Cherry Blossom

RSP11335
StrainSEEK Cannabis Certification Report

Accession Date:

October 18, 2019

General Information

Strain: Cherry Blossom
Sample: CK3
RSP ID: RSP11335
Grower: Yabba Cannaba
Accession Date: October 18, 2019
Gender: Female
Strain Seek Version: V2


What does this visualization mean?

Chemical Information*


Cannabinoid and Terpenoid information provided by our Partner Labs.

CANNABINOIDS

THC + THCA %: N/A
CBD + CBDA %: N/A
THCV + THCVA %: N/A
CBC + CBCA %: N/A
CBG + CBGA %: N/A
CBN + CBNA %: N/A

TERPENOIDS

  • α-Bisabolol %: N/A
    Borneol %: N/A
    Camphene %: N/A
    Carene %: N/A
    Caryophyllene oxide %: N/A
    β-Carophyllene %: N/A
    Fenchol %: N/A
    Geraniol %: N/A
    α-Humulene %: N/A
    Limonene %: N/A
    Linalool %: N/A
  • Myrcene %: N/A
    α-Phellandrene %: N/A
    Terpinolene %: N/A
    α-Terpineol %: N/A
    α-Terpinene %: N/A
    γ-Terpinene %: N/A
    Total Nerolidol %: N/A
    Total Ocimene %: N/A
    α-Pinene %: N/A
    β-Pinene %: N/A

Genetic Information

View this strain on the Phylotree
Percent Heterozygosity: 1.72
Download VCF file: Here
Download FastQ Files: Read 1 Read 2
Download BAM file: BAM index
Download Annotated Variants: ANNOTATED VCF index
Plant Type: Type III

Bt/Bd ALLELE COVERAGE

What does this visualization mean?

CBCAS COVERAGE


What does this visualization mean?

Y-RATIO DISTRIBUTION


What does this visualization mean?


VARIANTS (THCAS, CBDAS, and CBCAS)

Gene HGVS.c HGVS.p Annotation Annotation Impact Contig Contig Pos Ref/Alt Var Freq
CBDASc.221C>Gp.Thr74Sermissense variantMODERATEcontig17722082447

IGV:Start|Jump

C/G

NGS:0.136

C90:0.057

0.136
CBDASc.1420A>Cp.Lys474Glnmissense variantMODERATEcontig17722083646

IGV:Start|Jump

A/C

NGS:0.132

C90:0.813

0.132



VARIANTS (SELECT GENES OF INTEREST)

Gene HGVS.c HGVS.p Annotation Annotation Impact Contig Contig Pos Ref/Alt Var Freq
PKSG-2a

