Cherry Blossom

RSP11326
StrainSEEK Cannabis Certification Report

Accession Date:

October 18, 2019

General Information

Strain: Cherry Blossom
Sample: CG8
RSP ID: RSP11326
Grower: Yabba Cannaba
Accession Date: October 18, 2019
Gender: Female
Strain Seek Version: V2


What does this visualization mean?

Chemical Information*


Cannabinoid and Terpenoid information provided by our Partner Labs.

CANNABINOIDS

THC + THCA %: N/A
CBD + CBDA %: N/A
THCV + THCVA %: N/A
CBC + CBCA %: N/A
CBG + CBGA %: N/A
CBN + CBNA %: N/A

TERPENOIDS

  • α-Bisabolol %: N/A
    Borneol %: N/A
    Camphene %: N/A
    Carene %: N/A
    Caryophyllene oxide %: N/A
    β-Carophyllene %: N/A
    Fenchol %: N/A
    Geraniol %: N/A
    α-Humulene %: N/A
    Limonene %: N/A
    Linalool %: N/A
  • Myrcene %: N/A
    α-Phellandrene %: N/A
    Terpinolene %: N/A
    α-Terpineol %: N/A
    α-Terpinene %: N/A
    γ-Terpinene %: N/A
    Total Nerolidol %: N/A
    Total Ocimene %: N/A
    α-Pinene %: N/A
    β-Pinene %: N/A

Genetic Information

View this strain on the Phylotree
Percent Heterozygosity: 1.61
Download VCF file: Here
Download FastQ Files: Read 1 Read 2
Download BAM file: BAM index
Download Annotated Variants: ANNOTATED VCF index
Plant Type: Type III

Bt/Bd ALLELE COVERAGE

What does this visualization mean?

CBCAS COVERAGE


What does this visualization mean?

Y-RATIO DISTRIBUTION


What does this visualization mean?


VARIANTS (THCAS, CBDAS, and CBCAS)

Gene HGVS.c HGVS.p Annotation Annotation Impact Contig Contig Pos Ref/Alt Var Freq
CBDASc.221C>Gp.Thr74Sermissense variantMODERATEcontig17722082447

IGV:Start|Jump

C/G

NGS:0.136

C90:0.057

0.136
CBDASc.1420A>Cp.Lys474Glnmissense variantMODERATEcontig17722083646

IGV:Start|Jump

A/C

NGS:0.132

C90:0.813

0.132



VARIANTS (SELECT GENES OF INTEREST)

Gene HGVS.c HGVS.p Annotation Annotation Impact Contig Contig Pos Ref/Alt Var Freq
PKSG-4a

UNIPROT

c.493G>Ap.Gly165Sermissense variantMODERATEcontig7001937904

IGV:Start|Jump

G/A

NGS:0.103

C90:0.000

0.103
PKSG-4a

UNIPROT

c.1191_1193delTTAp.Tyr398deldisruptive inframe deletionMODERATEcontig7001938600

IGV:Start|Jump

AATT/A

NGS:0.167

C90:0.000

0.167
PKSG-2b

UNIPROT

c.1117A>Gp.Ile373Valmissense variantMODERATEcontig7001950521

IGV:Start|Jump

T/C

NGS:0.807

C90:0.981

0.807
PKSG-4b

UNIPROT

c.556A>Gp.Arg186Glymissense variant&splice region variantMODERATEcontig7002721117

