Cherry Blossom

RSP11306
StrainSEEK Cannabis Certification Report

Accession Date:

October 17, 2019

General Information

Strain: Cherry Blossom
Sample: CH7
RSP ID: RSP11306
Grower: Yabba Cannaba
Accession Date: October 17, 2019
Gender: Female
Strain Seek Version: V2


What does this visualization mean?

Chemical Information*


Cannabinoid and Terpenoid information provided by our Partner Labs.

CANNABINOIDS

THC + THCA %: N/A
CBD + CBDA %: N/A
THCV + THCVA %: N/A
CBC + CBCA %: N/A
CBG + CBGA %: N/A
CBN + CBNA %: N/A

TERPENOIDS

  • α-Bisabolol %: N/A
    Borneol %: N/A
    Camphene %: N/A
    Carene %: N/A
    Caryophyllene oxide %: N/A
    β-Carophyllene %: N/A
    Fenchol %: N/A
    Geraniol %: N/A
    α-Humulene %: N/A
    Limonene %: N/A
    Linalool %: N/A
  • Myrcene %: N/A
    α-Phellandrene %: N/A
    Terpinolene %: N/A
    α-Terpineol %: N/A
    α-Terpinene %: N/A
    γ-Terpinene %: N/A
    Total Nerolidol %: N/A
    Total Ocimene %: N/A
    α-Pinene %: N/A
    β-Pinene %: N/A

Genetic Information

View this strain on the Phylotree
Percent Heterozygosity: 1.26
Download VCF file: Here
Download FastQ Files: Read 1 Read 2
Download BAM file: BAM index
Download Annotated Variants: ANNOTATED VCF index
Plant Type: Type III

Bt/Bd ALLELE COVERAGE

What does this visualization mean?

CBCAS COVERAGE


What does this visualization mean?

Y-RATIO DISTRIBUTION


What does this visualization mean?


VARIANTS (THCAS, CBDAS, and CBCAS)

Gene HGVS.c HGVS.p Annotation Annotation Impact Contig Contig Pos Ref/Alt Var Freq



VARIANTS (SELECT GENES OF INTEREST)

Gene HGVS.c HGVS.p Annotation Annotation Impact Contig Contig Pos Ref/Alt Var Freq
PKSG-2a

UNIPROT

c.67T>Ap.Phe23Ilemissense variantMODERATEcontig7001945567

IGV:Start|Jump

A/T

NGS:0.825

C90:0.904

0.825
PKSG-2a

UNIPROT

c.31A>Tp.Thr11Sermissense variantMODERATEcontig7001945603

IGV:Start|Jump

T/A

NGS:0.763

C90:0.876

0.763
PKSG-2b

UNIPROT

c.31A>Tp.Thr11Sermissense variantMODERATEcontig7001951851

IGV:Start|Jump

T/A

NGS:0.844

C90:0.880

0.844
PKSG-4b

UNIPROT

c.496A>Gp.Lys166Glumissense variantMODERATEcontig7002721177

IGV:Start|Jump

T/C

NGS:0.651

C90:0.684

0.651
PKSG-4b

UNIPROT

c.489delTp.Phe163fsframeshift variantHIGHcontig7002721183

IGV:Start|Jump

CA/C

NGS:0.792

C90:0.761

0.792
PKSG-4b

UNIPROT

c.485A>Gp.Lys162Argmissense variantMODERATEcontig7002721188

IGV:Start|Jump

T/C

NGS:0.643

C90:0.301

0.643
PKSG-4b

UNIPROT

c.431T>Gp.Val144Glymissense variantMODERATEcontig7002721242

IGV:Start|Jump

A/C

NGS:0.575

C90:0.679

0.575
PKSG-4b

UNIPROT

c.419A>Gp.Asp140Glymissense variantMODERATEcontig7002721254

IGV:Start|Jump

T/C

NGS:0.430

C90:0.440

0.43
PKSG-4b

UNIPROT

c.352_355delACAGp.Thr118fsframeshift variantHIGHcontig7002721317

IGV:Start|Jump

CCTGT/C

NGS:0.529

C90:0.000

0.529
aPT4

UNIPROT

c.302A>Gp.Asn101Sermissense variantMODERATEcontig1212829099

IGV:Start|Jump

A/G

NGS:0.349

C90:0.000

0.349
aPT4

UNIPROT

c.744+1_744+19delGTAATTTATTTTATTATAAsplice donor variant&splice region variant&intron variantHIGHcontig1212831022

IGV:Start|Jump

GGTAATTTATTTTATTATAA/G

NGS:0.096

C90:0.000

0.096


NEAREST GENETIC RELATIVES TO Cherry Blossom:
# Relative Genetic Distance
1 RSP11325-Cherry Blossom 3.1
2 RSP11315-Cherry Blossom 3.72
3 RSP11322-Cherry Blossom 4.05
4 RSP11329-Cherry Blossom 4.27
5 RSP11303-Cherry Blossom CBG 5.33
6 RSP11272-Unknown- Cherry Wine - 005 5.74
7 RSP11304-Cherry Blossom 6.29
8 RSP11327-Cherry Blossom 6.96
9 RSP11330-Cherry Blossom 7.07
10 RSP11320-Cherry Blossom 7.2
11 RSP11285-Queen Dream CBG 7.5
12 RSP11317-Cherry Blossom 7.54
13 RSP11313-Cherry Blossom 7.68
14 RSP11299-Cherry Blossom 7.72
15 RSP11332-Cherry Blossom 7.76
16 RSP11316-Cherry Blossom 8.15
17 RSP11326-Cherry Blossom 8.18
18 RSP11147-Otto 8.39
19 RSP11324-Cherry Blossom 8.48
20 RSP11148-Wife 8.62
NEAREST GENETIC RELATIVES TO BASE TREE:
# Relative Genetic Distance
1 RSP10989-UP Sunrise 8.6
2 RSP11129-Cbot-2019-001 9
3 RSP11000-Liberty Haze 10.23
4 RSP11034-Italian Kiss 10.33
5 RSP10667-Tygra 10.44
6 RSP11132-Cbot-2019-004 10.5
7 RSP10684-Blueberry Cheesecake 10.59
8 RSP11123-RKM-2018-031 10.73
9 RSP11033-Blue Dream 10.91
10 RSP11100-RKM-2018-009 10.98
11 RSP10997-Kimbo Slice 10.98
12 RSP11002-CST 11.04
13 RSP10755-Recon 11.12
14 RSP11014-Durban Poison 11.26
15 RSP11097-RKM-2018-006 11.27
16 RSP11143-Cherry 11.32
17 RSP11051-KYRG-11 11.33
18 RSP10551-Sour Raspberry 11.48
19 RSP10988-The Gift 11.66
20 RSP10659-Tisza 11.71
NEAREST GENETIC RELATIVES IN PHYLOS DATASET:
Phylos Strain Number of Overlapping SNPs Concordance
SRR8346627 62 37
NEAREST GENETIC RELATIVES IN LYNCH DATASET:
Nearest Lynch Strain Number of Overlapping SNPs Concordance
SRR3495187 6 6

Blockchain Registration Information:

Transaction ID: 8f6cca14a10a6a4dcd4ca71a59eed500fd7ca2b4086ba6e3bed055b600855d1c
Stamping Certificate: PDF
SHASUM Hash: 52f2d110ba21ed7fe8d14b54ffa82b8853b00bf14631025a24cc85025ca7ca88