UNIPROT

c.67T>Ap.Phe23Ilemissense variantMODERATEcontig7001945567

IGV:Start|Jump

A/T

NGS:0.825

C90:0.904

0.825
PKSG-2a

UNIPROT

c.31A>Tp.Thr11Sermissense variantMODERATEcontig7001945603

IGV:Start|Jump

T/A

NGS:0.763

C90:0.876

0.763
PKSG-2b

UNIPROT

c.1152T>Ap.Asn384Lysmissense variantMODERATEcontig7001950486

IGV:Start|Jump

A/T

NGS:0.715

C90:0.895

0.715
PKSG-2b

UNIPROT

c.1132C>Gp.Leu378Valmissense variantMODERATEcontig7001950506

IGV:Start|Jump

G/C

NGS:0.717

C90:0.000

0.717
PKSG-2b

UNIPROT

c.1117A>Gp.Ile373Valmissense variantMODERATEcontig7001950521

IGV:Start|Jump

T/C

NGS:0.807

C90:0.981

0.807
PKSG-2b

UNIPROT

c.774G>Ap.Met258Ilemissense variantMODERATEcontig7001950864

IGV:Start|Jump

C/T

NGS:0.366

C90:0.947

0.366
PKSG-2b

UNIPROT

c.31A>Tp.Thr11Sermissense variantMODERATEcontig7001951851

IGV:Start|Jump

T/A

NGS:0.844

C90:0.880

0.844
PKSG-4b

UNIPROT

c.496A>Gp.Lys166Glumissense variantMODERATEcontig7002721177

IGV:Start|Jump

T/C

NGS:0.651

C90:0.684

0.651
PKSG-4b

UNIPROT

c.489delTp.Phe163fsframeshift variantHIGHcontig7002721183

IGV:Start|Jump

CA/C

NGS:0.792

C90:0.761

0.792
PKSG-4b

UNIPROT

c.485A>Gp.Lys162Argmissense variantMODERATEcontig7002721188

IGV:Start|Jump

T/C

NGS:0.643

C90:0.301

0.643
PKSG-4b

UNIPROT

c.431T>Gp.Val144Glymissense variantMODERATEcontig7002721242

IGV:Start|Jump

A/C

NGS:0.575

C90:0.679

0.575
PKSG-4b

UNIPROT

c.419A>Gp.Asp140Glymissense variantMODERATEcontig7002721254

IGV:Start|Jump

T/C

NGS:0.430

C90:0.440

0.43
PKSG-4b

UNIPROT

c.352_355delACAGp.Thr118fsframeshift variantHIGHcontig7002721317

IGV:Start|Jump

CCTGT/C

NGS:0.529

C90:0.000

0.529
PKSG-4b

UNIPROT

c.323A>Gp.Glu108Glymissense variantMODERATEcontig7002721350

IGV:Start|Jump

T/C

NGS:0.469

C90:0.000

0.469
DXR-2

UNIPROT

c.1319T>Cp.Ile440Thrmissense variantMODERATEcontig380285250

IGV:Start|Jump

A/G

NGS:0.480

C90:0.000

0.48
FAD2-2

UNIPROT

c.62C>Tp.Pro21Leumissense variantMODERATEcontig831803307

IGV:Start|Jump

G/A

NGS:0.042

C90:0.000

0.042
FAD2-2

UNIPROT

c.47_57delTGAATCATACTp.Leu16fsframeshift variantHIGHcontig831803311

IGV:Start|Jump

GAGTATGATTCA/G

NGS:0.018

C90:0.000

0.018
aPT4

UNIPROT

c.97T>Cp.Tyr33Hismissense variantMODERATEcontig1212828753

IGV:Start|Jump

T/C

NGS:0.439

C90:0.000

0.439
aPT4

UNIPROT

c.153A>Cp.Lys51Asnmissense variantMODERATEcontig1212828809

IGV:Start|Jump

A/C

NGS:0.375

C90:0.000

0.375
aPT4

UNIPROT

c.235_236delGTp.Val79fsframeshift variantHIGHcontig1212829030

IGV:Start|Jump

ATG/A

NGS:0.417

C90:0.000

0.417
aPT4

UNIPROT

c.238delTp.Ser80fsframeshift variantHIGHcontig1212829034

IGV:Start|Jump

AT/A

NGS:0.421

C90:0.000

0.421
aPT4

UNIPROT

c.302A>Gp.Asn101Sermissense variantMODERATEcontig1212829099

IGV:Start|Jump

A/G

NGS:0.349

C90:0.000

0.349
aPT4

UNIPROT

c.744+1_744+19delGTAATTTATTTTATTATAAsplice donor variant&splice region variant&intron variantHIGHcontig1212831022

IGV:Start|Jump

GGTAATTTATTTTATTATAA/G

NGS:0.096

C90:0.000

0.096
HDS-2

UNIPROT

c.82_93delGTAACCGGAACTp.Val28_Thr31delconservative inframe deletionMODERATEcontig951989748

