Cherry Blossom

RSP11302
StrainSEEK Cannabis Certification Report

Accession Date:

October 17, 2019

General Information

Strain: Cherry Blossom
Sample: CA2
RSP ID: RSP11302
Grower: Yabba Cannaba
Accession Date: October 17, 2019
Gender: Female
Strain Seek Version: V2


What does this visualization mean?

Chemical Information*


Cannabinoid and Terpenoid information provided by our Partner Labs.

CANNABINOIDS

THC + THCA %: N/A
CBD + CBDA %: N/A
THCV + THCVA %: N/A
CBC + CBCA %: N/A
CBG + CBGA %: N/A
CBN + CBNA %: N/A

TERPENOIDS

  • α-Bisabolol %: N/A
    Borneol %: N/A
    Camphene %: N/A
    Carene %: N/A
    Caryophyllene oxide %: N/A
    β-Carophyllene %: N/A
    Fenchol %: N/A
    Geraniol %: N/A
    α-Humulene %: N/A
    Limonene %: N/A
    Linalool %: N/A
  • Myrcene %: N/A
    α-Phellandrene %: N/A
    Terpinolene %: N/A
    α-Terpineol %: N/A
    α-Terpinene %: N/A
    γ-Terpinene %: N/A
    Total Nerolidol %: N/A
    Total Ocimene %: N/A
    α-Pinene %: N/A
    β-Pinene %: N/A

Genetic Information

View this strain on the Phylotree
Percent Heterozygosity: 1.58
Download VCF file: Here
Download FastQ Files: Read 1 Read 2
Download BAM file: BAM index
Download Annotated Variants: ANNOTATED VCF index
Plant Type: Type III

Bt/Bd ALLELE COVERAGE

What does this visualization mean?

CBCAS COVERAGE


What does this visualization mean?

Y-RATIO DISTRIBUTION


What does this visualization mean?


VARIANTS (THCAS, CBDAS, and CBCAS)

Gene HGVS.c HGVS.p Annotation Annotation Impact Contig Contig Pos Ref/Alt Var Freq
CBDASc.8G>Ap.Cys3Tyrmissense variantMODERATEcontig17722082234

IGV:Start|Jump

G/A

NGS:0.057

C90:0.000

0.057
CBDASc.221C>Gp.Thr74Sermissense variantMODERATEcontig17722082447

IGV:Start|Jump

C/G

NGS:0.136

C90:0.057

0.136
CBDASc.1420A>Cp.Lys474Glnmissense variantMODERATEcontig17722083646

IGV:Start|Jump

A/C

NGS:0.132

C90:0.813

0.132



VARIANTS (SELECT GENES OF INTEREST)

Gene HGVS.c HGVS.p Annotation Annotation Impact Contig Contig Pos Ref/Alt Var Freq
GPPs1

