Arcata Trainwreck

RSP 11176

Grower: NETA

General Information

Sample Name
Arcata Trainwreck _29NOV2016
Accession Date
June 25, 2019
Reported Plant Sex
Female

The strain rarity visualization shows how distant the strain is from the other cultivars in the Kannapedia database. The y-axis represents genetic distance, getting farther as you go up. The width of the visualization at any position along the y-axis shows how many strains there are in the database at that genetic distance. So, a common strain will have a more bottom-heavy shape, while uncommon and rare cultivars will have a visualization that is generally shifted towards the top.

Rarity: Rare
Most Distant Most Similar

Chemical Information

Cannabinoid and terpenoid information provided by the grower.

Cannabinoids

THC + THCA
12.6%
CBD + CBDA
0.%
THCV + THCVA
0.%
CBC + CBCA
0.1%
CBG + CBGA
0.6%
CBN + CBNA
0.%

Terpenoids

α-Bisabolol
0.002%
Borneol
0.002%
Camphene
0.003%
Carene
0.014%
Caryophyllene oxide
n/a
β-Caryophyllene
0.086%
Fenchol
0.001%
Geraniol
n/a
α-Humulene
0.025%
Limonene
0.045%
Linalool
0.006%
Myrcene
0.05%
α-Phellandrene
0.011%
Terpinolene
0.198%
α-Terpineol
0.016%
α-Terpinene
0.012%
γ-Terpinene
0.01%
Total Nerolidol
0.005%
Total Ocimene
0.043%
α-Pinene
0.042%
β-Pinene
0.064%

Genetic Information

Plant Type
Type I

The bell curve in the heterozygosity visualization shows the distribution of heterozygosity levels for cannabis cultivars in the Kannapedia database. The green line shows where this particular strain fits within the distribution. Heterozygosity is associated with heterosis (aka hybrid vigor) but also leads to the production of more variable offspring. When plants have two genetically different parents, heterozygosity levels will be higher than if it has been inbred or backcrossed repeatedly.

Heterozygosity: 1.99%
Least Heterozygous Most Heterozygous

This chart represents the Illumina sequence coverage over the Bt/Bd allele. These are the three regions in the cannabis genome that impact THCA, CBDA, CBGA production. Coverage over the Active CBDAS gene is highly correlated with Type II and Type III plants as described by Etienne de Meijer. Coverage over the THCA gene is highly correlated with Type I and Type II plants but is anti-correlated with Type III plants. Type I plants require coverage over the inactive CBDA loci and no coverage over the Active CBDA gene. Lack of coverage over the Active CBDA and Active THCA allele are presumed to be Type IV plants (CBGA dominant). While deletions of entire THCAS and CBDAS genes are the most common Bt:Bd alleles observed, it is possible to have plants with these genes where functional expression of the enzyme is disrupted by deactivating point mutations (Kojoma et al. 2006).

Bt/Bd Allele Coverage

This chart represents the Illumina sequence coverage over the CBCA synthase gene.

CBCAS Coverage

Variants (THCAS, CBDAS, and CBCAS)

Gene HGVS.c HGVS.p Annotation Annotation Impact Contig Contig Pos Ref/Alt Var Freq
CBCAS c.1420C>T p.Pro474Ser missense variant moderate contig756 3100726

IGV: Start, Jump

C/T
NGS:
0.009
C90:
0.000

Variants (Select Genes of Interest)

