Cherry Blossom

RSP11323
StrainSEEK Cannabis Certification Report

Accession Date:

October 18, 2019

General Information

Strain: Cherry Blossom
Sample: CI5
RSP ID: RSP11323
Grower: Yabba Cannaba
Accession Date: October 18, 2019
Gender: Female
Strain Seek Version: V2


What does this visualization mean?

Chemical Information*


Cannabinoid and Terpenoid information provided by our Partner Labs.

CANNABINOIDS

THC + THCA %: N/A
CBD + CBDA %: N/A
THCV + THCVA %: N/A
CBC + CBCA %: N/A
CBG + CBGA %: N/A
CBN + CBNA %: N/A

TERPENOIDS

  • α-Bisabolol %: N/A
    Borneol %: N/A
    Camphene %: N/A
    Carene %: N/A
    Caryophyllene oxide %: N/A
    β-Carophyllene %: N/A
    Fenchol %: N/A
    Geraniol %: N/A
    α-Humulene %: N/A
    Limonene %: N/A
    Linalool %: N/A
  • Myrcene %: N/A
    α-Phellandrene %: N/A
    Terpinolene %: N/A
    α-Terpineol %: N/A
    α-Terpinene %: N/A
    γ-Terpinene %: N/A
    Total Nerolidol %: N/A
    Total Ocimene %: N/A
    α-Pinene %: N/A
    β-Pinene %: N/A

Genetic Information

View this strain on the Phylotree
Percent Heterozygosity: 1.09
Download VCF file: Here
Download FastQ Files: Read 1 Read 2
Download BAM file: BAM index
Download Annotated Variants: ANNOTATED VCF index
Plant Type: Type III

Bt/Bd ALLELE COVERAGE

What does this visualization mean?

CBCAS COVERAGE


What does this visualization mean?

Y-RATIO DISTRIBUTION


What does this visualization mean?


VARIANTS (THCAS, CBDAS, and CBCAS)

Gene HGVS.c HGVS.p Annotation Annotation Impact Contig Contig Pos Ref/Alt Var Freq



VARIANTS (SELECT GENES OF INTEREST)

Gene HGVS.c HGVS.p Annotation Annotation Impact Contig Contig Pos Ref/Alt Var Freq
PKSG-4a

UNIPROT

c.493G>Ap.Gly165Sermissense variantMODERATEcontig7001937904

IGV:Start|Jump

G/A

NGS:0.103

C90:0.000

0.103
PKSG-4a

UNIPROT

c.1191_1193delTTAp.Tyr398deldisruptive inframe deletionMODERATEcontig7001938600

IGV:Start|Jump

AATT/A

NGS:0.167

C90:0.000

0.167
PKSG-2b

UNIPROT

c.1117A>Gp.Ile373Valmissense variantMODERATEcontig7001950521

IGV:Start|Jump

T/C

NGS:0.807

C90:0.981

0.807
PKSG-4b

UNIPROT

c.496A>Gp.Lys166Glumissense variantMODERATEcontig7002721177

IGV:Start|Jump

T/C

NGS:0.651

C90:0.684

0.651
PKSG-4b

UNIPROT

c.489delTp.Phe163fsframeshift variantHIGHcontig7002721183

IGV:Start|Jump

CA/C

NGS:0.792

C90:0.761

0.792
PKSG-4b

UNIPROT

c.485A>Gp.Lys162Argmissense variantMODERATEcontig7002721188

IGV:Start|Jump

T/C

NGS:0.643

C90:0.301

0.643
PKSG-4b

UNIPROT

c.352_355delACAGp.Thr118fsframeshift variantHIGHcontig7002721317

IGV:Start|Jump

CCTGT/C

NGS:0.529

C90:0.000

0.529
PKSG-4b

UNIPROT

c.324A>Cp.Glu108Aspmissense variantMODERATEcontig7002721349

IGV:Start|Jump

T/G

NGS:0.094

C90:0.000

0.094
PKSG-4b

UNIPROT

c.323A>Gp.Glu108Glymissense variantMODERATEcontig7002721350

IGV:Start|Jump

T/C

NGS:0.469

C90:0.000

0.469
aPT4

UNIPROT

c.97T>Cp.Tyr33Hismissense variantMODERATEcontig1212828753

IGV:Start|Jump

T/C

NGS:0.439

C90:0.000

0.439
aPT4

UNIPROT

c.153A>Cp.Lys51Asnmissense variantMODERATEcontig1212828809

IGV:Start|Jump

A/C

NGS:0.375

C90:0.000

0.375
aPT4

UNIPROT

c.235_236delGTp.Val79fsframeshift variantHIGHcontig1212829030

IGV:Start|Jump

ATG/A

NGS:0.417

C90:0.000

0.417
aPT4

UNIPROT

c.238delTp.Ser80fsframeshift variantHIGHcontig1212829034

IGV:Start|Jump

AT/A

NGS:0.421

C90:0.000

0.421
aPT4

UNIPROT

c.302A>Gp.Asn101Sermissense variantMODERATEcontig1212829099

IGV:Start|Jump

A/G

NGS:0.349

C90:0.000

0.349
aPT4

UNIPROT

c.744+1_744+19delGTAATTTATTTTATTATAAsplice donor variant&splice region variant&intron variantHIGHcontig1212831022

