Cherry Blossom

RSP11334
StrainSEEK Cannabis Certification Report

Accession Date:

October 18, 2019

General Information

Strain: Cherry Blossom
Sample: CI8
RSP ID: RSP11334
Grower: Yabba Cannaba
Accession Date: October 18, 2019
Gender: Female
Strain Seek Version: V2


What does this visualization mean?

Chemical Information*


Cannabinoid and Terpenoid information provided by our Partner Labs.

CANNABINOIDS

THC + THCA %: N/A
CBD + CBDA %: N/A
THCV + THCVA %: N/A
CBC + CBCA %: N/A
CBG + CBGA %: N/A
CBN + CBNA %: N/A

TERPENOIDS

  • α-Bisabolol %: N/A
    Borneol %: N/A
    Camphene %: N/A
    Carene %: N/A
    Caryophyllene oxide %: N/A
    β-Carophyllene %: N/A
    Fenchol %: N/A
    Geraniol %: N/A
    α-Humulene %: N/A
    Limonene %: N/A
    Linalool %: N/A
  • Myrcene %: N/A
    α-Phellandrene %: N/A
    Terpinolene %: N/A
    α-Terpineol %: N/A
    α-Terpinene %: N/A
    γ-Terpinene %: N/A
    Total Nerolidol %: N/A
    Total Ocimene %: N/A
    α-Pinene %: N/A
    β-Pinene %: N/A

Genetic Information

View this strain on the Phylotree
Percent Heterozygosity: 1.5
Download VCF file: Here
Download FastQ Files: Read 1 Read 2
Download BAM file: BAM index
Download Annotated Variants: ANNOTATED VCF index
Plant Type: Type III

Bt/Bd ALLELE COVERAGE

What does this visualization mean?

CBCAS COVERAGE


What does this visualization mean?

Y-RATIO DISTRIBUTION


What does this visualization mean?


VARIANTS (THCAS, CBDAS, and CBCAS)

Gene HGVS.c HGVS.p Annotation Annotation Impact Contig Contig Pos Ref/Alt Var Freq
CBDASc.221C>Gp.Thr74Sermissense variantMODERATEcontig17722082447

IGV:Start|Jump

C/G

NGS:0.136

C90:0.057

0.136
CBDASc.1420A>Cp.Lys474Glnmissense variantMODERATEcontig17722083646

IGV:Start|Jump

A/C

NGS:0.132

C90:0.813

0.132



VARIANTS (SELECT GENES OF INTEREST)

Gene HGVS.c HGVS.p Annotation Annotation Impact Contig Contig Pos Ref/Alt Var Freq
PKSG-2a

