Cherry Blossom

RSP11321
StrainSEEK Cannabis Certification Report

Accession Date:

October 17, 2019

General Information

Strain: Cherry Blossom
Sample: CJ5
RSP ID: RSP11321
Grower: Yabba Cannaba
Accession Date: October 17, 2019
Gender: Female
Strain Seek Version: V2


What does this visualization mean?

Chemical Information*


Cannabinoid and Terpenoid information provided by our Partner Labs.

CANNABINOIDS

THC + THCA %: N/A
CBD + CBDA %: N/A
THCV + THCVA %: N/A
CBC + CBCA %: N/A
CBG + CBGA %: N/A
CBN + CBNA %: N/A

TERPENOIDS

  • α-Bisabolol %: N/A
    Borneol %: N/A
    Camphene %: N/A
    Carene %: N/A
    Caryophyllene oxide %: N/A
    β-Carophyllene %: N/A
    Fenchol %: N/A
    Geraniol %: N/A
    α-Humulene %: N/A
    Limonene %: N/A
    Linalool %: N/A
  • Myrcene %: N/A
    α-Phellandrene %: N/A
    Terpinolene %: N/A
    α-Terpineol %: N/A
    α-Terpinene %: N/A
    γ-Terpinene %: N/A
    Total Nerolidol %: N/A
    Total Ocimene %: N/A
    α-Pinene %: N/A
    β-Pinene %: N/A

Genetic Information

View this strain on the Phylotree
Percent Heterozygosity: 1.56
Download VCF file: Here
Download FastQ Files: Read 1 Read 2
Download BAM file: BAM index
Download Annotated Variants: ANNOTATED VCF index
Plant Type: Type III

Bt/Bd ALLELE COVERAGE

What does this visualization mean?

CBCAS COVERAGE


What does this visualization mean?

Y-RATIO DISTRIBUTION


What does this visualization mean?


VARIANTS (THCAS, CBDAS, and CBCAS)

Gene HGVS.c HGVS.p Annotation Annotation Impact Contig Contig Pos Ref/Alt Var Freq
CBDASc.221C>Gp.Thr74Sermissense variantMODERATEcontig17722082447

IGV:Start|Jump

C/G

NGS:0.136

C90:0.057

0.136
CBDASc.1420A>Cp.Lys474Glnmissense variantMODERATEcontig17722083646

IGV:Start|Jump

A/C

NGS:0.132

C90:0.813

0.132



VARIANTS (SELECT GENES OF INTEREST)

Gene HGVS.c HGVS.p Annotation Annotation Impact Contig Contig Pos Ref/Alt Var Freq
PKSG-4a