PKSA-3b

UniProt

c.298G>A p.Ala100Thr missense variant moderate contig705 2271640

IGV: Start, Jump

C/T
NGS:
0.044
C90:
0.177
EMF1-2

UniProt

c.3G>T p.Met1? start lost high contig885 103

IGV: Start, Jump

G/T
NGS:
0.007
C90:
0.000
EMF1-2

UniProt

c.349G>A p.Asp117Asn missense variant moderate contig885 449

IGV: Start, Jump

G/A
NGS:
0.004
C90:
0.000
EMF1-2

UniProt

c.572A>G p.Asn191Ser missense variant moderate contig885 672

IGV: Start, Jump

A/G
NGS:
0.004
C90:
0.000
EMF1-2

UniProt

c.710A>C p.His237Pro missense variant moderate contig885 810

IGV: Start, Jump

A/C
NGS:
0.090
C90:
0.474
EMF1-2

UniProt

c.1148C>T p.Ala383Val missense variant moderate contig885 2034

IGV: Start, Jump

C/T
NGS:
0.007
C90:
0.000
EMF1-2

UniProt

c.1187T>C p.Leu396Ser missense variant moderate contig885 2073

IGV: Start, Jump

T/C
NGS:
0.026
C90:
0.000
EMF1-2

UniProt

c.1189G>A p.Ala397Thr missense variant moderate contig885 2075

IGV: Start, Jump

G/A
NGS:
0.007
C90:
0.000
EMF1-2

UniProt

c.1199G>A p.Arg400Lys missense variant moderate contig885 2085

IGV: Start, Jump

G/A
NGS:
0.007
C90:
0.000
EMF1-2

UniProt

c.1332_1336delCCAGC p.Gln445fs frameshift variant high contig885 2217

IGV: Start, Jump

GCCAGC/G
NGS:
0.002
C90:
0.000
EMF1-2

UniProt

c.1331G>A p.Ser444Asn missense variant moderate contig885 2217

IGV: Start, Jump

GCCAGC/ACCAGC
NGS:
0.004
C90:
0.000
EMF1-2

UniProt

c.1409G>A p.Arg470Lys missense variant moderate contig885 2295

IGV: Start, Jump

G/A
NGS:
0.007
C90:
0.000
EMF1-2

UniProt

c.1828A>G p.Ile610Val missense variant moderate contig885 2714

IGV: Start, Jump

A/G
NGS:
0.007
C90:
0.000
EMF1-2

UniProt

c.2008C>T p.Pro670Ser missense variant moderate contig885 2894

IGV: Start, Jump

C/T
NGS:
0.007
C90:
0.000
EMF1-2

UniProt

c.2256A>T p.Lys752Asn missense variant moderate contig885 3142

IGV: Start, Jump

A/T
NGS:
0.026
C90:
0.000
EMF1-2

UniProt

c.2653A>G p.Thr885Ala missense variant moderate contig885 3539

IGV: Start, Jump

A/G
NGS:
0.007
C90:
0.000
PHL-2 c.44G>A p.Arg15Lys missense variant moderate contig2621 337613

IGV: Start, Jump

G/A
NGS:
0.015
C90:
0.167
PHL-2 c.575T>C p.Ile192Thr missense variant moderate contig2621 339568

IGV: Start, Jump

T/C
NGS:
0.009
C90:
0.000
PHL-2 c.932T>C p.Leu311Pro missense variant moderate contig2621 340210

IGV: Start, Jump

T/C
NGS:
0.039
C90:
0.268
PHL-2 c.1057A>G p.Arg353Gly missense variant moderate contig2621 340335

IGV: Start, Jump

A/G
NGS:
0.096
C90:
0.555
PHL-2 c.1096G>A p.Ala366Thr missense variant moderate contig2621 340374

IGV: Start, Jump

G/A
NGS:
0.090
C90:
0.531
PHL-2 c.1837G>A p.Glu613Lys missense variant moderate contig2621 341115

IGV: Start, Jump

G/A
NGS:
0.009
C90:
0.000
PHL-2 c.2564T>A p.Phe855Tyr missense variant moderate contig2621 342607

IGV: Start, Jump

T/A
NGS:
0.064
C90:
0.732
PHL-2 c.2578T>A p.Leu860Ile missense variant moderate contig2621 342621

IGV: Start, Jump

T/A
NGS:
0.068
C90:
0.746
PHL-2 c.2624C>T p.Ser875Phe missense variant moderate contig2621 342667

IGV: Start, Jump

C/T
NGS:
0.042
C90:
0.268
PHL-2 c.2783G>A p.Ser928Asn missense variant moderate contig2621 342826

IGV: Start, Jump

G/A
NGS:
0.107
C90:
0.890
PHL-2 c.2830A>C p.Asn944His missense variant moderate contig2621 342873

