RKM-2018-026

RSP 11118

Grower: R-Kiem Seeds

General Information

Accession Date
October 21, 2018
Reported Plant Sex
Female

The strain rarity visualization shows how distant the strain is from the other cultivars in the Kannapedia database. The y-axis represents genetic distance, getting farther as you go up. The width of the visualization at any position along the y-axis shows how many strains there are in the database at that genetic distance. So, a common strain will have a more bottom-heavy shape, while uncommon and rare cultivars will have a visualization that is generally shifted towards the top.

Rarity: Uncommon
Most Distant Most Similar

Chemical Information

Cannabinoid and terpenoid information provided by the grower.

Cannabinoids

No information provided.

Terpenoids

No information provided.

Genetic Information

Plant Type
Type I

The bell curve in the heterozygosity visualization shows the distribution of heterozygosity levels for cannabis cultivars in the Kannapedia database. The green line shows where this particular strain fits within the distribution. Heterozygosity is associated with heterosis (aka hybrid vigor) but also leads to the production of more variable offspring. When plants have two genetically different parents, heterozygosity levels will be higher than if it has been inbred or backcrossed repeatedly.

Heterozygosity: 1.45%
Least Heterozygous Most Heterozygous

The ratio of reads mapped to Y-contigs to reads mapped to the whole Cannabis genome (Y-ratios) has been demonstrated to be strongly correlated with plant sex typing. This plot shows the distribution of Y-ratios for all samples in our database which were sequenced with the same method (panel or WGS) as this sample and where this sample falls in the distribution.

Y-Ratio Distribution: 0.0488
male female RSP11118

This chart represents the Illumina sequence coverage over the Bt/Bd allele. These are the three regions in the cannabis genome that impact THCA, CBDA, CBGA production. Coverage over the Active CBDAS gene is highly correlated with Type II and Type III plants as described by Etienne de Meijer. Coverage over the THCA gene is highly correlated with Type I and Type II plants but is anti-correlated with Type III plants. Type I plants require coverage over the inactive CBDA loci and no coverage over the Active CBDA gene. Lack of coverage over the Active CBDA and Active THCA allele are presumed to be Type IV plants (CBGA dominant). While deletions of entire THCAS and CBDAS genes are the most common Bt:Bd alleles observed, it is possible to have plants with these genes where functional expression of the enzyme is disrupted by deactivating point mutations (Kojoma et al. 2006).

Bt/Bd Allele Coverage

This chart represents the Illumina sequence coverage over the CBCA synthase gene.

CBCAS Coverage

Variants (THCAS, CBDAS, and CBCAS)

Gene HGVS.c HGVS.p Annotation Annotation Impact Contig Contig Pos Ref/Alt Var Freq
THCAS c.187A>C p.Ile63Leu missense variant moderate contig741 4417641

IGV: Start, Jump

T/G
NGS:
0.059
C90:
0.679

Variants (Select Genes of Interest)