IGV:Start|Jump

CGTAACCGGAACT/C

NGS:0.805

C90:0.000

0.805
HDS-2

UNIPROT

c.127T>Gp.Ser43Alamissense variantMODERATEcontig951989794

IGV:Start|Jump

T/G

NGS:0.721

C90:0.000

0.721


NEAREST GENETIC RELATIVES TO Cherry Blossom:
# Relative Genetic Distance
1 RSP11308-Cherry Blossom 0
2 RSP11321-Cherry Blossom 5.04
3 RSP11271-Unknown- Cherry Wine - 004 5.29
4 RSP11334-Cherry Blossom 5.51
5 RSP11332-Cherry Blossom 5.75
6 RSP11272-Unknown- Cherry Wine - 005 5.98
7 RSP11302-Cherry Blossom 6.08
8 RSP11316-Cherry Blossom 6.16
9 RSP11269-Unknown- Cherry Wine - 002 6.19
10 RSP11327-Cherry Blossom 6.22
11 RSP11320-Cherry Blossom 6.27
12 RSP11311-Cherry Blossom 6.32
13 RSP11267-Cherry Wine 6.63
14 RSP11299-Cherry Blossom 6.72
15 RSP11317-Cherry Blossom 6.72
16 RSP11326-Cherry Blossom 6.87
17 RSP11268-Unknown- Cherry Wine - 001 6.98
18 RSP11270-Unknown- Cherry Wine - 003 7.04
19 RSP11304-Cherry Blossom 7.05
20 RSP11324-Cherry Blossom 7.21
NEAREST GENETIC RELATIVES TO BASE TREE:
# Relative Genetic Distance
1 RSP10684-Blueberry Cheesecake 9.08
2 RSP11000-Liberty Haze 9.67
3 RSP10989-UP Sunrise 9.69
4 RSP11111-RKM-2018-019 9.71
5 RSP11142-Cherry 9.83
6 RSP11143-Cherry 10.32
7 RSP11014-Durban Poison 10.33
8 RSP10105-QUEEN JESUS 10.57
9 RSP10755-Recon 10.58
10 RSP10672-Blueberry Cheesecake 10.65
11 RSP11126-RKM-2018-034 11.02
12 RSP10988-The Gift 11.09
13 RSP11051-KYRG-11 11.21
14 RSP11050-Hermaphrodite ResearchSample2 11.45
15 RSP11114-RKM-2018-022 11.48
16 RSP10659-Tisza 11.56
17 RSP10667-Tygra 11.56
18 RSP10991-Golden Goat 2 11.57
19 RSP11094-RKM-2018-003 11.57
20 RSP10997-Kimbo Slice 11.64
MOST GENETICALLY DISTANT STRAINS FROM Cherry Blossom:
# Strain Genetic Distance
1 RSP11075-JL yellow 15.57
2 RSP11214-JL 3rd Gen Mother 14.89
3 RSP11199-JL 4th Gen 5 14.6
4 RSP11197-JL 3rd Gen Mother 14.58
5 RSP11194-JL 4th Gen 2 14.54
6 RSP11213-80E 14.05
7 RSP11200-JL 4th Gen 6 14.01
8 RSP11093-RKM-2018-002 13.98
9 RSP11193-JL 4th Gen 1 13.95
10 RSP11185-Chem 91 13.9
11 RSP11198-JL 4th Gen 4 13.76
12 RSP11038-Skunk 18 13.75
13 RSP11100-RKM-2018-009 13.74
14 RSP11116-RKM-2018-024 13.73
15 RSP10551-Sour Raspberry 13.68
16 RSP11347-Jacks Cleaner 13.53
17 RSP11101-RKM-2018-010 13.52
18 RSP11241-501st OG 13.41
19 RSP11266-Abacus 13.35
20 RSP11211-80E 13.35
NEAREST GENETIC RELATIVES IN PHYLOS DATASET:
Phylos Strain Number of Overlapping SNPs Concordance
SRR8349070 65 39

Blockchain Registration Information:

Transaction ID: 587e67d202e5fdc14ef75c489299ee362a122eaa93cab8f1248b41364da9bf55
Stamping Certificate: PDF
SHASUM Hash: 1d47e686ae280503586fd32257f2be2055120b09eef6438d450dc1aa44e89ebb