Cherry Blossom

RSP11274
StrainSEEK Cannabis Certification Report

Accession Date:

October 10, 2019

General Information

Strain: Cherry Blossom
Sample: CG3
RSP ID: RSP11274
Grower: Yabba Cannaba
Accession Date: October 10, 2019
Gender: Female
Strain Seek Version: V2


What does this visualization mean?

Chemical Information*


Cannabinoid and Terpenoid information provided by our Partner Labs.

CANNABINOIDS

THC + THCA %: N/A
CBD + CBDA %: N/A
THCV + THCVA %: N/A
CBC + CBCA %: N/A
CBG + CBGA %: N/A
CBN + CBNA %: N/A

TERPENOIDS

  • α-Bisabolol %: N/A
    Borneol %: N/A
    Camphene %: N/A
    Carene %: N/A
    Caryophyllene oxide %: N/A
    β-Carophyllene %: N/A
    Fenchol %: N/A
    Geraniol %: N/A
    α-Humulene %: N/A
    Limonene %: N/A
    Linalool %: N/A
  • Myrcene %: N/A
    α-Phellandrene %: N/A
    Terpinolene %: N/A
    α-Terpineol %: N/A
    α-Terpinene %: N/A
    γ-Terpinene %: N/A
    Total Nerolidol %: N/A
    Total Ocimene %: N/A
    α-Pinene %: N/A
    β-Pinene %: N/A

Genetic Information

View this strain on the Phylotree
Percent Heterozygosity: 1.09
Download VCF file: Here
Download FastQ Files: Read 1 Read 2
Download BAM file: BAM index
Download Annotated Variants: ANNOTATED VCF index
Plant Type: Type III

Bt/Bd ALLELE COVERAGE

What does this visualization mean?

CBCAS COVERAGE


What does this visualization mean?

Y-RATIO DISTRIBUTION


What does this visualization mean?


VARIANTS (THCAS, CBDAS, and CBCAS)

Gene HGVS.c HGVS.p Annotation Annotation Impact Contig Contig Pos Ref/Alt Var Freq



VARIANTS (SELECT GENES OF INTEREST)

Gene HGVS.c HGVS.p Annotation Annotation Impact Contig Contig Pos Ref/Alt Var Freq
PKSG-4a

