Cherry Blossom

RSP11299
StrainSEEK Cannabis Certification Report

Accession Date:

October 17, 2019

General Information

Strain: Cherry Blossom
Sample: CA4
RSP ID: RSP11299
Grower: Yabba Cannaba
Accession Date: October 17, 2019
Gender: Female
Strain Seek Version: V2


What does this visualization mean?

Chemical Information*


Cannabinoid and Terpenoid information provided by our Partner Labs.

CANNABINOIDS

THC + THCA %: N/A
CBD + CBDA %: N/A
THCV + THCVA %: N/A
CBC + CBCA %: N/A
CBG + CBGA %: N/A
CBN + CBNA %: N/A

TERPENOIDS

  • α-Bisabolol %: N/A
    Borneol %: N/A
    Camphene %: N/A
    Carene %: N/A
    Caryophyllene oxide %: N/A
    β-Carophyllene %: N/A
    Fenchol %: N/A
    Geraniol %: N/A
    α-Humulene %: N/A
    Limonene %: N/A
    Linalool %: N/A
  • Myrcene %: N/A
    α-Phellandrene %: N/A
    Terpinolene %: N/A
    α-Terpineol %: N/A
    α-Terpinene %: N/A
    γ-Terpinene %: N/A
    Total Nerolidol %: N/A
    Total Ocimene %: N/A
    α-Pinene %: N/A
    β-Pinene %: N/A

Genetic Information

View this strain on the Phylotree
Percent Heterozygosity: 1.66
Download VCF file: Here
Download FastQ Files: Read 1 Read 2
Download BAM file: BAM index
Download Annotated Variants: ANNOTATED VCF index
Plant Type: Type III

Bt/Bd ALLELE COVERAGE

What does this visualization mean?

CBCAS COVERAGE


What does this visualization mean?

Y-RATIO DISTRIBUTION


What does this visualization mean?


VARIANTS (THCAS, CBDAS, and CBCAS)

Gene HGVS.c HGVS.p Annotation Annotation Impact Contig Contig Pos Ref/Alt Var Freq



VARIANTS (SELECT GENES OF INTEREST)

Gene HGVS.c HGVS.p Annotation Annotation Impact Contig Contig Pos Ref/Alt Var Freq
PKSG-4a

UNIPROT

c.493G>Ap.Gly165Sermissense variantMODERATEcontig7001937904

IGV:Start|Jump

G/A

NGS:0.103

C90:0.000

0.103
PKSG-4a

UNIPROT

c.1191_1193delTTAp.Tyr398deldisruptive inframe deletionMODERATEcontig7001938600

IGV:Start|Jump

AATT/A

NGS:0.167

C90:0.000

0.167
PKSG-2a

UNIPROT

c.67T>Ap.Phe23Ilemissense variantMODERATEcontig7001945567

IGV:Start|Jump

A/T

NGS:0.825

C90:0.904

0.825
PKSG-2a

UNIPROT

c.31A>Tp.Thr11Sermissense variantMODERATEcontig7001945603

IGV:Start|Jump

T/A

NGS:0.763

C90:0.876

0.763
PKSG-2b

UNIPROT

c.1117A>Gp.Ile373Valmissense variantMODERATEcontig7001950521

IGV:Start|Jump

T/C

NGS:0.807

C90:0.981

0.807
PKSG-2b

UNIPROT

c.31A>Tp.Thr11Sermissense variantMODERATEcontig7001951851

IGV:Start|Jump

T/A

NGS:0.844

C90:0.880

0.844
PKSG-4b

UNIPROT

c.496A>Gp.Lys166Glumissense variantMODERATEcontig7002721177

IGV:Start|Jump

T/C

NGS:0.651

C90:0.684

0.651
PKSG-4b

UNIPROT

c.489delTp.Phe163fsframeshift variantHIGHcontig7002721183

IGV:Start|Jump

CA/C

NGS:0.792

C90:0.761

0.792
PKSG-4b

UNIPROT

c.485A>Gp.Lys162Argmissense variantMODERATEcontig7002721188

IGV:Start|Jump

T/C

NGS:0.643

C90:0.301

0.643
PKSG-4b

UNIPROT

c.431T>Gp.Val144Glymissense variantMODERATEcontig7002721242

IGV:Start|Jump

A/C

NGS:0.575

C90:0.679

0.575
PKSG-4b

UNIPROT

c.428_429insTGGGCTGAGTGAGTATGGGTCAp.Val144fsframeshift variantHIGHcontig7002721244