IGV: Start, Jump

A/C
NGS:
0.044
C90:
0.000
PHL-2 c.2834A>G p.Asn945Ser missense variant moderate contig2621 342877

IGV: Start, Jump

A/G
NGS:
0.004
C90:
0.000
PHL-2 c.2903_2905dupGCA p.Ser968dup disruptive inframe insertion moderate contig2621 342939

IGV: Start, Jump

T/TGCA
NGS:
0.018
C90:
0.522
PHL-2 c.2933G>T p.Arg978Leu missense variant moderate contig2621 342976

IGV: Start, Jump

G/T
NGS:
0.048
C90:
0.297
PHL-2 c.2936T>G p.Val979Gly missense variant moderate contig2621 342979

IGV: Start, Jump

T/G
NGS:
0.048
C90:
0.000
PHL-2 c.3209A>G p.Gln1070Arg missense variant moderate contig2621 343252

IGV: Start, Jump

A/G
NGS:
0.103
C90:
0.885
PHL-2 c.3379C>G p.His1127Asp missense variant moderate contig2621 343422

IGV: Start, Jump

C/G
NGS:
0.004
C90:
0.000
PHL-2 c.3380A>G p.His1127Arg missense variant moderate contig2621 343423

IGV: Start, Jump

A/G
NGS:
0.004
C90:
0.000
PHL-2 c.3381T>A p.His1127Gln missense variant moderate contig2621 343424

IGV: Start, Jump

T/A
NGS:
0.004
C90:
0.000
PHL-2 c.3457A>G p.Thr1153Ala missense variant moderate contig2621 343500

IGV: Start, Jump

A/G
NGS:
0.002
C90:
0.000
PHL-2 c.3467A>G p.Gln1156Arg missense variant moderate contig2621 343510

IGV: Start, Jump

A/G
NGS:
0.064
C90:
0.713
PHL-2 c.3556_3557delAA p.Lys1186fs frameshift variant high contig2621 343598