UNIPROT

c.493G>Ap.Gly165Sermissense variantMODERATEcontig7001937904

IGV:Start|Jump

G/A

NGS:0.103

C90:0.000

0.103
PKSG-4a

UNIPROT

c.1191_1193delTTAp.Tyr398deldisruptive inframe deletionMODERATEcontig7001938600

IGV:Start|Jump

AATT/A

NGS:0.167

C90:0.000

0.167
PKSG-2b

UNIPROT

c.1117A>Gp.Ile373Valmissense variantMODERATEcontig7001950521

IGV:Start|Jump

T/C

NGS:0.807

C90:0.981

0.807
PKSG-4b

UNIPROT

c.496A>Gp.Lys166Glumissense variantMODERATEcontig7002721177

IGV:Start|Jump

T/C

NGS:0.651

C90:0.684

0.651
PKSG-4b

UNIPROT

c.489delTp.Phe163fsframeshift variantHIGHcontig7002721183

IGV:Start|Jump

CA/C

NGS:0.792

C90:0.761

0.792
PKSG-4b

UNIPROT

c.485A>Tp.Lys162Metmissense variantMODERATEcontig7002721188

IGV:Start|Jump

T/A

NGS:0.007

C90:0.000

0.007
PKSG-4b

UNIPROT

c.485A>Gp.Lys162Argmissense variantMODERATEcontig7002721188

IGV:Start|Jump

T/C

NGS:0.643

C90:0.301

0.643
PKSG-4b

UNIPROT

c.352_355delACAGp.Thr118fsframeshift variantHIGHcontig7002721317

IGV:Start|Jump

CCTGT/C

NGS:0.529

C90:0.000

0.529
PKSG-4b

UNIPROT

c.324A>Cp.Glu108Aspmissense variantMODERATEcontig7002721349

IGV:Start|Jump

T/G

NGS:0.094

C90:0.000

0.094
PKSG-4b

UNIPROT

c.323A>Gp.Glu108Glymissense variantMODERATEcontig7002721350

IGV:Start|Jump

T/C

NGS:0.469

C90:0.000

0.469
DXR-2

UNIPROT

c.1319T>Cp.Ile440Thrmissense variantMODERATEcontig380285250

IGV:Start|Jump

A/G

NGS:0.480

C90:0.000

0.48
aPT4

UNIPROT

c.97T>Cp.Tyr33Hismissense variantMODERATEcontig1212828753

IGV:Start|Jump

T/C

NGS:0.439

C90:0.000

0.439
aPT4

UNIPROT

c.153A>Cp.Lys51Asnmissense variantMODERATEcontig1212828809

IGV:Start|Jump

A/C

NGS:0.375

C90:0.000

0.375
aPT4

UNIPROT

c.235_236delGTp.Val79fsframeshift variantHIGHcontig1212829030

IGV:Start|Jump

ATG/A

NGS:0.417

C90:0.000

0.417
aPT4

UNIPROT

c.238delTp.Ser80fsframeshift variantHIGHcontig1212829034

IGV:Start|Jump

AT/A

NGS:0.421

C90:0.000

0.421
aPT4

UNIPROT

c.302A>Gp.Asn101Sermissense variantMODERATEcontig1212829099

IGV:Start|Jump

A/G

NGS:0.349

C90:0.000

0.349
aPT4

UNIPROT

c.744+1_744+19delGTAATTTATTTTATTATAAsplice donor variant&splice region variant&intron variantHIGHcontig1212831022

IGV:Start|Jump

GGTAATTTATTTTATTATAA/G

NGS:0.096

C90:0.000

0.096
HDS-2

UNIPROT

c.82_93delGTAACCGGAACTp.Val28_Thr31delconservative inframe deletionMODERATEcontig951989748

IGV:Start|Jump

CGTAACCGGAACT/C

NGS:0.805

C90:0.000

0.805
HDS-2

UNIPROT

c.127T>Gp.Ser43Alamissense variantMODERATEcontig951989794

IGV:Start|Jump

T/G

NGS:0.721

C90:0.000

0.721


NEAREST GENETIC RELATIVES TO Cherry Blossom:
# Relative Genetic Distance
1 RSP11268-Unknown- Cherry Wine - 001 3.93
2 RSP11308-Cherry Blossom 4.93
3 RSP11335-Cherry Blossom 5.04
4 RSP11320-Cherry Blossom 5.05
5 RSP11269-Unknown- Cherry Wine - 002 5.12
6 RSP11334-Cherry Blossom 5.39
7 RSP11302-Cherry Blossom 5.73
8 RSP11331-Cherry Blossom 6.04
9 RSP11271-Unknown- Cherry Wine - 004 6.07
10 RSP11326-Cherry Blossom 6.34
11 RSP11327-Cherry Blossom 6.45
12 RSP11332-Cherry Blossom 6.55
13 RSP11274-Cherry Blossom 6.59
14 RSP11299-Cherry Blossom 6.65
15 RSP11316-Cherry Blossom 6.73
16 RSP11272-Unknown- Cherry Wine - 005 6.75
17 RSP11301-Cherry Blossom 6.79
18 RSP11323-Cherry Blossom 6.81
19 RSP11141-2nd Gen Cherry 6.83
20 RSP11270-Unknown- Cherry Wine - 003 6.92
NEAREST GENETIC RELATIVES TO BASE TREE:
# Relative Genetic Distance
1 RSP11143-Cherry 8.57
2 RSP10684-Blueberry Cheesecake 8.62
3 RSP11014-Durban Poison 8.68
4 RSP10989-UP Sunrise 9.23
5 RSP11000-Liberty Haze 9.64
6 RSP10105-QUEEN JESUS 10.26
7 RSP10991-Golden Goat 2 10.37
8 RSP10672-Blueberry Cheesecake 10.4
9 RSP11132-Cbot-2019-004 10.64
10 RSP11096-RKM-2018-005 10.83
11 RSP11048-Gold Cracker 10.89
12 RSP10755-Recon 10.93
13 RSP11111-RKM-2018-019 10.98
14 RSP10680-Blueberry Cheesecake 11.06
15 RSP11002-CST 11.13
16 RSP11129-Cbot-2019-001 11.14
17 RSP11050-Hermaphrodite ResearchSample2 11.14
18 RSP10659-Tisza 11.16
19 RSP11142-Cherry 11.3
20 RSP10997-Kimbo Slice 11.33
MOST GENETICALLY DISTANT STRAINS FROM Cherry Blossom:
# Strain Genetic Distance
1 RSP11213-80E 14.92
2 RSP11211-80E 14.34
3 RSP11212-80E 14.31
4 RSP11266-Abacus 14.1
5 RSP11185-Chem 91 13.89
6 RSP11075-JL yellow 13.79
7 RSP11128-Kush Hemp E1 13.59
8 RSP11214-JL 3rd Gen Mother 13.42
9 RSP11164-Brunswick High 13.37
10 RSP11103-RKM-2018-012 13.34
11 RSP11353-Rugburn OG 13.32
12 RSP11205-Feral 13.3
13 RSP11114-RKM-2018-022 13.28
14 RSP11347-Jacks Cleaner 13.25
15 RSP11116-RKM-2018-024 13.23
16 RSP11341-Garlic 13.13
17 RSP11241-501st OG 13.1
18 RSP11206-Feral 13.09
19 RSP11208-CS 13.02
20 RSP11093-RKM-2018-002 13.01
NEAREST GENETIC RELATIVES IN PHYLOS DATASET:
Phylos Strain Number of Overlapping SNPs Concordance
SRR4448327 66 39

Blockchain Registration Information:

Transaction ID: b83044a7464b4439ab73173f991bf7538c42b1fff381080d0864ece6c696830e
Stamping Certificate: PDF
SHASUM Hash: a535cc9ac13f31b8a05cf3f2dae17ab702000e72e9e8b68848d89a6f95c607e2