IGV:Start|Jump

T/C

NGS:0.022

C90:0.000

0.022
PKSG-4b

UNIPROT

c.496A>Gp.Lys166Glumissense variantMODERATEcontig7002721177

IGV:Start|Jump

T/C

NGS:0.651

C90:0.684

0.651
PKSG-4b

UNIPROT

c.489delTp.Phe163fsframeshift variantHIGHcontig7002721183

IGV:Start|Jump

CA/C

NGS:0.792

C90:0.761

0.792
PKSG-4b

UNIPROT

c.485A>Gp.Lys162Argmissense variantMODERATEcontig7002721188

IGV:Start|Jump

T/C

NGS:0.643

C90:0.301

0.643
PKSG-4b

UNIPROT

c.352_355delACAGp.Thr118fsframeshift variantHIGHcontig7002721317

IGV:Start|Jump

CCTGT/C

NGS:0.529

C90:0.000

0.529
PKSG-4b

UNIPROT

c.324A>Cp.Glu108Aspmissense variantMODERATEcontig7002721349

IGV:Start|Jump

T/G

NGS:0.094

C90:0.000

0.094
PKSG-4b

UNIPROT

c.323A>Gp.Glu108Glymissense variantMODERATEcontig7002721350

IGV:Start|Jump

T/C

NGS:0.469

C90:0.000

0.469
FAD2-2

UNIPROT

c.161T>Ap.Leu54Hismissense variantMODERATEcontig831803208

IGV:Start|Jump

A/T

NGS:0.156

C90:0.000

0.156
FAD2-2

UNIPROT

c.110C>Tp.Ala37Valmissense variantMODERATEcontig831803259

IGV:Start|Jump

G/A

NGS:0.013

C90:0.000

0.013
FAD2-2

UNIPROT

c.47_57delTGAATCATACTp.Leu16fsframeshift variantHIGHcontig831803311

IGV:Start|Jump

GAGTATGATTCA/G

NGS:0.018

C90:0.000

0.018
aPT4

UNIPROT

c.97T>Cp.Tyr33Hismissense variantMODERATEcontig1212828753

IGV:Start|Jump

T/C

NGS:0.439

C90:0.000

0.439
aPT4

UNIPROT

c.153A>Cp.Lys51Asnmissense variantMODERATEcontig1212828809

IGV:Start|Jump

A/C

NGS:0.375

C90:0.000

0.375
aPT4

UNIPROT

c.235_236delGTp.Val79fsframeshift variantHIGHcontig1212829030

IGV:Start|Jump

ATG/A

NGS:0.417

C90:0.000

0.417
aPT4

UNIPROT

c.238delTp.Ser80fsframeshift variantHIGHcontig1212829034

IGV:Start|Jump

AT/A

NGS:0.421

C90:0.000

0.421
aPT4

UNIPROT

c.302A>Gp.Asn101Sermissense variantMODERATEcontig1212829099

IGV:Start|Jump

A/G

NGS:0.349

C90:0.000

0.349
aPT4

UNIPROT

c.744+1_744+19delGTAATTTATTTTATTATAAsplice donor variant&splice region variant&intron variantHIGHcontig1212831022

IGV:Start|Jump

GGTAATTTATTTTATTATAA/G

NGS:0.096

C90:0.000

0.096


NEAREST GENETIC RELATIVES TO Cherry Blossom:
# Relative Genetic Distance
1 RSP11302-Cherry Blossom 4.28
2 RSP11329-Cherry Blossom 5.21
3 RSP11304-Cherry Blossom 5.58
4 RSP11313-Cherry Blossom 5.9
5 RSP11317-Cherry Blossom 6.34
6 RSP11321-Cherry Blossom 6.34
7 RSP11320-Cherry Blossom 6.57
8 RSP11335-Cherry Blossom 6.87
9 RSP11308-Cherry Blossom 6.9
10 RSP11322-Cherry Blossom 6.98
11 RSP11286-Queen Dream CBG 7.03
12 RSP11315-Cherry Blossom 7.09
13 RSP11299-Cherry Blossom 7.09
14 RSP11316-Cherry Blossom 7.18
15 RSP11272-Unknown- Cherry Wine - 005 7.3
16 RSP11282-Queen Dream CBG 7.61
17 RSP11310-Cherry Blossom 7.72
18 RSP11277-Queen Dream CBG 7.74
19 RSP11274-Cherry Blossom 7.75
20 RSP10684-Blueberry Cheesecake 7.78
NEAREST GENETIC RELATIVES TO BASE TREE:
# Relative Genetic Distance
1 RSP10684-Blueberry Cheesecake 8.3
2 RSP11014-Durban Poison 8.66
3 RSP11142-Cherry 8.89
4 RSP11000-Liberty Haze 9.3
5 RSP10667-Tygra 9.73
6 RSP10989-UP Sunrise 9.96
7 RSP11048-Gold Cracker 10.02
8 RSP11143-Cherry 10.05
9 RSP10659-Tisza 10.11
10 RSP10991-Golden Goat 2 10.15
11 RSP10755-Recon 10.23
12 RSP10672-Blueberry Cheesecake 10.29
13 RSP11111-RKM-2018-019 10.31
14 RSP11051-KYRG-11 10.49
15 RSP11121-RKM-2018-029 10.82
16 RSP11126-RKM-2018-034 10.9
17 RSP11050-Hermaphrodite ResearchSample2 11.01
18 RSP10658-Lovrin 11.02
19 RSP10664-Futura 75 11.03
20 RSP11054-Kyrgyz Gold 11.03
MOST GENETICALLY DISTANT STRAINS FROM Cherry Blossom:
# Strain Genetic Distance
1 RSP11133-Cbot-2019-005 14.91
2 RSP11196-JL 3rd Gen Father 14.01
3 RSP11185-Chem 91 13.95
4 RSP11075-JL yellow 13.85
5 RSP11174-AVIDEKEL 2 0 13.71
6 RSP11214-JL 3rd Gen Mother 13.57
7 RSP11213-80E 13.54
8 RSP11194-JL 4th Gen 2 13.45
9 RSP11128-Kush Hemp E1 13.34
10 RSP11093-RKM-2018-002 13.34
11 RSP11212-80E 13.3
12 RSP11197-JL 3rd Gen Mother 13.25
13 RSP11148-Wife 13.22
14 RSP11169-AVIDEKEL USA 13.13
15 RSP11353-Rugburn OG 13.11
16 RSP11211-80E 13.11
17 RSP11351-T S A G E 13.07
18 RSP11193-JL 4th Gen 1 13.06
19 RSP11125-RKM-2018-033 13
20 RSP11103-RKM-2018-012 12.99
NEAREST GENETIC RELATIVES IN PHYLOS DATASET:
Phylos Strain Number of Overlapping SNPs Concordance
SRR8346727 66 36

Blockchain Registration Information:

Transaction ID: dc0c167a8f4f064ffeef48d368c83ffd58063e4dbe6ec051df6f7a63f343c353
Stamping Certificate: PDF
SHASUM Hash: fcabcc09325055ce3d2eec80e55419315165a3fe01773deefd540e55ab65f086