IGV:Start|Jump

G/GTGACCCATACTCACTCAGCCCA

NGS:0.002

C90:0.000

0.002
PKSG-4b

UNIPROT

c.419A>Gp.Asp140Glymissense variantMODERATEcontig7002721254

IGV:Start|Jump

T/C

NGS:0.430

C90:0.440

0.43
PKSG-4b

UNIPROT

c.352_355delACAGp.Thr118fsframeshift variantHIGHcontig7002721317

IGV:Start|Jump

CCTGT/C

NGS:0.529

C90:0.000

0.529
PKSG-4b

UNIPROT

c.324A>Cp.Glu108Aspmissense variantMODERATEcontig7002721349

IGV:Start|Jump

T/G

NGS:0.094

C90:0.000

0.094
PKSG-4b

UNIPROT

c.323A>Gp.Glu108Glymissense variantMODERATEcontig7002721350

IGV:Start|Jump

T/C

NGS:0.469

C90:0.000

0.469
DXR-2

UNIPROT

c.1319T>Cp.Ile440Thrmissense variantMODERATEcontig380285250

IGV:Start|Jump

A/G

NGS:0.480

C90:0.000

0.48
aPT4

UNIPROT

c.97T>Cp.Tyr33Hismissense variantMODERATEcontig1212828753

IGV:Start|Jump

T/C

NGS:0.439

C90:0.000

0.439
aPT4

UNIPROT

c.153A>Cp.Lys51Asnmissense variantMODERATEcontig1212828809

IGV:Start|Jump

A/C

NGS:0.375

C90:0.000

0.375
aPT4

UNIPROT

c.235_236delGTp.Val79fsframeshift variantHIGHcontig1212829030

IGV:Start|Jump

ATG/A

NGS:0.417

C90:0.000

0.417
aPT4

UNIPROT

c.238delTp.Ser80fsframeshift variantHIGHcontig1212829034

IGV:Start|Jump

AT/A

NGS:0.421

C90:0.000

0.421
aPT4

UNIPROT

c.302A>Gp.Asn101Sermissense variantMODERATEcontig1212829099

IGV:Start|Jump

A/G

NGS:0.349

C90:0.000

0.349
aPT4

UNIPROT

c.744+1_744+19delGTAATTTATTTTATTATAAsplice donor variant&splice region variant&intron variantHIGHcontig1212831022

IGV:Start|Jump

GGTAATTTATTTTATTATAA/G

NGS:0.096

C90:0.000

0.096
HDS-2

UNIPROT

c.82_93delGTAACCGGAACTp.Val28_Thr31delconservative inframe deletionMODERATEcontig951989748

IGV:Start|Jump

CGTAACCGGAACT/C

NGS:0.805

C90:0.000

0.805
HDS-2

UNIPROT

c.127T>Gp.Ser43Alamissense variantMODERATEcontig951989794

IGV:Start|Jump

T/G

NGS:0.721

C90:0.000

0.721


NEAREST GENETIC RELATIVES TO Cherry Blossom:
# Relative Genetic Distance
1 RSP11331-Cherry Blossom 2.62
2 RSP11272-Unknown- Cherry Wine - 005 4.1
3 RSP11310-Cherry Blossom 4.7
4 RSP11315-Cherry Blossom 4.88
5 RSP11302-Cherry Blossom 4.99
6 RSP11307-Cherry Wine 5.07
7 RSP11305-Cherry Wine 5.09
8 RSP11330-Cherry Blossom 5.19
9 RSP11304-Cherry Blossom 5.37
10 RSP11316-Cherry Blossom 5.38
11 RSP11320-Cherry Blossom 5.45
12 RSP11324-Cherry Blossom 5.73
13 RSP11361-FL30 5.74
14 RSP11329-Cherry Blossom 5.96
15 RSP10684-Blueberry Cheesecake 6.01
16 RSP11332-Cherry Blossom 6.03
17 RSP10941-Midnight 6.06
18 RSP11327-Cherry Blossom 6.1
19 RSP11243-Doug's Varin 6.13
20 RSP11319-Cherry Blossom 6.22
NEAREST GENETIC RELATIVES TO BASE TREE:
# Relative Genetic Distance
1 RSP10684-Blueberry Cheesecake 6.31
2 RSP11000-Liberty Haze 8.35
3 RSP11014-Durban Poison 8.66
4 RSP10989-UP Sunrise 9.03
5 RSP11143-Cherry 9.18
6 RSP10105-QUEEN JESUS 9.29
7 RSP11129-Cbot-2019-001 9.36
8 RSP11132-Cbot-2019-004 9.57
9 RSP10755-Recon 9.82
10 RSP11123-RKM-2018-031 10.28
11 RSP10667-Tygra 10.4
12 RSP10991-Golden Goat 2 10.41
13 RSP11096-RKM-2018-005 10.42
14 RSP11119-RKM-2018-027 10.55
15 RSP11094-RKM-2018-003 10.56
16 RSP11050-Hermaphrodite ResearchSample2 10.71
17 RSP10997-Kimbo Slice 10.75
18 RSP10672-Blueberry Cheesecake 10.76
19 RSP11142-Cherry 10.78
20 RSP11124-RKM-2018-032 10.84
MOST GENETICALLY DISTANT STRAINS FROM Cherry Blossom:
# Strain Genetic Distance
1 RSP11213-80E 14.01
2 RSP11075-JL yellow 13.61
3 RSP11336-White Label 1 13.6
4 RSP11118-RKM-2018-026 13.55
5 RSP11211-80E 13.54
6 RSP11205-Feral 13.31
7 RSP11185-Chem 91 13.26
8 RSP10983-USO 31 13.15
9 RSP10891-Feral 13.08
10 RSP10890-Feral 13.05
11 RSP11341-Garlic 12.99
12 RSP10233-USO31 12.99
13 RSP11190-Red Eye OG 12.96
14 RSP11212-80E 12.96
15 RSP11214-JL 3rd Gen Mother 12.94
16 RSP10892-Feral 12.92
17 RSP10837-Skywalker OG 12.91
18 RSP11266-Abacus 12.88
19 RSP11116-RKM-2018-024 12.88
20 RSP11199-JL 4th Gen 5 12.73
NEAREST GENETIC RELATIVES IN PHYLOS DATASET:
Phylos Strain Number of Overlapping SNPs Concordance
SRR4450157 66 44

Blockchain Registration Information:

Transaction ID: 4b32f76228f2fb3d0f63bfe779c5d927812c2d647c408ac88a5b0ba512f1d9b3
Stamping Certificate: PDF
SHASUM Hash: efafe77d8572429bc76b5ffd2d583ade23b7014fb03c4767d0a8d9137fa19c6a