PKSG-2a

UniProt

c.67T>A p.Phe23Ile missense variant moderate contig700 1945567

IGV: Start, Jump

A/T
NGS:
0.825
C90:
0.904
PKSG-2a

UniProt

c.31A>T p.Thr11Ser missense variant moderate contig700 1945603

IGV: Start, Jump

T/A
NGS:
0.763
C90:
0.876
PKSG-2b

UniProt

c.1152T>A p.Asn384Lys missense variant moderate contig700 1950486

IGV: Start, Jump

A/T
NGS:
0.715
C90:
0.895
PKSG-2b

UniProt

c.1132C>G p.Leu378Val missense variant moderate contig700 1950506

IGV: Start, Jump

G/C
NGS:
0.717
C90:
0.000
PKSG-2b

UniProt

c.1117A>G p.Ile373Val missense variant moderate contig700 1950521

IGV: Start, Jump

T/C
NGS:
0.807
C90:
0.981
PKSG-2b

UniProt

c.948T>G p.Asp316Glu missense variant moderate contig700 1950690

IGV: Start, Jump

A/C
NGS:
0.456
C90:
0.000
PKSG-2b

UniProt

c.945T>G p.Ser315Arg missense variant moderate contig700 1950693

IGV: Start, Jump

A/C
NGS:
0.454
C90:
0.000
PKSG-2b

UniProt

c.934C>G p.His312Asp missense variant moderate contig700 1950704

IGV: Start, Jump

G/C
NGS:
0.410
C90:
0.000
PKSG-2b

UniProt

c.31A>T p.Thr11Ser missense variant moderate contig700 1951851

IGV: Start, Jump

T/A
NGS:
0.844
C90:
0.880
aPT4

UniProt

c.515+41_519delTATAATATTGATTACACTTAATTAATATAATTTTCATTATCAGGATA p.Ile173fs frameshift variant & splice acceptor variant & splice region variant & intron variant high contig121 2830750

IGV: Start, Jump

CTATAATATTGATTACACTTAATTAATATAATTTTCATTATCAGGATA/C
NGS:
0.002
C90:
0.000
aPT1

UniProt

c.629C>T p.Thr210Ile missense variant moderate contig121 2840237

IGV: Start, Jump

C/T
NGS:
0.561
C90:
0.598
HDS-2

UniProt

c.82_93delGTAACCGGAACT p.Val28_Thr31del conservative inframe deletion moderate contig95 1989748

IGV: Start, Jump

CGTAACCGGAACT/C
NGS:
0.805
C90:
0.000
HDS-2

UniProt

c.127T>G p.Ser43Ala missense variant moderate contig95 1989794

IGV: Start, Jump

T/G
NGS:
0.721
C90:
0.000

Nearest genetic relatives (All Samples)

0 0.058 0.117 0.175 0.233
clone distance sibling distance more distant
  1. 0.139 Skywalker OG (RSP10837)
  2. 0.141 SFVxTK (RSP11072)
  3. 0.146 Rugburn OG (RSP11353)
  4. 0.157 Red Eye OG (RSP11190)
  5. 0.164 RKM-2018-013 (RSP11104)
  6. 0.178 Garlic (RSP11341)
  7. 0.194 RKM-2018-012 (RSP11103)
  8. 0.197 Gorilla Cookies (RSP11231)
  9. 0.198 501st OG (RSP11241)
  10. 0.198 Pie Hoe (RSP11073)
  11. 0.203 Hermaphrodite ResearchSample2 (RSP11050)
  12. 0.204 Blueberry Cheesecake (RSP10680)
  13. 0.205 RKM-2018-034 (RSP11126)
  14. 0.209 Star Dawg (RSP11352)
  15. 0.213 RKM-2018-008 (RSP11099)
  16. 0.219 Sunday Driver (RSP11071)
  17. 0.221 Grape Stomper (RSP11180)
  18. 0.223 The Gift (RSP10988)
  19. 0.226 NSPM1 (RSP11362)
  20. 0.228 Hermaphrodite ResearchSample2 (RSP11043)

Nearest genetic relatives (Base Tree)

0 0.083 0.167 0.250 0.333
clone distance sibling distance more distant
  1. 0.141 Skywalker OG (RSP10837)
  2. 0.203 Pie Hoe (RSP11073)
  3. 0.207 Hermaphrodite ResearchSample2 (RSP11050)
  4. 0.208 RKM-2018-034 (RSP11126)
  5. 0.210 Blueberry Cheesecake (RSP10680)
  6. 0.217 The Gift (RSP10988)
  7. 0.231 RKM-2018-033 (RSP11125)
  8. 0.235 RKM-2018-032 (RSP11124)
  9. 0.239 RKM-2018-020 (RSP11112)
  10. 0.249 RKM-2018-005 (RSP11096)
  11. 0.252 RKM-2018-002 (RSP11093)
  12. 0.262 Kimbo Slice (RSP10997)
  13. 0.267 RKM-2018-009 (RSP11100)
  14. 0.276 Kush Hemp E1 (RSP11128)
  15. 0.289 Sour Raspberry (RSP10551)
  16. 0.291 Blueberry Cheesecake (RSP10684)
  17. 0.308 RKM-2018-029 (RSP11121)
  18. 0.311 Durban Poison (RSP11014)
  19. 0.312 Gold Cracker (RSP11048)
  20. 0.312 Kyrgyz Gold (RSP11054)

