Tisza

RSP 11044

Grower: CSU

General Information

Sample Name
Tisza-1
Accession Date
January 7, 2018
Reported Plant Sex
Male

The strain rarity visualization shows how distant the strain is from the other cultivars in the Kannapedia database. The y-axis represents genetic distance, getting farther as you go up. The width of the visualization at any position along the y-axis shows how many strains there are in the database at that genetic distance. So, a common strain will have a more bottom-heavy shape, while uncommon and rare cultivars will have a visualization that is generally shifted towards the top.

Rarity: Uncommon
Most Distant Most Similar

Chemical Information

Cannabinoid and terpenoid information provided by the grower.

Cannabinoids

No information provided.

Terpenoids

No information provided.

Genetic Information

Plant Type
Type II

The bell curve in the heterozygosity visualization shows the distribution of heterozygosity levels for cannabis cultivars in the Kannapedia database. The green line shows where this particular strain fits within the distribution. Heterozygosity is associated with heterosis (aka hybrid vigor) but also leads to the production of more variable offspring. When plants have two genetically different parents, heterozygosity levels will be higher than if it has been inbred or backcrossed repeatedly.

Heterozygosity: 1.31%
Least Heterozygous Most Heterozygous

The ratio of reads mapped to Y-contigs to reads mapped to the whole Cannabis genome (Y-ratios) has been demonstrated to be strongly correlated with plant sex typing. This plot shows the distribution of Y-ratios for all samples in our database which were sequenced with the same method (panel or WGS) as this sample and where this sample falls in the distribution.

Y-Ratio Distribution: 0.0975
male female RSP11044

This chart represents the Illumina sequence coverage over the Bt/Bd allele. These are the three regions in the cannabis genome that impact THCA, CBDA, CBGA production. Coverage over the Active CBDAS gene is highly correlated with Type II and Type III plants as described by Etienne de Meijer. Coverage over the THCA gene is highly correlated with Type I and Type II plants but is anti-correlated with Type III plants. Type I plants require coverage over the inactive CBDA loci and no coverage over the Active CBDA gene. Lack of coverage over the Active CBDA and Active THCA allele are presumed to be Type IV plants (CBGA dominant). While deletions of entire THCAS and CBDAS genes are the most common Bt:Bd alleles observed, it is possible to have plants with these genes where functional expression of the enzyme is disrupted by deactivating point mutations (Kojoma et al. 2006).

Bt/Bd Allele Coverage

This chart represents the Illumina sequence coverage over the CBCA synthase gene.

CBCAS Coverage

Variants (THCAS, CBDAS, and CBCAS)

Gene HGVS.c HGVS.p Annotation Annotation Impact Contig Contig Pos Ref/Alt Var Freq
THCAS c.187A>C p.Ile63Leu missense variant moderate contig741 4417641

IGV: Start, Jump

T/G
NGS:
0.059
C90:
0.679

Variants (Select Genes of Interest)

PKSG-2a

UniProt

c.948T>G p.Asp316Glu missense variant moderate contig700 1944442

IGV: Start, Jump

A/C
NGS:
0.079
C90:
0.000
PKSG-2a

UniProt

c.945T>G p.Ser315Arg missense variant moderate contig700 1944445

IGV: Start, Jump

A/C
NGS:
0.079
C90:
0.000
PKSG-2a

UniProt

c.944G>A p.Ser315Asn missense variant moderate contig700 1944446

IGV: Start, Jump

C/T
NGS:
0.079
C90:
0.000
PKSG-2a

UniProt

c.934C>G p.His312Asp missense variant moderate contig700 1944456

IGV: Start, Jump

G/C
NGS:
0.070
C90:
0.000
PKSG-2a

UniProt

c.-22_2delTAAAAATTATAATAATAATAATAT p.Met1del start lost & conservative inframe deletion high contig700 1945631

IGV: Start, Jump

CATATTATTATTATTATAATTTTTA/C
NGS:
0.013
C90:
0.000
PKSG-2b

UniProt

c.945T>G p.Ser315Arg missense variant moderate contig700 1950693

IGV: Start, Jump

A/C
NGS:
0.454
C90:
0.000
PKSG-2b

UniProt

c.944G>A p.Ser315Asn missense variant moderate contig700 1950694

IGV: Start, Jump

C/T
NGS:
0.445
C90:
0.000
PKSG-2b

UniProt

c.934C>G p.His312Asp missense variant moderate contig700 1950704

IGV: Start, Jump

G/C
NGS:
0.410
C90:
0.000
PKSG-2b

UniProt

c.31A>T p.Thr11Ser missense variant moderate contig700 1951851

IGV: Start, Jump

T/A
NGS:
0.844
C90:
0.880
PKSG-4b

UniProt

c.526T>C p.Trp176Arg missense variant moderate contig700 2721147

IGV: Start, Jump

A/G
NGS:
0.037
C90:
0.000
aPT1

UniProt

c.160A>C p.Thr54Pro missense variant moderate contig121 2835867

IGV: Start, Jump

A/C
NGS:
0.086
C90:
0.048
aPT1

UniProt

c.670T>A p.Ser224Thr missense variant moderate contig121 2840278

IGV: Start, Jump

T/A
NGS:
0.077
C90:
0.000
aPT1

UniProt

c.727G>T p.Glu243* stop gained high contig121 2841362

IGV: Start, Jump

G/T
NGS:
0.127
C90:
0.100
aPT1

UniProt

c.864C>G p.Asn288Lys missense variant moderate contig121 2842407

IGV: Start, Jump

C/G
NGS:
0.075
C90:
0.062
HDS-2

UniProt

c.82_93delGTAACCGGAACT p.Val28_Thr31del conservative inframe deletion moderate contig95 1989748

IGV: Start, Jump

CGTAACCGGAACT/C
NGS:
0.805
C90:
0.000

Nearest genetic relative in Phylos dataset

Phylos Strain SRR4448807
Overlapping SNPs:
113
Concordance:
70

Nearest genetic relative in Lynch dataset

Lynch Strain SRR3495166
Overlapping SNPs:
2
Concordance:
2

Blockchain Registration Information

Transaction ID
321aa23f01f531e522660d4abef1954782ecf9f65e8668330b7bcf96218afbc9
Stamping Certificate
Download PDF (864.2 KB)
SHASUM Hash
95005c68c2c3f576f9b28bd374ab50c1d4dcf49b1cf9904683a84d004aa451da
QR code for RSP11044

Kannapedia uses cookies

By clicking Allow All, you agree to the storing of cookies on your device to enhance site navigation, analyze site usage, and assist in our marketing efforts.

Customize Settings