Cherry Blossom

RSP11320
StrainSEEK Cannabis Certification Report

Accession Date:

October 17, 2019

General Information

Strain: Cherry Blossom
Sample: CA9
RSP ID: RSP11320
Grower: Yabba Cannaba
Accession Date: October 17, 2019
Gender: Female
Strain Seek Version: V2


What does this visualization mean?

Chemical Information*


Cannabinoid and Terpenoid information provided by our Partner Labs.

CANNABINOIDS

THC + THCA %: N/A
CBD + CBDA %: N/A
THCV + THCVA %: N/A
CBC + CBCA %: N/A
CBG + CBGA %: N/A
CBN + CBNA %: N/A

TERPENOIDS

  • α-Bisabolol %: N/A
    Borneol %: N/A
    Camphene %: N/A
    Carene %: N/A
    Caryophyllene oxide %: N/A
    β-Carophyllene %: N/A
    Fenchol %: N/A
    Geraniol %: N/A
    α-Humulene %: N/A
    Limonene %: N/A
    Linalool %: N/A
  • Myrcene %: N/A
    α-Phellandrene %: N/A
    Terpinolene %: N/A
    α-Terpineol %: N/A
    α-Terpinene %: N/A
    γ-Terpinene %: N/A
    Total Nerolidol %: N/A
    Total Ocimene %: N/A
    α-Pinene %: N/A
    β-Pinene %: N/A

Genetic Information

View this strain on the Phylotree
Percent Heterozygosity: 1.6
Download VCF file: Here
Download FastQ Files: Read 1 Read 2
Download BAM file: BAM index
Download Annotated Variants: ANNOTATED VCF index
Plant Type: Type III

Bt/Bd ALLELE COVERAGE

What does this visualization mean?

CBCAS COVERAGE


What does this visualization mean?

Y-RATIO DISTRIBUTION


What does this visualization mean?


VARIANTS (THCAS, CBDAS, and CBCAS)

Gene HGVS.c HGVS.p Annotation Annotation Impact Contig Contig Pos Ref/Alt Var Freq
CBDASc.221C>Gp.Thr74Sermissense variantMODERATEcontig17722082447

IGV:Start|Jump

C/G

NGS:0.136

C90:0.057

0.136
CBDASc.1420A>Cp.Lys474Glnmissense variantMODERATEcontig17722083646

IGV:Start|Jump

A/C

NGS:0.132

C90:0.813

0.132



VARIANTS (SELECT GENES OF INTEREST)

Gene HGVS.c HGVS.p Annotation Annotation Impact Contig Contig Pos Ref/Alt Var Freq
PKSG-4a