Most genetically distant strains (All Samples)

0 0.133 0.267 0.400 0.533
clone distance sibling distance more distant
  1. 0.515 Cherry Blossom (RSP11323)
  2. 0.513 Cherry Blossom (RSP11318)
  3. 0.488 Unknown- Cherry Wine - 001 (RSP11268)
  4. 0.483 Cherry Blossom (RSP11274)
  5. 0.482 Cherry Blossom (RSP11312)
  6. 0.477 Unknown- Cherry Wine - 002 (RSP11269)
  7. 0.477 Wife (RSP11148)
  8. 0.476 Cherry Blossom (RSP11298)
  9. 0.474 Unknown- Cherry Wine - 003 (RSP11270)
  10. 0.473 Avidekel (RSP10938)
  11. 0.472 Cherry Blossom (RSP11301)
  12. 0.466 Cherry Blossom (RSP11328)
  13. 0.463 Cherry Blossom (RSP11331)
  14. 0.462 Cherry Blossom (RSP11327)
  15. 0.461 Cherry Blossom (RSP11302)
  16. 0.459 Cherry Blossom (RSP11311)
  17. 0.459 Cherry Blossom (RSP11315)
  18. 0.458 Cherry Blossom (RSP11300)
  19. 0.458 Cherry Blossom (RSP11306)
  20. 0.457 Cherry Blossom (RSP11310)

Most genetically distant strains (Base Tree)

0 0.108 0.217 0.325 0.433
clone distance sibling distance more distant
  1. 0.428 Cherry (RSP11143)
  2. 0.393 Cbot-2019-001 (RSP11129)
  3. 0.386 Cherry (RSP11142)
  4. 0.383 Cbot-2019-005 (RSP11133)
  5. 0.379 RKM-2018-023 (RSP11115)
  6. 0.373 RKM-2018-018 (RSP11110)
  7. 0.372 UP Sunrise (RSP10989)
  8. 0.370 Blueberry Cheesecake (RSP10672)
  9. 0.362 JL yellow (RSP11075)
  10. 0.359 RKM-2018-028 (RSP11120)
  11. 0.358 Black Beauty (RSP11035)
  12. 0.355 Italian Kiss (RSP11034)
  13. 0.354 RKM-2018-031 (RSP11123)
  14. 0.353 RKM-2018-006 (RSP11097)
  15. 0.352 RKM-2018-027 (RSP11119)
  16. 0.351 Carmagnola (RSP11037)
  17. 0.351 RKM-2018-022 (RSP11114)
  18. 0.349 RKM-2018-003 (RSP11094)
  19. 0.347 Cbot-2019-004 (RSP11132)
  20. 0.341 CST (RSP11002)

Nearest genetic relative in Phylos dataset

Phylos Strain SRR8346878
Overlapping SNPs:
79
Concordance:
60

Nearest genetic relative in Lynch dataset

Lynch Strain SRR3495243
Overlapping SNPs:
4
Concordance:
4

Blockchain Registration Information

Transaction ID
260e497261b87418e63b1823c470a65b918e192f7bd79d953a91e78d3e868a18
Stamping Certificate
Download PDF (861.7 KB)
SHASUM Hash
c3e901c609b3abec48cb191b3e6f74b7a46b49015724dae6b5bf5453575b223f
QR code for RSP11118

Kannapedia uses cookies

By clicking Allow All, you agree to the storing of cookies on your device to enhance site navigation, analyze site usage, and assist in our marketing efforts.

Customize Settings