Cherry Blossom

RSP11317
StrainSEEK Cannabis Certification Report

Accession Date:

October 17, 2019

General Information

Strain: Cherry Blossom
Sample: CI2
RSP ID: RSP11317
Grower: Yabba Cannaba
Accession Date: October 17, 2019
Gender: Female
Strain Seek Version: V2


What does this visualization mean?

Chemical Information*


Cannabinoid and Terpenoid information provided by our Partner Labs.

CANNABINOIDS

THC + THCA %: N/A
CBD + CBDA %: N/A
THCV + THCVA %: N/A
CBC + CBCA %: N/A
CBG + CBGA %: N/A
CBN + CBNA %: N/A

TERPENOIDS

  • α-Bisabolol %: N/A
    Borneol %: N/A
    Camphene %: N/A
    Carene %: N/A
    Caryophyllene oxide %: N/A
    β-Carophyllene %: N/A
    Fenchol %: N/A
    Geraniol %: N/A
    α-Humulene %: N/A
    Limonene %: N/A
    Linalool %: N/A
  • Myrcene %: N/A
    α-Phellandrene %: N/A
    Terpinolene %: N/A
    α-Terpineol %: N/A
    α-Terpinene %: N/A
    γ-Terpinene %: N/A
    Total Nerolidol %: N/A
    Total Ocimene %: N/A
    α-Pinene %: N/A
    β-Pinene %: N/A

Genetic Information

View this strain on the Phylotree
Percent Heterozygosity: 1.52
Download VCF file: Here
Download FastQ Files: Read 1 Read 2
Download BAM file: BAM index
Download Annotated Variants: ANNOTATED VCF index
Plant Type: Type III

Bt/Bd ALLELE COVERAGE

What does this visualization mean?

CBCAS COVERAGE


What does this visualization mean?

Y-RATIO DISTRIBUTION


What does this visualization mean?


VARIANTS (THCAS, CBDAS, and CBCAS)

Gene HGVS.c HGVS.p Annotation Annotation Impact Contig Contig Pos Ref/Alt Var Freq
CBDASc.221C>Gp.Thr74Sermissense variantMODERATEcontig17722082447

IGV:Start|Jump

C/G

NGS:0.136

C90:0.057

0.136
CBDASc.1420A>Cp.Lys474Glnmissense variantMODERATEcontig17722083646

IGV:Start|Jump

A/C

NGS:0.132

C90:0.813

0.132



VARIANTS (SELECT GENES OF INTEREST)

Gene HGVS.c HGVS.p Annotation Annotation Impact Contig Contig Pos Ref/Alt Var Freq
PKSG-2a

UNIPROT

c.67T>Ap.Phe23Ilemissense variantMODERATEcontig7001945567

IGV:Start|Jump

A/T

NGS:0.825

C90:0.904

0.825
PKSG-2a

UNIPROT

c.31A>Tp.Thr11Sermissense variantMODERATEcontig7001945603

IGV:Start|Jump

T/A

NGS:0.763

C90:0.876

0.763
PKSG-2b

UNIPROT

c.1117A>Gp.Ile373Valmissense variantMODERATEcontig7001950521

IGV:Start|Jump

T/C

NGS:0.807

C90:0.981

0.807
PKSG-2b

UNIPROT

c.31A>Tp.Thr11Sermissense variantMODERATEcontig7001951851

IGV:Start|Jump

T/A

NGS:0.844

C90:0.880

0.844
PKSG-4b

UNIPROT

c.496A>Gp.Lys166Glumissense variantMODERATEcontig7002721177

IGV:Start|Jump

T/C

NGS:0.651

C90:0.684

0.651
PKSG-4b

UNIPROT

c.489delTp.Phe163fsframeshift variantHIGHcontig7002721183

IGV:Start|Jump

CA/C

NGS:0.792

C90:0.761

0.792
PKSG-4b

UNIPROT

c.485A>Gp.Lys162Argmissense variantMODERATEcontig7002721188

IGV:Start|Jump

T/C

NGS:0.643

C90:0.301

0.643
PKSG-4b

UNIPROT

c.431T>Gp.Val144Glymissense variantMODERATEcontig7002721242

IGV:Start|Jump

A/C

NGS:0.575

C90:0.679

0.575
PKSG-4b

UNIPROT

c.419A>Gp.Asp140Glymissense variantMODERATEcontig7002721254

IGV:Start|Jump

T/C

NGS:0.430

C90:0.440

0.43
PKSG-4b

UNIPROT

c.352_355delACAGp.Thr118fsframeshift variantHIGHcontig7002721317

IGV:Start|Jump

CCTGT/C

NGS:0.529

C90:0.000

0.529
aPT4

UNIPROT

c.302A>Gp.Asn101Sermissense variantMODERATEcontig1212829099

IGV:Start|Jump

A/G

NGS:0.349

C90:0.000

0.349
aPT4

UNIPROT

c.744+1_744+19delGTAATTTATTTTATTATAAsplice donor variant&splice region variant&intron variantHIGHcontig1212831022