UNIPROT

c.493G>Ap.Gly165Sermissense variantMODERATEcontig7001937904

IGV:Start|Jump

G/A

NGS:0.103

C90:0.000

0.103
PKSG-4a

UNIPROT

c.1191_1193delTTAp.Tyr398deldisruptive inframe deletionMODERATEcontig7001938600

IGV:Start|Jump

AATT/A

NGS:0.167

C90:0.000

0.167
PKSG-2b

UNIPROT

c.1117A>Gp.Ile373Valmissense variantMODERATEcontig7001950521

IGV:Start|Jump

T/C

NGS:0.807

C90:0.981

0.807
PKSG-2b

UNIPROT

c.774G>Ap.Met258Ilemissense variantMODERATEcontig7001950864

IGV:Start|Jump

C/T

NGS:0.366

C90:0.947

0.366
PKSG-4b

UNIPROT

c.496A>Gp.Lys166Glumissense variantMODERATEcontig7002721177

IGV:Start|Jump

T/C

NGS:0.651

C90:0.684

0.651
PKSG-4b

UNIPROT

c.489delTp.Phe163fsframeshift variantHIGHcontig7002721183

IGV:Start|Jump

CA/C

NGS:0.792

C90:0.761

0.792
PKSG-4b

UNIPROT

c.485A>Gp.Lys162Argmissense variantMODERATEcontig7002721188

IGV:Start|Jump

T/C

NGS:0.643

C90:0.301

0.643
PKSG-4b

UNIPROT

c.419A>Gp.Asp140Glymissense variantMODERATEcontig7002721254

IGV:Start|Jump

T/C

NGS:0.430

C90:0.440

0.43
PKSG-4b

UNIPROT

c.352_355delACAGp.Thr118fsframeshift variantHIGHcontig7002721317

IGV:Start|Jump

CCTGT/C

NGS:0.529

C90:0.000

0.529
PKSG-4b

UNIPROT

c.324A>Cp.Glu108Aspmissense variantMODERATEcontig7002721349

IGV:Start|Jump

T/G

NGS:0.094

C90:0.000

0.094
PKSG-4b

UNIPROT

c.323A>Gp.Glu108Glymissense variantMODERATEcontig7002721350

IGV:Start|Jump

T/C

NGS:0.469

C90:0.000

0.469
aPT4

UNIPROT

c.97T>Cp.Tyr33Hismissense variantMODERATEcontig1212828753

IGV:Start|Jump

T/C

NGS:0.439

C90:0.000

0.439
aPT4

UNIPROT

c.153A>Cp.Lys51Asnmissense variantMODERATEcontig1212828809

IGV:Start|Jump

A/C

NGS:0.375

C90:0.000

0.375
aPT4

UNIPROT

c.235_236delGTp.Val79fsframeshift variantHIGHcontig1212829030

IGV:Start|Jump

ATG/A

NGS:0.417

C90:0.000

0.417
aPT4

UNIPROT

c.238delTp.Ser80fsframeshift variantHIGHcontig1212829034

IGV:Start|Jump

AT/A

NGS:0.421

C90:0.000

0.421
aPT4

UNIPROT

c.302A>Gp.Asn101Sermissense variantMODERATEcontig1212829099

IGV:Start|Jump

A/G

NGS:0.349

C90:0.000

0.349
aPT4

UNIPROT

c.744+1_744+19delGTAATTTATTTTATTATAAsplice donor variant&splice region variant&intron variantHIGHcontig1212831022

IGV:Start|Jump

GGTAATTTATTTTATTATAA/G

NGS:0.096

C90:0.000

0.096
HDS-2

UNIPROT

c.82_93delGTAACCGGAACTp.Val28_Thr31delconservative inframe deletionMODERATEcontig951989748

IGV:Start|Jump

CGTAACCGGAACT/C

NGS:0.805

C90:0.000

0.805
HDS-2

UNIPROT

c.127T>Gp.Ser43Alamissense variantMODERATEcontig951989794

IGV:Start|Jump

T/G

NGS:0.721

C90:0.000

0.721


NEAREST GENETIC RELATIVES TO Cherry Blossom:
# Relative Genetic Distance
1 RSP11319-Cherry Blossom 3.3
2 RSP11272-Unknown- Cherry Wine - 005 3.46
3 RSP11274-Cherry Blossom 3.49
4 RSP11316-Cherry Blossom 3.62
5 RSP11332-Cherry Blossom 3.79
6 RSP11300-Cherry Blossom 4.07
7 RSP11304-Cherry Blossom 4.11
8 RSP11269-Unknown- Cherry Wine - 002 4.33
9 RSP11309-Cherry Blossom 4.4
10 RSP11312-Cherry Blossom 4.77
11 RSP11314-Cherry Blossom 4.8
12 RSP11270-Unknown- Cherry Wine - 003 4.86
13 RSP11321-Cherry Blossom 5.05
14 RSP11327-Cherry Blossom 5.16
15 RSP11313-Cherry Blossom 5.17
16 RSP11299-Cherry Blossom 5.45
17 RSP11311-Cherry Blossom 5.48
18 RSP11303-Cherry Blossom CBG 5.51
19 RSP11298-Cherry Blossom 5.54
20 RSP10684-Blueberry Cheesecake 5.66
NEAREST GENETIC RELATIVES TO BASE TREE:
# Relative Genetic Distance
1 RSP10684-Blueberry Cheesecake 5.95
2 RSP11000-Liberty Haze 7.22
3 RSP11014-Durban Poison 8.13
4 RSP10105-QUEEN JESUS 8.63
5 RSP10989-UP Sunrise 9
6 RSP10755-Recon 9.29
7 RSP11142-Cherry 9.42
8 RSP10672-Blueberry Cheesecake 9.44
9 RSP11132-Cbot-2019-004 9.63
10 RSP11123-RKM-2018-031 9.66
11 RSP11002-CST 9.79
12 RSP11096-RKM-2018-005 9.83
13 RSP11129-Cbot-2019-001 9.92
14 RSP10997-Kimbo Slice 9.93
15 RSP11050-Hermaphrodite ResearchSample2 10.14
16 RSP11048-Gold Cracker 10.32
17 RSP10659-Tisza 10.41
18 RSP11119-RKM-2018-027 10.42
19 RSP10988-The Gift 10.42
20 RSP11124-RKM-2018-032 10.53
MOST GENETICALLY DISTANT STRAINS FROM Cherry Blossom:
# Strain Genetic Distance
1 RSP11185-Chem 91 13.33
2 RSP11336-White Label 1 13.17
3 RSP11266-Abacus 13
4 RSP11213-80E 12.96
5 RSP11075-JL yellow 12.9
6 RSP11341-Garlic 12.89
7 RSP11196-JL 3rd Gen Father 12.88
8 RSP11199-JL 4th Gen 5 12.76
9 RSP11194-JL 4th Gen 2 12.73
10 RSP11190-Red Eye OG 12.69
11 RSP11352-Star Dawg 12.65
12 RSP11118-RKM-2018-026 12.6
13 RSP11211-80E 12.5
14 RSP11093-RKM-2018-002 12.48
15 RSP11214-JL 3rd Gen Mother 12.43
16 RSP10892-Feral 12.41
17 RSP11212-80E 12.37
18 RSP10233-USO31 12.35
19 RSP11128-Kush Hemp E1 12.31
20 RSP11114-RKM-2018-022 12.29
NEAREST GENETIC RELATIVES IN PHYLOS DATASET:
Phylos Strain Number of Overlapping SNPs Concordance
SRR8349179 56 37

Blockchain Registration Information:

Transaction ID: d9465503e2d946c9ae6352630ee9066293dc71b167ef41677ef8ccaaa9def426
Stamping Certificate: PDF
SHASUM Hash: 28f18672700ae2c65380ae23729a73de1e640e5219453d7a30e846bdeca8701e