IGV:Start|Jump

GGTAATTTATTTTATTATAA/G

NGS:0.096

C90:0.000

0.096
HDS-2

UNIPROT

c.82_93delGTAACCGGAACTp.Val28_Thr31delconservative inframe deletionMODERATEcontig951989748

IGV:Start|Jump

CGTAACCGGAACT/C

NGS:0.805

C90:0.000

0.805
HDS-2

UNIPROT

c.127T>Gp.Ser43Alamissense variantMODERATEcontig951989794

IGV:Start|Jump

T/G

NGS:0.721

C90:0.000

0.721


NEAREST GENETIC RELATIVES TO Cherry Blossom:
# Relative Genetic Distance
1 RSP11327-Cherry Blossom 6.39
2 RSP11274-Cherry Blossom 6.52
3 RSP11321-Cherry Blossom 6.81
4 RSP11331-Cherry Blossom 7.27
5 RSP11299-Cherry Blossom 7.31
6 RSP11268-Unknown- Cherry Wine - 001 7.49
7 RSP11334-Cherry Blossom 7.65
8 RSP11318-Cherry Blossom 7.88
9 RSP11301-Cherry Blossom 8.01
10 RSP11277-Queen Dream CBG 8.13
11 RSP11303-Cherry Blossom CBG 8.18
12 RSP11289-Queen Dream 8.26
13 RSP11302-Cherry Blossom 8.38
14 RSP11315-Cherry Blossom 8.81
15 RSP11322-Cherry Blossom 9.23
16 RSP11269-Unknown- Cherry Wine - 002 9.25
17 RSP11316-Cherry Blossom 9.3
18 RSP10938-Avidekel 9.39
19 RSP11298-Cherry Blossom 9.44
20 RSP11288-Queen Dream 9.53
NEAREST GENETIC RELATIVES TO BASE TREE:
# Relative Genetic Distance
1 RSP11143-Cherry 10.52
2 RSP10989-UP Sunrise 10.74
3 RSP10684-Blueberry Cheesecake 11.43
4 RSP11129-Cbot-2019-001 11.99
5 RSP10667-Tygra 12.02
6 RSP11132-Cbot-2019-004 12.04
7 RSP11096-RKM-2018-005 12.08
8 RSP10105-QUEEN JESUS 12.41
9 RSP11110-RKM-2018-018 12.42
10 RSP10551-Sour Raspberry 12.51
11 RSP11000-Liberty Haze 12.62
12 RSP11014-Durban Poison 12.78
13 RSP10668-Ivory 12.81
14 RSP11120-RKM-2018-028 12.83
15 RSP11049-Hermaphrodite Research Sample1 13.03
16 RSP11033-Blue Dream 13.13
17 RSP10672-Blueberry Cheesecake 13.13
18 RSP11050-Hermaphrodite ResearchSample2 13.37
19 RSP10979-Carmagnola 13.43
20 RSP10659-Tisza 13.45
MOST GENETICALLY DISTANT STRAINS FROM Cherry Blossom:
# Strain Genetic Distance
1 RSP11336-White Label 1 16.34
2 RSP11142-Cherry 16.18
3 RSP11211-80E 15.89
4 RSP11213-80E 15.89
5 RSP11114-RKM-2018-022 15.6
6 RSP11118-RKM-2018-026 15.44
7 RSP11212-80E 15.4
8 RSP11353-Rugburn OG 15.07
9 RSP11266-Abacus 15.05
10 RSP11300-Cherry Blossom 14.99
11 RSP11341-Garlic 14.94
12 RSP11190-Red Eye OG 14.83
13 RSP10837-Skywalker OG 14.74
14 RSP11337-White Label 2 14.68
15 RSP11128-Kush Hemp E1 14.67
16 RSP11354-Dominion Skunk 14.6
17 RSP11104-RKM-2018-013 14.59
18 RSP11221-Big Bud 14.57
19 RSP11072-SFVxTK 14.54
20 RSP11356-Strawberry Cough 14.51
NEAREST GENETIC RELATIVES IN PHYLOS DATASET:
Phylos Strain Number of Overlapping SNPs Concordance
SRR4448209 63 40
NEAREST GENETIC RELATIVES IN LYNCH DATASET:
Nearest Lynch Strain Number of Overlapping SNPs Concordance
SRR3495321 7 7

Blockchain Registration Information:

Transaction ID: ad0115ce868ba14211b8c02d24228d429cd96e51862839b604016ecc235877c5
Stamping Certificate: PDF
SHASUM Hash: ebfa12c8bdc7a9d402eb7493c5f59e57412409544e86fb800120a17ef6e9d71a