IGV:Start|Jump

GGTAATTTATTTTATTATAA/G

NGS:0.096

C90:0.000

0.096
HDS-2

UNIPROT

c.82_93delGTAACCGGAACTp.Val28_Thr31delconservative inframe deletionMODERATEcontig951989748

IGV:Start|Jump

CGTAACCGGAACT/C

NGS:0.805

C90:0.000

0.805
HDS-2

UNIPROT

c.127T>Gp.Ser43Alamissense variantMODERATEcontig951989794

IGV:Start|Jump

T/G

NGS:0.721

C90:0.000

0.721


NEAREST GENETIC RELATIVES TO Cherry Blossom:
# Relative Genetic Distance
1 RSP11272-Unknown- Cherry Wine - 005 5.14
2 RSP11324-Cherry Blossom 5.48
3 RSP11330-Cherry Blossom 5.5
4 RSP11333-Cherry Blossom 6.13
5 RSP11326-Cherry Blossom 6.34
6 RSP11314-Cherry Blossom 6.59
7 RSP11313-Cherry Blossom 6.61
8 RSP11335-Cherry Blossom 6.72
9 RSP11308-Cherry Blossom 6.84
10 RSP11332-Cherry Blossom 6.86
11 RSP11304-Cherry Blossom 6.96
12 RSP11271-Unknown- Cherry Wine - 004 7.05
13 RSP11322-Cherry Blossom 7.36
14 RSP11303-Cherry Blossom CBG 7.44
15 RSP11306-Cherry Blossom 7.54
16 RSP11320-Cherry Blossom 7.54
17 RSP11309-Cherry Blossom 7.88
18 RSP11145-Cherry Wine 8.05
19 RSP11142-Cherry 8.26
20 RSP11327-Cherry Blossom 8.27
NEAREST GENETIC RELATIVES TO BASE TREE:
# Relative Genetic Distance
1 RSP11142-Cherry 8.64
2 RSP10755-Recon 9.31
3 RSP11000-Liberty Haze 9.89
4 RSP11051-KYRG-11 10.23
5 RSP10989-UP Sunrise 10.27
6 RSP10659-Tisza 10.33
7 RSP11054-Kyrgyz Gold 10.5
8 RSP10684-Blueberry Cheesecake 10.58
9 RSP10667-Tygra 10.67
10 RSP10997-Kimbo Slice 10.76
11 RSP10241-Monoica 10.79
12 RSP11037-Carmagnola 10.85
13 RSP10981-USO 31 10.89
14 RSP10658-Lovrin 10.91
15 RSP10664-Futura 75 11.11
16 RSP11123-RKM-2018-031 11.13
17 RSP11129-Cbot-2019-001 11.19
18 RSP11014-Durban Poison 11.2
19 RSP11047-Santhica27 11.21
20 RSP11044-Tisza 11.3
MOST GENETICALLY DISTANT STRAINS FROM Cherry Blossom:
# Strain Genetic Distance
1 RSP11070-Danny Noonan 15.81
2 RSP11149-TI 14.96
3 RSP11185-Chem 91 14.88
4 RSP11093-RKM-2018-002 14.83
5 RSP11120-RKM-2018-028 14.73
6 RSP11075-JL yellow 14.51
7 RSP11038-Skunk 18 14.46
8 RSP11214-JL 3rd Gen Mother 14.34
9 RSP11351-T S A G E 14.3
10 RSP11030-Skunk 18 14.27
11 RSP11197-JL 3rd Gen Mother 14.22
12 RSP11323-Cherry Blossom 14.22
13 RSP11110-RKM-2018-018 14.13
14 RSP11194-JL 4th Gen 2 14.11
15 RSP11199-JL 4th Gen 5 14.06
16 RSP11115-RKM-2018-023 13.95
17 RSP11035-Black Beauty 13.84
18 RSP11122-RKM-2018-030 13.8
19 RSP10551-Sour Raspberry 13.79
20 RSP11193-JL 4th Gen 1 13.75
NEAREST GENETIC RELATIVES IN PHYLOS DATASET:
Phylos Strain Number of Overlapping SNPs Concordance
SRR4448289 64 35

Blockchain Registration Information:

Transaction ID: 805e46b54dde68864df80c9510e3daa9f97f8911978df73119a36b7c65c377b6
Stamping Certificate: PDF
SHASUM Hash: 75bf27fde3ef31c7b346104c81a354356791edc2aa658720b4fdf2bc3ea828cc