UNIPROT

c.845_848delAAAGp.Glu282fsframeshift variantHIGHcontig676169629

IGV:Start|Jump

TGAAA/T

NGS:0.118

C90:0.000

0.118
PKSG-4a

UNIPROT

c.493G>Ap.Gly165Sermissense variantMODERATEcontig7001937904

IGV:Start|Jump

G/A

NGS:0.103

C90:0.000

0.103
PKSG-4a

UNIPROT

c.1191_1193delTTAp.Tyr398deldisruptive inframe deletionMODERATEcontig7001938600

IGV:Start|Jump

AATT/A

NGS:0.167

C90:0.000

0.167
PKSG-2a

UNIPROT

c.1117A>Gp.Ile373Valmissense variantMODERATEcontig7001944273

IGV:Start|Jump

T/C

NGS:0.101

C90:0.967

0.101
PKSG-2b

UNIPROT

c.1117A>Gp.Ile373Valmissense variantMODERATEcontig7001950521

IGV:Start|Jump

T/C

NGS:0.807

C90:0.981

0.807
PKSG-4b

UNIPROT

c.496A>Gp.Lys166Glumissense variantMODERATEcontig7002721177

IGV:Start|Jump

T/C

NGS:0.651

C90:0.684

0.651
PKSG-4b

UNIPROT

c.489delTp.Phe163fsframeshift variantHIGHcontig7002721183

IGV:Start|Jump

CA/C

NGS:0.792

C90:0.761

0.792
PKSG-4b

UNIPROT

c.485A>Gp.Lys162Argmissense variantMODERATEcontig7002721188

IGV:Start|Jump

T/C

NGS:0.643

C90:0.301

0.643
PKSG-4b

UNIPROT

c.352_355delACAGp.Thr118fsframeshift variantHIGHcontig7002721317

IGV:Start|Jump

CCTGT/C

NGS:0.529

C90:0.000

0.529
PKSG-4b

UNIPROT

c.324A>Cp.Glu108Aspmissense variantMODERATEcontig7002721349

IGV:Start|Jump

T/G

NGS:0.094

C90:0.000

0.094
PKSG-4b

UNIPROT

c.323A>Gp.Glu108Glymissense variantMODERATEcontig7002721350

IGV:Start|Jump

T/C

NGS:0.469

C90:0.000

0.469
DXR-2

UNIPROT

c.1319T>Cp.Ile440Thrmissense variantMODERATEcontig380285250

IGV:Start|Jump

A/G

NGS:0.480

C90:0.000

0.48
aPT4

UNIPROT

c.97T>Cp.Tyr33Hismissense variantMODERATEcontig1212828753

IGV:Start|Jump

T/C

NGS:0.439

C90:0.000

0.439
aPT4

UNIPROT

c.153A>Cp.Lys51Asnmissense variantMODERATEcontig1212828809

IGV:Start|Jump

A/C

NGS:0.375

C90:0.000

0.375
aPT4

UNIPROT

c.235_236delGTp.Val79fsframeshift variantHIGHcontig1212829030

IGV:Start|Jump

ATG/A

NGS:0.417

C90:0.000

0.417
aPT4

UNIPROT

c.238delTp.Ser80fsframeshift variantHIGHcontig1212829034

IGV:Start|Jump

AT/A

NGS:0.421

C90:0.000

0.421
aPT4

UNIPROT

c.302A>Gp.Asn101Sermissense variantMODERATEcontig1212829099

IGV:Start|Jump

A/G

NGS:0.349

C90:0.000

0.349
aPT4

UNIPROT

c.744+1_744+19delGTAATTTATTTTATTATAAsplice donor variant&splice region variant&intron variantHIGHcontig1212831022

IGV:Start|Jump

GGTAATTTATTTTATTATAA/G

NGS:0.096

C90:0.000

0.096
HDS-2

UNIPROT

c.82_93delGTAACCGGAACTp.Val28_Thr31delconservative inframe deletionMODERATEcontig951989748

IGV:Start|Jump

CGTAACCGGAACT/C

NGS:0.805

C90:0.000

0.805
HDS-2

UNIPROT

c.127T>Gp.Ser43Alamissense variantMODERATEcontig951989794

IGV:Start|Jump

T/G

NGS:0.721

C90:0.000

0.721
HDS-1

UNIPROT

c.-108+1_-108+2insGsplice donor variant&intron variantHIGHcontig1891889975

IGV:Start|Jump

A/AC

NGS:0.217

C90:0.000

0.217


NEAREST GENETIC RELATIVES TO Cherry Blossom:
# Relative Genetic Distance
1 RSP11326-Cherry Blossom 4.28
2 RSP11310-Cherry Blossom 4.76
3 RSP11331-Cherry Blossom 4.83
4 RSP11299-Cherry Blossom 4.99
5 RSP11313-Cherry Blossom 5.09
6 RSP11333-Cherry Blossom 5.45
7 RSP11321-Cherry Blossom 5.73
8 RSP11308-Cherry Blossom 6.05
9 RSP11318-Cherry Blossom 6.05
10 RSP11335-Cherry Blossom 6.08
11 RSP11324-Cherry Blossom 6.33
12 RSP11316-Cherry Blossom 6.57
13 RSP11272-Unknown- Cherry Wine - 005 6.62
14 RSP11320-Cherry Blossom 6.8
15 RSP11282-Queen Dream CBG 6.96
16 RSP11330-Cherry Blossom 7.09
17 RSP11184-Domnesia 7.11
18 RSP11274-Cherry Blossom 7.12
19 RSP11319-Cherry Blossom 7.13
20 RSP11243-Doug's Varin 7.14
NEAREST GENETIC RELATIVES TO BASE TREE:
# Relative Genetic Distance
1 RSP10684-Blueberry Cheesecake 7.72
2 RSP11142-Cherry 8.73
3 RSP11000-Liberty Haze 8.99
4 RSP11014-Durban Poison 9.18
5 RSP10989-UP Sunrise 9.61
6 RSP10991-Golden Goat 2 9.69
7 RSP11143-Cherry 9.84
8 RSP11111-RKM-2018-019 10.15
9 RSP11048-Gold Cracker 10.19
10 RSP10672-Blueberry Cheesecake 10.46
11 RSP10105-QUEEN JESUS 10.56
12 RSP10667-Tygra 10.77
13 RSP11097-RKM-2018-006 10.95
14 RSP10755-Recon 11.04
15 RSP11119-RKM-2018-027 11.13
16 RSP10659-Tisza 11.24
17 RSP11094-RKM-2018-003 11.33
18 RSP11134-Cbot-2019-006 11.35
19 RSP11124-RKM-2018-032 11.35
20 RSP11120-RKM-2018-028 11.53
MOST GENETICALLY DISTANT STRAINS FROM Cherry Blossom:
# Strain Genetic Distance
1 RSP11213-80E 14.53
2 RSP11075-JL yellow 14.5
3 RSP11214-JL 3rd Gen Mother 14.35
4 RSP11211-80E 13.85
5 RSP11118-RKM-2018-026 13.82
6 RSP11185-Chem 91 13.8
7 RSP11093-RKM-2018-002 13.67
8 RSP11336-White Label 1 13.56
9 RSP11197-JL 3rd Gen Mother 13.48
10 RSP11341-Garlic 13.41
11 RSP11200-JL 4th Gen 6 13.39
12 RSP11212-80E 13.38
13 RSP11128-Kush Hemp E1 13.38
14 RSP11194-JL 4th Gen 2 13.29
15 RSP11353-Rugburn OG 13.28
16 RSP11241-501st OG 13.27
17 RSP11196-JL 3rd Gen Father 13.22
18 RSP11205-Feral 13.16
19 RSP10837-Skywalker OG 13.16
20 RSP11103-RKM-2018-012 13.08
NEAREST GENETIC RELATIVES IN PHYLOS DATASET:
Phylos Strain Number of Overlapping SNPs Concordance
SRR4450157 66 41

Blockchain Registration Information:

Transaction ID: bdba5c45143a5dfedfa847f973467d7ba3fb5b1ce61aa47a22176385426d29a6
Stamping Certificate: PDF
SHASUM Hash: c5fc554f3d2de32d89abbfe03aad8a16f347d43641bf0a0ba4c0fe76071b0702