP11191-Super Sour Diesel 12.48
16 RSP11241-501st OG 12.45
17 RSP11341-Garlic 12.41
18 RSP11222-Glueberry OG 12.41
19 RSP11070-Danny Noonan 12.4
20 RSP11214-JL 3rd Gen Mother 12.39
NEAREST GENETIC RELATIVES IN PHYLOS DATASET:
Phylos Strain Number of Overlapping SNPs Concordance
SRR8346901 70 46

Blockchain Registration Information:

Transaction ID: 895b1dcba1e342a68256b190375c5c2b2e476a0f2a20201b7f8f20ab3db6379c
Stamping Certificate: PDF
SHASUM Hash: 332099f2e14345454faf40d4a4f4dc17556e6c8cea111fb7900208b69587e879