UNIPROT

c.493G>Ap.Gly165Sermissense variantMODERATEcontig7001937904

IGV:Start|Jump

G/A

NGS:0.103

C90:0.000

0.103
PKSG-4a

UNIPROT

c.1191_1193delTTAp.Tyr398deldisruptive inframe deletionMODERATEcontig7001938600

IGV:Start|Jump

AATT/A

NGS:0.167

C90:0.000

0.167
PKSG-2a

UNIPROT

c.1117A>Gp.Ile373Valmissense variantMODERATEcontig7001944273

IGV:Start|Jump

T/C

NGS:0.101

C90:0.967

0.101
PKSG-2a

UNIPROT

c.67T>Ap.Phe23Ilemissense variantMODERATEcontig7001945567

IGV:Start|Jump

A/T

NGS:0.825

C90:0.904

0.825
PKSG-2a

UNIPROT

c.31A>Tp.Thr11Sermissense variantMODERATEcontig7001945603

IGV:Start|Jump

T/A

NGS:0.763

C90:0.876

0.763
PKSG-2b

UNIPROT

c.1152T>Ap.Asn384Lysmissense variantMODERATEcontig7001950486

IGV:Start|Jump

A/T

NGS:0.715

C90:0.895

0.715
PKSG-2b

UNIPROT

c.1132C>Gp.Leu378Valmissense variantMODERATEcontig7001950506

IGV:Start|Jump

G/C

NGS:0.717

C90:0.000

0.717
PKSG-2b

UNIPROT

c.1117A>Gp.Ile373Valmissense variantMODERATEcontig7001950521

IGV:Start|Jump

T/C

NGS:0.807

C90:0.981

0.807
PKSG-2b

UNIPROT

c.774G>Ap.Met258Ilemissense variantMODERATEcontig7001950864

IGV:Start|Jump

C/T

NGS:0.366

C90:0.947

0.366
PKSG-2b

UNIPROT

c.718T>Ap.Phe240Ilemissense variantMODERATEcontig7001950920

IGV:Start|Jump

A/T

NGS:0.114

C90:0.000

0.114
PKSG-2b

UNIPROT

c.592A>Gp.Asn198Aspmissense variantMODERATEcontig7001951046

IGV:Start|Jump

T/C

NGS:0.048

C90:0.000

0.048
PKSG-2b

UNIPROT

c.588T>Gp.Asp196Glumissense variantMODERATEcontig7001951050

IGV:Start|Jump

A/C

NGS:0.024

C90:0.000

0.024
PKSG-2b

UNIPROT

c.560C>Tp.Thr187Metmissense variantMODERATEcontig7001951078

IGV:Start|Jump

G/A

NGS:0.050

C90:0.000

0.05
PKSG-2b

UNIPROT

c.558G>Ap.Met186Ilemissense variantMODERATEcontig7001951080

IGV:Start|Jump

C/T

NGS:0.050

C90:0.000

0.05
PKSG-2b

UNIPROT

c.241G>Ap.Val81Metmissense variantMODERATEcontig7001951397

IGV:Start|Jump

C/T

NGS:0.154

C90:0.000

0.154
PKSG-2b

UNIPROT

c.240T>Gp.Asp80Glumissense variantMODERATEcontig7001951398

IGV:Start|Jump

A/C

NGS:0.156

C90:0.000

0.156
PKSG-2b

UNIPROT

c.230T>Cp.Val77Alamissense variantMODERATEcontig7001951408

IGV:Start|Jump

A/G

NGS:0.134

C90:0.646

0.134
PKSG-2b

UNIPROT

c.224A>Gp.Lys75Argmissense variantMODERATEcontig7001951414

IGV:Start|Jump

T/C

NGS:0.151

C90:0.957

0.151
PKSG-2b

UNIPROT

c.188T>Gp.Ile63Sermissense variantMODERATEcontig7001951450

IGV:Start|Jump

A/C

NGS:0.118

C90:0.000

0.118
PKSG-2b

UNIPROT

c.187A>Tp.Ile63Phemissense variantMODERATEcontig7001951451

IGV:Start|Jump

T/A

NGS:0.116

C90:0.000

0.116
PKSG-2b

UNIPROT

c.167C>Gp.Thr56Sermissense variantMODERATEcontig7001951471

IGV:Start|Jump

G/C

NGS:0.103

C90:0.947

0.103
PKSG-2b

UNIPROT

c.31A>Tp.Thr11Sermissense variantMODERATEcontig7001951851

IGV:Start|Jump

T/A

NGS:0.844

C90:0.880

0.844
PKSG-4b

UNIPROT

c.556A>Gp.Arg186Glymissense variant&splice region variantMODERATEcontig7002721117

IGV:Start|Jump

T/C

NGS:0.022

C90:0.000

0.022
PKSG-4b

UNIPROT

c.496A>Gp.Lys166Glumissense variantMODERATEcontig7002721177

IGV:Start|Jump

T/C

NGS:0.651

C90:0.684

0.651
PKSG-4b

UNIPROT

c.489delTp.Phe163fsframeshift variantHIGHcontig7002721183

IGV:Start|Jump

CA/C

NGS:0.792

C90:0.761

0.792
PKSG-4b

UNIPROT

c.485A>Gp.Lys162Argmissense variantMODERATEcontig7002721188

IGV:Start|Jump

T/C

NGS:0.643

C90:0.301

0.643
PKSG-4b

UNIPROT

c.431T>Gp.Val144Glymissense variantMODERATEcontig7002721242

IGV:Start|Jump

A/C

NGS:0.575

C90:0.679

0.575
PKSG-4b

UNIPROT

c.419A>Gp.Asp140Glymissense variantMODERATEcontig7002721254

IGV:Start|Jump

T/C

NGS:0.430

C90:0.440

0.43
PKSG-4b

UNIPROT

c.352_355delACAGp.Thr118fsframeshift variantHIGHcontig7002721317

IGV:Start|Jump

CCTGT/C

NGS:0.529

C90:0.000

0.529
PKSG-4b

UNIPROT

c.324A>Cp.Glu108Aspmissense variantMODERATEcontig7002721349

IGV:Start|Jump

T/G

NGS:0.094

C90:0.000

0.094
PKSG-4b

UNIPROT

c.323A>Gp.Glu108Glymissense variantMODERATEcontig7002721350

IGV:Start|Jump

T/C

NGS:0.469

C90:0.000

0.469
aPT4

UNIPROT

c.97T>Cp.Tyr33Hismissense variantMODERATEcontig1212828753

IGV:Start|Jump

T/C

NGS:0.439

C90:0.000

0.439
aPT4

UNIPROT

c.153A>Cp.Lys51Asnmissense variantMODERATEcontig1212828809

IGV:Start|Jump

A/C

NGS:0.375

C90:0.000

0.375
aPT4

UNIPROT

c.235_236delGTp.Val79fsframeshift variantHIGHcontig1212829030

IGV:Start|Jump

ATG/A

NGS:0.417

C90:0.000

0.417
aPT4

UNIPROT

c.238delTp.Ser80fsframeshift variantHIGHcontig1212829034

IGV:Start|Jump

AT/A

NGS:0.421

C90:0.000

0.421
aPT4

UNIPROT

c.302A>Gp.Asn101Sermissense variantMODERATEcontig1212829099

IGV:Start|Jump

A/G

NGS:0.349

C90:0.000

0.349
aPT4

UNIPROT

c.744+1_744+19delGTAATTTATTTTATTATAAsplice donor variant&splice region variant&intron variantHIGHcontig1212831022