IGV: Start, Jump

GAA/G
NGS:
0.013
C90:
0.096
PKSG-2a

UniProt

c.67T>A p.Phe23Ile missense variant moderate contig700 1945567

IGV: Start, Jump

A/T
NGS:
0.825
C90:
0.904
PKSG-2a

UniProt

c.31A>T p.Thr11Ser missense variant moderate contig700 1945603

IGV: Start, Jump

T/A
NGS:
0.763
C90:
0.876
PKSG-2b

UniProt

c.1152T>A p.Asn384Lys missense variant moderate contig700 1950486

IGV: Start, Jump

A/T
NGS:
0.715
C90:
0.895
PKSG-2b

UniProt

c.1132C>G p.Leu378Val missense variant moderate contig700 1950506

IGV: Start, Jump

G/C
NGS:
0.717
C90:
0.000
PKSG-2b

UniProt

c.1117A>G p.Ile373Val missense variant moderate contig700 1950521

IGV: Start, Jump

T/C
NGS:
0.807
C90:
0.981
PKSG-2b

UniProt

c.774G>A p.Met258Ile missense variant moderate contig700 1950864

IGV: Start, Jump

C/T
NGS:
0.366
C90:
0.947
PKSG-2b

UniProt

c.718T>A p.Phe240Ile missense variant moderate contig700 1950920

IGV: Start, Jump

A/T
NGS:
0.114
C90:
0.000
PKSG-2b

UniProt

c.560C>T p.Thr187Met missense variant moderate contig700 1951078

IGV: Start, Jump

G/A
NGS:
0.050
C90:
0.000
PKSG-2b

UniProt

c.558G>A p.Met186Ile missense variant moderate contig700 1951080

IGV: Start, Jump

C/T
NGS:
0.050
C90:
0.000
PKSG-2b

UniProt

c.31A>T p.Thr11Ser missense variant moderate contig700 1951851

IGV: Start, Jump

T/A
NGS:
0.844
C90:
0.880
PKSG-2b

UniProt

c.-2_1dupATA start lost & conservative inframe insertion high contig700 1951880

IGV: Start, Jump

A/ATAT
NGS:
0.410
C90:
0.000
PKSG-4b

UniProt

c.567T>A p.Asn189Lys missense variant moderate contig700 2715027

IGV: Start, Jump

A/T
NGS:
0.002
C90:
0.000
PKSG-4b

UniProt

c.535_545delATTGGAGTGGG p.Ile179fs frameshift variant high contig700 2721127

IGV: Start, Jump

CCCCACTCCAAT/C
NGS:
0.105
C90:
0.000
PKSG-4b

UniProt

c.544G>T p.Gly182Trp missense variant moderate contig700 2721129

IGV: Start, Jump

C/A
NGS:
0.055
C90:
0.000
PKSG-4b

UniProt

c.541G>C p.Val181Leu missense variant moderate contig700 2721132

IGV: Start, Jump

C/G
NGS:
0.004
C90:
0.000
PKSG-4b

UniProt

c.523C>T p.His175Tyr missense variant moderate contig700 2721150

IGV: Start, Jump

G/A
NGS:
0.112
C90:
0.325
PKSG-4b

UniProt

c.489delT p.Phe163fs frameshift variant high contig700 2721183

IGV: Start, Jump

CA/C
NGS:
0.792
C90:
0.761
PKSG-4b

UniProt

c.352_355delACAG p.Thr118fs frameshift variant high contig700 2721317

IGV: Start, Jump

CCTGT/C
NGS:
0.529
C90:
0.000
PKSG-4b

UniProt

c.353_354insCC p.Gly119fs frameshift variant high contig700 2721319

IGV: Start, Jump

T/TGG
NGS:
0.175
C90:
0.000
PKSG-4b

UniProt

c.323A>G p.Glu108Gly missense variant moderate contig700 2721350

IGV: Start, Jump

T/C
NGS:
0.469
C90:
0.000
PKSG-4b

UniProt

c.316+2T>A splice donor variant & intron variant high contig700 2723818

IGV: Start, Jump

A/T
NGS:
0.070
C90:
0.689
PKSG-4b

UniProt

c.229G>A p.Gly77Ser missense variant moderate contig700 2724206

IGV: Start, Jump

C/T
NGS:
0.042
C90:
0.000
PKSG-4b

UniProt

c.216G>C p.Leu72Phe missense variant moderate contig700 2724219

IGV: Start, Jump

C/G
NGS:
0.044
C90:
0.000
PKSG-4b

UniProt

c.206T>C p.Leu69Ser missense variant moderate contig700 2724229

IGV: Start, Jump

A/G
NGS:
0.044
C90:
0.000
PKSG-4b

UniProt

c.143G>A p.Arg48Gln missense variant moderate contig700 2724292

IGV: Start, Jump

C/T
