Cherry Blossom

RSP11314
StrainSEEK Cannabis Certification Report

Accession Date:

October 17, 2019

General Information

Strain: Cherry Blossom
Sample: CH5
RSP ID: RSP11314
Grower: Yabba Cannaba
Accession Date: October 17, 2019
Gender: Female
Strain Seek Version: V2


What does this visualization mean?

Chemical Information*


Cannabinoid and Terpenoid information provided by our Partner Labs.

CANNABINOIDS

THC + THCA %: N/A
CBD + CBDA %: N/A
THCV + THCVA %: N/A
CBC + CBCA %: N/A
CBG + CBGA %: N/A
CBN + CBNA %: N/A

TERPENOIDS

  • α-Bisabolol %: N/A
    Borneol %: N/A
    Camphene %: N/A
    Carene %: N/A
    Caryophyllene oxide %: N/A
    β-Carophyllene %: N/A
    Fenchol %: N/A
    Geraniol %: N/A
    α-Humulene %: N/A
    Limonene %: N/A
    Linalool %: N/A
  • Myrcene %: N/A
    α-Phellandrene %: N/A
    Terpinolene %: N/A
    α-Terpineol %: N/A
    α-Terpinene %: N/A
    γ-Terpinene %: N/A
    Total Nerolidol %: N/A
    Total Ocimene %: N/A
    α-Pinene %: N/A
    β-Pinene %: N/A

Genetic Information

View this strain on the Phylotree
Percent Heterozygosity: 1.44
Download VCF file: Here
Download FastQ Files: Read 1 Read 2
Download BAM file: BAM index
Download Annotated Variants: ANNOTATED VCF index
Plant Type: Type III

Bt/Bd ALLELE COVERAGE

What does this visualization mean?

CBCAS COVERAGE


What does this visualization mean?

Y-RATIO DISTRIBUTION


What does this visualization mean?


VARIANTS (THCAS, CBDAS, and CBCAS)

Gene HGVS.c HGVS.p Annotation Annotation Impact Contig Contig Pos Ref/Alt Var Freq
CBDASc.221C>Gp.Thr74Sermissense variantMODERATEcontig17722082447

IGV:Start|Jump

C/G

NGS:0.136

C90:0.057

0.136
CBDASc.1420A>Cp.Lys474Glnmissense variantMODERATEcontig17722083646

IGV:Start|Jump

A/C

NGS:0.132

C90:0.813

0.132



VARIANTS (SELECT GENES OF INTEREST)

Gene HGVS.c HGVS.p Annotation Annotation Impact Contig Contig Pos Ref/Alt Var Freq
PKSG-2a

UNIPROT

c.67T>Ap.Phe23Ilemissense variantMODERATEcontig7001945567

IGV:Start|Jump

A/T

NGS:0.825

C90:0.904

0.825
PKSG-2a

UNIPROT

c.31A>Tp.Thr11Sermissense variantMODERATEcontig7001945603

IGV:Start|Jump

T/A

NGS:0.763

C90:0.876

0.763
PKSG-2b

UNIPROT

c.1117A>Gp.Ile373Valmissense variantMODERATEcontig7001950521

IGV:Start|Jump

T/C

NGS:0.807

C90:0.981

0.807
PKSG-2b

UNIPROT

c.31A>Tp.Thr11Sermissense variantMODERATEcontig7001951851

IGV:Start|Jump

T/A

NGS:0.844

C90:0.880

0.844
PKSG-4b

UNIPROT

c.556A>Gp.Arg186Glymissense variant&splice region variantMODERATEcontig7002721117