IGV:Start|Jump

GGTAATTTATTTTATTATAA/G

NGS:0.096

C90:0.000

0.096
HDS-2

UNIPROT

c.82_93delGTAACCGGAACTp.Val28_Thr31delconservative inframe deletionMODERATEcontig951989748

IGV:Start|Jump

CGTAACCGGAACT/C

NGS:0.805

C90:0.000

0.805
HDS-2

UNIPROT

c.127T>Gp.Ser43Alamissense variantMODERATEcontig951989794

IGV:Start|Jump

T/G

NGS:0.721

C90:0.000

0.721


NEAREST GENETIC RELATIVES TO Cherry Blossom:
# Relative Genetic Distance
1 RSP11320-Cherry Blossom 3.49
2 RSP11316-Cherry Blossom 5.05
3 RSP11327-Cherry Blossom 5.29
4 RSP11268-Unknown- Cherry Wine - 001 6.09
5 RSP11314-Cherry Blossom 6.16
6 RSP11269-Unknown- Cherry Wine - 002 6.29
7 RSP11323-Cherry Blossom 6.52
8 RSP11321-Cherry Blossom 6.59
9 RSP11272-Unknown- Cherry Wine - 005 6.82
10 RSP11318-Cherry Blossom 6.96
11 RSP11319-Cherry Blossom 7
12 RSP11302-Cherry Blossom 7.12
13 RSP11308-Cherry Blossom 7.28
14 RSP11335-Cherry Blossom 7.31
15 RSP11304-Cherry Blossom 7.4
16 RSP11295-Queen Dream CBG 7.45
17 RSP11311-Cherry Blossom 7.47
18 RSP11299-Cherry Blossom 7.51
19 RSP11322-Cherry Blossom 7.65
20 RSP11326-Cherry Blossom 7.75
NEAREST GENETIC RELATIVES TO BASE TREE:
# Relative Genetic Distance
1 RSP10105-QUEEN JESUS 8.93
2 RSP10684-Blueberry Cheesecake 9.51
3 RSP11000-Liberty Haze 10.14
4 RSP10672-Blueberry Cheesecake 10.24
5 RSP11132-Cbot-2019-004 10.44
6 RSP10989-UP Sunrise 10.52
7 RSP11097-RKM-2018-006 10.75
8 RSP11111-RKM-2018-019 10.77
9 RSP11014-Durban Poison 10.97
10 RSP11133-Cbot-2019-005 11
11 RSP11142-Cherry 11.3
12 RSP10667-Tygra 11.34
13 RSP11096-RKM-2018-005 11.36
14 RSP11120-RKM-2018-028 11.37
15 RSP10659-Tisza 11.47
16 RSP11050-Hermaphrodite ResearchSample2 11.56
17 RSP11034-Italian Kiss 11.57
18 RSP10551-Sour Raspberry 11.61
19 RSP11143-Cherry 11.66
20 RSP11129-Cbot-2019-001 11.68
MOST GENETICALLY DISTANT STRAINS FROM Cherry Blossom:
# Strain Genetic Distance
1 RSP11336-White Label 1 15.24
2 RSP11213-80E 14.74
3 RSP11118-RKM-2018-026 14.5
4 RSP11211-80E 14.48
5 RSP11341-Garlic 14.07
6 RSP11185-Chem 91 14.04
7 RSP11212-80E 13.91
8 RSP11352-Star Dawg 13.85
9 RSP11266-Abacus 13.72
10 RSP11093-RKM-2018-002 13.65
11 RSP11354-Dominion Skunk 13.55
12 RSP11190-Red Eye OG 13.49
13 RSP10837-Skywalker OG 13.47
14 RSP11222-Glueberry OG 13.22
15 RSP11353-Rugburn OG 13.21
16 RSP11241-501st OG 13.17
17 RSP11198-JL 4th Gen 4 13.14
18 RSP11104-RKM-2018-013 13.13
19 RSP11072-SFVxTK 13.1
20 RSP11075-JL yellow 13.08
NEAREST GENETIC RELATIVES IN PHYLOS DATASET:
Phylos Strain Number of Overlapping SNPs Concordance
SRR8346543 70 42

Blockchain Registration Information:

Transaction ID: 62c68eb3751c85da10b0a55e70e42842d073781338258396c3d916e35034931e
Stamping Certificate: PDF
SHASUM Hash: b68349d3dbf2ef71750471c1f446acd1aeec45e94ee259352bd9505a39fec08a