NGS:
0.002
C90:
0.000
AAE1-1

UniProt

c.1580A>G p.Asn527Ser missense variant moderate contig606 3242691

IGV: Start, Jump

T/C
NGS:
0.004
C90:
0.000
AAE1-1

UniProt

c.1504G>A p.Asp502Asn missense variant moderate contig606 3242767

IGV: Start, Jump

C/T
NGS:
0.004
C90:
0.000
AAE1-1

UniProt

c.946G>A p.Ala316Thr missense variant moderate contig606 3243325

IGV: Start, Jump

C/T
NGS:
0.004
C90:
0.000
AAE1-1

UniProt

c.454A>G p.Lys152Glu missense variant moderate contig606 3243817

IGV: Start, Jump

T/C
NGS:
0.007
C90:
0.000
DXR-2

UniProt

c.1319T>C p.Ile440Thr missense variant moderate contig380 285250

IGV: Start, Jump

A/G
NGS:
0.480
C90:
0.000
FAD2-2

UniProt

c.196T>C p.Phe66Leu missense variant moderate contig83 1803173

IGV: Start, Jump

A/G
NGS:
0.033
C90:
0.000
FAD2-2

UniProt

c.172G>T p.Asp58Tyr missense variant moderate contig83 1803197

IGV: Start, Jump

C/A
NGS:
0.070
C90:
0.000
FAD2-2

UniProt

c.161T>A p.Leu54His missense variant moderate contig83 1803208

IGV: Start, Jump

A/T
NGS:
0.156
C90:
0.000
ELF3

UniProt

c.358G>A p.Gly120Arg missense variant moderate contig97 242064

IGV: Start, Jump

G/A
NGS:
0.099
C90:
0.493
ELF3

UniProt

c.520A>C p.Asn174His missense variant moderate contig97 242226

IGV: Start, Jump

A/C
NGS:
0.094
C90:
0.502
ELF3

UniProt

c.574A>G p.Asn192Asp missense variant moderate contig97 242280

IGV: Start, Jump

A/G
NGS:
0.042
C90:
0.579
ELF3

UniProt

c.772A>G p.Ser258Gly missense variant moderate contig97 242478

IGV: Start, Jump

A/G
NGS:
0.112
C90:
0.000
ELF3

UniProt

c.812G>C p.Gly271Ala missense variant moderate contig97 242518

IGV: Start, Jump

G/C
NGS:
0.114
C90:
0.938
ELF3

UniProt

c.1230-2_1230-1delAG splice acceptor variant & intron variant high contig97 243676

IGV: Start, Jump

TAG/T
NGS:
0.088
C90:
0.450
ELF3

UniProt

c.1466G>A p.Ser489Asn missense variant moderate contig97 244297

IGV: Start, Jump

G/A
NGS:
0.123
C90:
0.000
ELF3

UniProt

c.1630A>G p.Thr544Ala missense variant moderate contig97 244461

IGV: Start, Jump

A/G
NGS:
0.103
C90:
0.545
ELF3

UniProt

c.1803_1805delTCA p.His601del disruptive inframe deletion moderate contig97 244625

IGV: Start, Jump

ACAT/A
NGS:
0.092
C90:
0.000
ELF3

UniProt

c.1966C>G p.Pro656Ala missense variant moderate contig97 244797

IGV: Start, Jump

C/G
NGS:
0.123
C90:
0.632
ELF3

UniProt

c.2141C>G p.Pro714Arg missense variant moderate contig97 244972

IGV: Start, Jump

C/G
NGS:
0.088
C90:
0.335
ELF3

UniProt

c.2198G>T p.Arg733Leu missense variant moderate contig97 245029

IGV: Start, Jump

G/T
NGS:
0.125
C90:
0.531
ELF3

UniProt

c.2216A>G p.His739Arg missense variant moderate contig97 245047

IGV: Start, Jump

A/G
NGS:
0.020
C90:
0.182
aPT4

UniProt

c.35A>C p.Gln12Pro missense variant moderate contig121 2828691

IGV: Start, Jump

A/C
NGS:
0.075
C90:
0.000
aPT4

UniProt

c.80A>G p.Lys27Arg missense variant moderate contig121 2828736

IGV: Start, Jump

A/G
NGS:
0.061
C90:
0.000
aPT4

UniProt

c.202T>A p.Leu68Ile missense variant moderate contig121 2828858

IGV: Start, Jump

T/A
NGS:
0.068
C90:
0.000
aPT4

UniProt

c.216A>T p.Lys72Asn missense variant moderate contig121 2828872

IGV: Start, Jump

A/T
NGS:
0.075
C90:
0.000
aPT4

UniProt

c.916C>T p.His306Tyr missense variant & splice region variant moderate contig121 2832711