IGV:Start|Jump

T/C

NGS:0.022

C90:0.000

0.022
PKSG-4b

UNIPROT

c.496A>Gp.Lys166Glumissense variantMODERATEcontig7002721177

IGV:Start|Jump

T/C

NGS:0.651

C90:0.684

0.651
PKSG-4b

UNIPROT

c.489delTp.Phe163fsframeshift variantHIGHcontig7002721183

IGV:Start|Jump

CA/C

NGS:0.792

C90:0.761

0.792
PKSG-4b

UNIPROT

c.485A>Gp.Lys162Argmissense variantMODERATEcontig7002721188

IGV:Start|Jump

T/C

NGS:0.643

C90:0.301

0.643
PKSG-4b

UNIPROT

c.431T>Gp.Val144Glymissense variantMODERATEcontig7002721242

IGV:Start|Jump

A/C

NGS:0.575

C90:0.679

0.575
PKSG-4b

UNIPROT

c.419A>Gp.Asp140Glymissense variantMODERATEcontig7002721254

IGV:Start|Jump

T/C

NGS:0.430

C90:0.440

0.43
aPT4

UNIPROT

c.97T>Cp.Tyr33Hismissense variantMODERATEcontig1212828753

IGV:Start|Jump

T/C

NGS:0.439

C90:0.000

0.439
aPT4

UNIPROT

c.744+1_744+19delGTAATTTATTTTATTATAAsplice donor variant&splice region variant&intron variantHIGHcontig1212831022

IGV:Start|Jump

GGTAATTTATTTTATTATAA/G

NGS:0.096

C90:0.000

0.096
HDS-2

UNIPROT

c.82_93delGTAACCGGAACTp.Val28_Thr31delconservative inframe deletionMODERATEcontig951989748

IGV:Start|Jump

CGTAACCGGAACT/C

NGS:0.805

C90:0.000

0.805
HDS-2

UNIPROT

c.127T>Gp.Ser43Alamissense variantMODERATEcontig951989794

IGV:Start|Jump

T/G

NGS:0.721

C90:0.000

0.721


NEAREST GENETIC RELATIVES TO Cherry Blossom:
# Relative Genetic Distance
1 RSP11320-Cherry Blossom 4.8
2 RSP11333-Cherry Blossom 5.34
3 RSP11313-Cherry Blossom 5.58
4 RSP11311-Cherry Blossom 5.85
5 RSP11274-Cherry Blossom 6.16
6 RSP11272-Unknown- Cherry Wine - 005 6.18
7 RSP11317-Cherry Blossom 6.59
8 RSP11327-Cherry Blossom 7.07
9 RSP11309-Cherry Blossom 7.68
10 RSP11319-Cherry Blossom 7.69
11 RSP11324-Cherry Blossom 7.87
12 RSP11316-Cherry Blossom 8.06
13 RSP11322-Cherry Blossom 8.17
14 RSP11332-Cherry Blossom 8.35
15 RSP11304-Cherry Blossom 8.35
16 RSP11335-Cherry Blossom 8.48
17 RSP11308-Cherry Blossom 8.48
18 RSP11142-Cherry 8.68
19 RSP11267-Cherry Wine 8.7
20 RSP11133-Cbot-2019-005 8.76
NEAREST GENETIC RELATIVES TO BASE TREE:
# Relative Genetic Distance
1 RSP11142-Cherry 9.12
2 RSP11133-Cbot-2019-005 9.19
3 RSP10755-Recon 10.03
4 RSP11000-Liberty Haze 10.33
5 RSP11051-KYRG-11 10.8
6 RSP10659-Tisza 10.85
7 RSP10997-Kimbo Slice 10.96
8 RSP10105-QUEEN JESUS 11.01
9 RSP10684-Blueberry Cheesecake 11.07
10 RSP11054-Kyrgyz Gold 11.25
11 RSP10989-UP Sunrise 11.42
12 RSP10667-Tygra 11.49
13 RSP10653-Jiangji 11.5
14 RSP11111-RKM-2018-019 11.65
15 RSP11037-Carmagnola 11.68
16 RSP11123-RKM-2018-031 11.69
17 RSP10979-Carmagnola 11.72
18 RSP11047-Santhica27 11.74
19 RSP10988-The Gift 11.87
20 RSP11050-Hermaphrodite ResearchSample2 11.89
NEAREST GENETIC RELATIVES IN PHYLOS DATASET:
Phylos Strain Number of Overlapping SNPs Concordance
SRR4448814 66 39

Blockchain Registration Information:

Transaction ID: fff629338ea88a8b60fe5c0065b7a137ef0f820dff189942264e689e88cc6c16
Stamping Certificate: PDF
SHASUM Hash: c57b06cc2dc953e2ddae0233ca5607431859491243290fe88a760d8290072579