Cherry Blossom

RSP11308
StrainSEEK Cannabis Certification Report

Accession Date:

October 17, 2019

General Information

Strain: Cherry Blossom
Sample: CK6
RSP ID: RSP11308
Grower: Yabba Cannaba
Accession Date: October 17, 2019
Gender: Female
Strain Seek Version: V2


What does this visualization mean?

Chemical Information*


Cannabinoid and Terpenoid information provided by our Partner Labs.

CANNABINOIDS

THC + THCA %: N/A
CBD + CBDA %: N/A
THCV + THCVA %: N/A
CBC + CBCA %: N/A
CBG + CBGA %: N/A
CBN + CBNA %: N/A

TERPENOIDS

  • α-Bisabolol %: N/A
    Borneol %: N/A
    Camphene %: N/A
    Carene %: N/A
    Caryophyllene oxide %: N/A
    β-Carophyllene %: N/A
    Fenchol %: N/A
    Geraniol %: N/A
    α-Humulene %: N/A
    Limonene %: N/A
    Linalool %: N/A
  • Myrcene %: N/A
    α-Phellandrene %: N/A
    Terpinolene %: N/A
    α-Terpineol %: N/A
    α-Terpinene %: N/A
    γ-Terpinene %: N/A
    Total Nerolidol %: N/A
    Total Ocimene %: N/A
    α-Pinene %: N/A
    β-Pinene %: N/A

Genetic Information

View this strain on the Phylotree
Percent Heterozygosity: 1.75
Download VCF file: Here
Download FastQ Files: Read 1 Read 2
Download BAM file: BAM index
Download Annotated Variants: ANNOTATED VCF index
Plant Type: Type III

Bt/Bd ALLELE COVERAGE

What does this visualization mean?

CBCAS COVERAGE


What does this visualization mean?

Y-RATIO DISTRIBUTION


What does this visualization mean?


VARIANTS (THCAS, CBDAS, and CBCAS)

Gene HGVS.c HGVS.p Annotation Annotation Impact Contig Contig Pos Ref/Alt Var Freq
CBDASc.221C>Gp.Thr74Sermissense variantMODERATEcontig17722082447

IGV:Start|Jump

C/G

NGS:0.136

C90:0.057

0.136
CBDASc.1420A>Cp.Lys474Glnmissense variantMODERATEcontig17722083646

IGV:Start|Jump

A/C

NGS:0.132

C90:0.813

0.132



VARIANTS (SELECT GENES OF INTEREST)

Gene HGVS.c HGVS.p Annotation Annotation Impact Contig Contig Pos Ref/Alt Var Freq
PKSG-2a