IGV: Start, Jump

C/T
NGS:
0.015
C90:
0.000
aPT4

UniProt

c.1111C>A p.Leu371Ile missense variant moderate contig121 2833296

IGV: Start, Jump

C/A
NGS:
0.044
C90:
0.000
aPT4

UniProt

c.1168T>C p.Tyr390His missense variant moderate contig121 2833503

IGV: Start, Jump

T/C
NGS:
0.546
C90:
0.000
aPT1

UniProt

c.160A>C p.Thr54Pro missense variant moderate contig121 2835867

IGV: Start, Jump

A/C
NGS:
0.086
C90:
0.048
aPT1

UniProt

c.406A>G p.Ile136Val missense variant moderate contig121 2839605

IGV: Start, Jump

A/G
NGS:
0.579
C90:
0.761
aPT1

UniProt

c.670T>A p.Ser224Thr missense variant moderate contig121 2840278

IGV: Start, Jump

T/A
NGS:
0.077
C90:
0.000
aPT1

UniProt

c.727G>T p.Glu243* stop gained high contig121 2841362

IGV: Start, Jump

G/T
NGS:
0.127
C90:
0.100
aPT1

UniProt

c.864C>G p.Asn288Lys missense variant moderate contig121 2842407

IGV: Start, Jump

C/G
NGS:
0.075
C90:
0.062
HDS-2

UniProt

c.82_93delGTAACCGGAACT p.Val28_Thr31del conservative inframe deletion moderate contig95 1989748

IGV: Start, Jump

CGTAACCGGAACT/C
NGS:
0.805
C90:
0.000
HDS-2

UniProt

c.127T>G p.Ser43Ala missense variant moderate contig95 1989794

IGV: Start, Jump

T/G
NGS:
0.721
C90:
0.000
AAE1-2

UniProt

c.331A>G p.Asn111Asp missense variant moderate contig81 209293

IGV: Start, Jump

A/G
NGS:
0.123
C90:
0.000
AAE1-2

UniProt

c.688G>A p.Asp230Asn missense variant moderate contig81 209650

IGV: Start, Jump

G/A
NGS:
0.018
C90:
0.000
AAE1-2

UniProt

c.1415G>A p.Ser472Asn missense variant moderate contig81 210377

IGV: Start, Jump

G/A
NGS:
0.070
C90:
0.000
AAE1-2

UniProt

c.1417A>G p.Thr473Ala missense variant moderate contig81 210379

IGV: Start, Jump

A/G
NGS:
0.070
C90:
0.000
AAE1-2

UniProt

c.1434G>T p.Glu478Asp missense variant moderate contig81 210396

IGV: Start, Jump

G/T
NGS:
0.075
C90:
0.000
AAE1-2

UniProt

c.1541T>C p.Val514Ala missense variant moderate contig81 210503

IGV: Start, Jump

T/C
NGS:
0.050
C90:
0.000
PHL-1

UniProt

c.2623A>G p.Thr875Ala missense variant moderate contig1439 1487174

IGV: Start, Jump

T/C
NGS:
0.123
C90:
0.000
PHL-1

UniProt

c.2551A>G p.Thr851Ala missense variant moderate contig1439 1487246

IGV: Start, Jump

T/C
NGS:
0.116
C90:
0.890
PHL-1

UniProt

c.1387A>G p.Thr463Ala missense variant moderate contig1439 1489811

IGV: Start, Jump

T/C
NGS:
0.107
C90:
0.904
TFL1

UniProt

c.314_315delCA p.Thr105fs frameshift variant high contig1636 520601

IGV: Start, Jump

CTG/C
NGS:
0.004
C90:
0.057
HDS-1

UniProt

c.1618A>G p.Ile540Val missense variant moderate contig1891 885936

IGV: Start, Jump

T/C
NGS:
0.099
C90:
0.861
HDS-1

UniProt

c.1475C>A p.Pro492Gln missense variant moderate contig1891 886162

IGV: Start, Jump

G/T
NGS:
0.011
C90:
0.000
HDS-1

UniProt

c.1393G>A p.Ala465Thr missense variant & splice region variant moderate contig1891 886355