UNIPROT

c.67T>Ap.Phe23Ilemissense variantMODERATEcontig7001945567

IGV:Start|Jump

A/T

NGS:0.825

C90:0.904

0.825
PKSG-2a

UNIPROT

c.31A>Tp.Thr11Sermissense variantMODERATEcontig7001945603

IGV:Start|Jump

T/A

NGS:0.763

C90:0.876

0.763
PKSG-2b

UNIPROT

c.1117A>Gp.Ile373Valmissense variantMODERATEcontig7001950521

IGV:Start|Jump

T/C

NGS:0.807

C90:0.981

0.807
PKSG-2b

UNIPROT

c.31A>Tp.Thr11Sermissense variantMODERATEcontig7001951851

IGV:Start|Jump

T/A

NGS:0.844

C90:0.880

0.844
PKSG-4b

UNIPROT

c.496A>Gp.Lys166Glumissense variantMODERATEcontig7002721177

IGV:Start|Jump

T/C

NGS:0.651

C90:0.684

0.651
PKSG-4b

UNIPROT

c.489delTp.Phe163fsframeshift variantHIGHcontig7002721183

IGV:Start|Jump

CA/C

NGS:0.792

C90:0.761

0.792
PKSG-4b

UNIPROT

c.485A>Gp.Lys162Argmissense variantMODERATEcontig7002721188

IGV:Start|Jump

T/C

NGS:0.643

C90:0.301

0.643
PKSG-4b

UNIPROT

c.431T>Gp.Val144Glymissense variantMODERATEcontig7002721242

IGV:Start|Jump

A/C

NGS:0.575

C90:0.679

0.575
PKSG-4b

UNIPROT

c.419A>Gp.Asp140Glymissense variantMODERATEcontig7002721254

IGV:Start|Jump

T/C

NGS:0.430

C90:0.440

0.43
PKSG-4b

UNIPROT

c.352_355delACAGp.Thr118fsframeshift variantHIGHcontig7002721317

IGV:Start|Jump

CCTGT/C

NGS:0.529

C90:0.000

0.529
aPT4

UNIPROT

c.744+1_744+19delGTAATTTATTTTATTATAAsplice donor variant&splice region variant&intron variantHIGHcontig1212831022

IGV:Start|Jump

GGTAATTTATTTTATTATAA/G

NGS:0.096

C90:0.000

0.096
HDS-2

UNIPROT

c.82_93delGTAACCGGAACTp.Val28_Thr31delconservative inframe deletionMODERATEcontig951989748

IGV:Start|Jump

CGTAACCGGAACT/C

NGS:0.805

C90:0.000

0.805
HDS-2

UNIPROT

c.127T>Gp.Ser43Alamissense variantMODERATEcontig951989794

IGV:Start|Jump

T/G

NGS:0.721

C90:0.000

0.721


NEAREST GENETIC RELATIVES TO Cherry Blossom:
# Relative Genetic Distance
1 RSP11271-Unknown- Cherry Wine - 004 4.5
2 RSP11321-Cherry Blossom 5.39
3 RSP11308-Cherry Blossom 5.46
4 RSP11335-Cherry Blossom 5.51
5 RSP11310-Cherry Blossom 6.02
6 RSP11299-Cherry Blossom 6.23
7 RSP11331-Cherry Blossom 6.34
8 RSP11311-Cherry Blossom 6.64
9 RSP11324-Cherry Blossom 6.64
10 RSP11328-Cherry Blossom 7.18
11 RSP11268-Unknown- Cherry Wine - 001 7.29
12 RSP11327-Cherry Blossom 7.4
13 RSP11269-Unknown- Cherry Wine - 002 7.56
14 RSP11333-Cherry Blossom 7.6
15 RSP11323-Cherry Blossom 7.65
16 RSP11320-Cherry Blossom 7.77
17 RSP11302-Cherry Blossom 7.82
18 RSP11301-Cherry Blossom 8.01
19 RSP11272-Unknown- Cherry Wine - 005 8.04
20 RSP11330-Cherry Blossom 8.04
NEAREST GENETIC RELATIVES TO BASE TREE:
# Relative Genetic Distance
1 RSP10755-Recon 10.34
2 RSP11143-Cherry 10.36
3 RSP10684-Blueberry Cheesecake 10.47
4 RSP11014-Durban Poison 10.55
5 RSP11133-Cbot-2019-005 10.68
6 RSP10989-UP Sunrise 10.96
7 RSP10667-Tygra 11.05
8 RSP11000-Liberty Haze 11.19
9 RSP10988-The Gift 11.48
10 RSP10105-QUEEN JESUS 11.64
11 RSP10997-Kimbo Slice 11.64
12 RSP11096-RKM-2018-005 12.03
13 RSP11050-Hermaphrodite ResearchSample2 12.03
14 RSP11111-RKM-2018-019 12.1
15 RSP10659-Tisza 12.2
16 RSP11132-Cbot-2019-004 12.24
17 RSP11054-Kyrgyz Gold 12.37
18 RSP11051-KYRG-11 12.38
19 RSP11002-CST 12.42
20 RSP10991-Golden Goat 2 12.44
NEAREST GENETIC RELATIVES IN PHYLOS DATASET:
Phylos Strain Number of Overlapping SNPs Concordance
SRR8346522 65 40

Blockchain Registration Information:

Transaction ID: 084e5bc0e5ef682bce4458fd7f4ae26cd4d5a39bec3919e59d83d3fe0085b244
Stamping Certificate: PDF
SHASUM Hash: a1c70bbfae1c04eafa6daf7945698976cdf49722f9f115eb1779153ba06f57d7