UNIPROT

c.67T>Ap.Phe23Ilemissense variantMODERATEcontig7001945567

IGV:Start|Jump

A/T

NGS:0.825

C90:0.904

0.825
PKSG-2a

UNIPROT

c.31A>Tp.Thr11Sermissense variantMODERATEcontig7001945603

IGV:Start|Jump

T/A

NGS:0.763

C90:0.876

0.763
PKSG-2b

UNIPROT

c.1117A>Gp.Ile373Valmissense variantMODERATEcontig7001950521

IGV:Start|Jump

T/C

NGS:0.807

C90:0.981

0.807
PKSG-2b

UNIPROT

c.31A>Tp.Thr11Sermissense variantMODERATEcontig7001951851

IGV:Start|Jump

T/A

NGS:0.844

C90:0.880

0.844
PKSG-4b

UNIPROT

c.496A>Gp.Lys166Glumissense variantMODERATEcontig7002721177

IGV:Start|Jump

T/C

NGS:0.651

C90:0.684

0.651
PKSG-4b

UNIPROT

c.489delTp.Phe163fsframeshift variantHIGHcontig7002721183

IGV:Start|Jump

CA/C

NGS:0.792

C90:0.761

0.792
PKSG-4b

UNIPROT

c.485A>Gp.Lys162Argmissense variantMODERATEcontig7002721188

IGV:Start|Jump

T/C

NGS:0.643

C90:0.301

0.643
PKSG-4b

UNIPROT

c.431T>Gp.Val144Glymissense variantMODERATEcontig7002721242

IGV:Start|Jump

A/C

NGS:0.575

C90:0.679

0.575
PKSG-4b

UNIPROT

c.419A>Gp.Asp140Glymissense variantMODERATEcontig7002721254

IGV:Start|Jump

T/C

NGS:0.430

C90:0.440

0.43
PKSG-4b

UNIPROT

c.352_355delACAGp.Thr118fsframeshift variantHIGHcontig7002721317

IGV:Start|Jump

CCTGT/C

NGS:0.529

C90:0.000

0.529
DXR-2

UNIPROT

c.1319T>Cp.Ile440Thrmissense variantMODERATEcontig380285250

IGV:Start|Jump

A/G

NGS:0.480

C90:0.000

0.48
FAD2-2

UNIPROT

c.62C>Tp.Pro21Leumissense variantMODERATEcontig831803307

IGV:Start|Jump

G/A

NGS:0.042

C90:0.000

0.042
FAD2-2

UNIPROT

c.47_57delTGAATCATACTp.Leu16fsframeshift variantHIGHcontig831803311

IGV:Start|Jump

GAGTATGATTCA/G

NGS:0.018

C90:0.000

0.018
aPT4

UNIPROT

c.97T>Cp.Tyr33Hismissense variantMODERATEcontig1212828753

IGV:Start|Jump

T/C

NGS:0.439

C90:0.000

0.439
aPT4

UNIPROT

c.153A>Cp.Lys51Asnmissense variantMODERATEcontig1212828809

IGV:Start|Jump

A/C

NGS:0.375

C90:0.000

0.375
aPT4

UNIPROT

c.238delTp.Ser80fsframeshift variantHIGHcontig1212829034

IGV:Start|Jump

AT/A

NGS:0.421

C90:0.000

0.421
aPT4

UNIPROT

c.302A>Gp.Asn101Sermissense variantMODERATEcontig1212829099

IGV:Start|Jump

A/G

NGS:0.349

C90:0.000

0.349
aPT4

UNIPROT

c.744+1_744+2delGTsplice donor variant&intron variantHIGHcontig1212831022

IGV:Start|Jump

GGTAATTTATTTTATTATAA/GAATTTATTTTATTATAA

NGS:0.004

C90:0.000

0.004
aPT4

UNIPROT

c.744+1_744+19delGTAATTTATTTTATTATAAsplice donor variant&splice region variant&intron variantHIGHcontig1212831022

IGV:Start|Jump

GGTAATTTATTTTATTATAA/G

NGS:0.096

C90:0.000

0.096
HDS-2

UNIPROT

c.82_93delGTAACCGGAACTp.Val28_Thr31delconservative inframe deletionMODERATEcontig951989748

IGV:Start|Jump

CGTAACCGGAACT/C

NGS:0.805

C90:0.000

0.805
HDS-2

UNIPROT

c.127T>Gp.Ser43Alamissense variantMODERATEcontig951989794

IGV:Start|Jump

T/G

NGS:0.721

C90:0.000

0.721


NEAREST GENETIC RELATIVES TO Cherry Blossom:
# Relative Genetic Distance
1 RSP11335-Cherry Blossom 0
2 RSP11321-Cherry Blossom 4.93
3 RSP11271-Unknown- Cherry Wine - 004 5.35
4 RSP11334-Cherry Blossom 5.46
5 RSP11332-Cherry Blossom 5.72
6 RSP11272-Unknown- Cherry Wine - 005 5.99
7 RSP11302-Cherry Blossom 6.05
8 RSP11327-Cherry Blossom 6.11
9 RSP11316-Cherry Blossom 6.15
10 RSP11269-Unknown- Cherry Wine - 002 6.16
11 RSP11311-Cherry Blossom 6.23
12 RSP11320-Cherry Blossom 6.26
13 RSP11267-Cherry Wine 6.65
14 RSP11299-Cherry Blossom 6.7
15 RSP11317-Cherry Blossom 6.84
16 RSP11268-Unknown- Cherry Wine - 001 6.87
17 RSP11326-Cherry Blossom 6.9
18 RSP11270-Unknown- Cherry Wine - 003 7.01
19 RSP11304-Cherry Blossom 7.04
20 RSP11324-Cherry Blossom 7.17
NEAREST GENETIC RELATIVES TO BASE TREE:
# Relative Genetic Distance
1 RSP10684-Blueberry Cheesecake 9.12
2 RSP11000-Liberty Haze 9.72
3 RSP11111-RKM-2018-019 9.88
4 RSP11142-Cherry 9.88
5 RSP10989-UP Sunrise 9.92
6 RSP11014-Durban Poison 10.3
7 RSP11143-Cherry 10.32
8 RSP10105-QUEEN JESUS 10.46
9 RSP10755-Recon 10.55
10 RSP10672-Blueberry Cheesecake 10.68
11 RSP11126-RKM-2018-034 11.03
12 RSP10988-The Gift 11.19
13 RSP11051-KYRG-11 11.25
14 RSP10667-Tygra 11.49
15 RSP10659-Tisza 11.51
16 RSP11114-RKM-2018-022 11.56
17 RSP11094-RKM-2018-003 11.61
18 RSP10997-Kimbo Slice 11.63
19 RSP11050-Hermaphrodite ResearchSample2 11.64
20 RSP11073-Pie Hoe 11.69
MOST GENETICALLY DISTANT STRAINS FROM Cherry Blossom:
# Strain Genetic Distance
1 RSP11075-JL yellow 15.63
2 RSP11214-JL 3rd Gen Mother 14.91
3 RSP11197-JL 3rd Gen Mother 14.66
4 RSP11199-JL 4th Gen 5 14.58
5 RSP11194-JL 4th Gen 2 14.5
6 RSP11093-RKM-2018-002 14.06
7 RSP11200-JL 4th Gen 6 14.02
8 RSP11213-80E 14.02
9 RSP11185-Chem 91 13.98
10 RSP11193-JL 4th Gen 1 13.9
11 RSP11038-Skunk 18 13.82
12 RSP11100-RKM-2018-009 13.81
13 RSP11198-JL 4th Gen 4 13.8
14 RSP11116-RKM-2018-024 13.71
15 RSP11347-Jacks Cleaner 13.6
16 RSP10551-Sour Raspberry 13.59
17 RSP11241-501st OG 13.58
18 RSP11101-RKM-2018-010 13.54
19 RSP11030-Skunk 18 13.52
20 RSP11266-Abacus 13.51
NEAREST GENETIC RELATIVES IN PHYLOS DATASET:
Phylos Strain Number of Overlapping SNPs Concordance
SRR8349297 60 37

Blockchain Registration Information:

Transaction ID: f85a049e7c6085127b8854c8a5b206290622e758b08779cf01dec9c44bce6e4d
Stamping Certificate: PDF
SHASUM Hash: b84983faec1048eafb9b161b6f10d1414adc164517f9f3969230c8ac54f11575