IGV: Start, Jump

C/T
NGS:
0.009
C90:
0.091
HDS-1

UniProt

c.1378G>A p.Val460Ile missense variant moderate contig1891 886370

IGV: Start, Jump

C/T
NGS:
0.167
C90:
0.000
HDS-1

UniProt

c.56C>G p.Ala19Gly missense variant moderate contig1891 889336

IGV: Start, Jump

G/C
NGS:
0.125
C90:
0.943
HDS-1

UniProt

c.35G>A p.Cys12Tyr missense variant moderate contig1891 889357

IGV: Start, Jump

C/T
NGS:
0.094
C90:
0.646
HDS-1

UniProt

c.-108+1_-108+2insG splice donor variant & intron variant high contig1891 889975

IGV: Start, Jump

A/AC
NGS:
0.217
C90:
0.000
FAD2

UniProt

c.148G>A p.Val50Ile missense variant moderate contig1460 1084112

IGV: Start, Jump

C/T
NGS:
0.004
C90:
0.000
FAD2

UniProt

c.94A>G p.Thr32Ala missense variant moderate contig1460 1084166

IGV: Start, Jump

T/C
NGS:
0.015
C90:
0.000
PIE1-2

UniProt

c.6773T>C p.Leu2258Ser missense variant moderate contig1460 1184314

IGV: Start, Jump

A/G
NGS:
0.046
C90:
0.675
PIE1-2

UniProt

c.6653A>G p.Asn2218Ser missense variant moderate contig1460 1184434

IGV: Start, Jump

T/C
NGS:
0.059
C90:
0.928
PIE1-2

UniProt

c.6636T>G p.Asp2212Glu missense variant moderate contig1460 1184451

IGV: Start, Jump

A/C
NGS:
0.035
C90:
0.885
PIE1-2

UniProt

c.6623C>T p.Ala2208Val missense variant moderate contig1460 1184464

IGV: Start, Jump

G/A
NGS:
0.044
C90:
0.689
PIE1-2

UniProt

c.6149G>A p.Arg2050Lys missense variant moderate contig1460 1185335

IGV: Start, Jump

C/T
NGS:
0.011
C90:
0.234
PIE1-2

UniProt

c.1872T>A p.Asp624Glu missense variant moderate contig1460 1190252

IGV: Start, Jump

A/T
NGS:
0.086
C90:
0.990
PIE1-2

UniProt

c.1630G>C p.Ala544Pro missense variant moderate contig1460 1191600

IGV: Start, Jump

C/G
NGS:
0.070
C90:
0.933
PIE1-2

UniProt

c.1289A>G p.Asp430Gly missense variant moderate contig1460 1192109

IGV: Start, Jump

T/C
NGS:
0.079
C90:
0.000
PIE1-2

UniProt

c.982G>A p.Glu328Lys missense variant moderate contig1460 1192416

IGV: Start, Jump

C/T
NGS:
0.050
C90:
0.976
PIE1-2

UniProt

c.710C>T p.Pro237Leu missense variant moderate contig1460 1193804

IGV: Start, Jump

G/A
NGS:
0.072
C90:
0.866
PIE1-2

UniProt

c.706T>C p.Tyr236His missense variant moderate contig1460 1193808

IGV: Start, Jump

A/G
NGS:
0.059
C90:
0.737
PIE1-2

UniProt

c.637T>A p.Ser213Thr missense variant moderate contig1460 1194421

IGV: Start, Jump

A/T
NGS:
0.079
C90:
0.885
EMF2

UniProt

c.1772A>G p.Gln591Arg missense variant moderate contig954 3059929

IGV: Start, Jump

A/G
NGS:
0.092
C90:
0.876
EMF1-1

UniProt

c.62C>G p.Thr21Ser missense variant moderate contig883 268910

IGV: Start, Jump

C/G
NGS:
0.007
C90:
0.000
EMF1-1

UniProt

c.242A>G p.Lys81Arg missense variant moderate contig883 269731

IGV: Start, Jump

A/G
NGS:
0.022
C90:
0.053
EMF1-1

UniProt

c.389G>A p.Arg130Gln missense variant moderate contig883 269878

IGV: Start, Jump

G/A
NGS:
0.007
C90:
0.000
EMF1-1

UniProt

c.476A>T p.Asn159Ile missense variant moderate contig883 269965

IGV: Start, Jump

A/T
NGS:
0.007
C90:
0.000
EMF1-1

UniProt

c.590A>T p.Lys197Ile missense variant moderate contig883 270079

IGV: Start, Jump

A/T
NGS:
0.007
C90:
0.000
FLD

UniProt

c.2981T>C p.Met994Thr missense variant moderate contig1450 2044012

IGV: Start, Jump

A/G
NGS:
0.064
C90:
0.478
FLD

UniProt

c.2964C>A p.Asp988Glu missense variant moderate contig1450 2044029

IGV: Start, Jump

G/T
NGS:
0.057
C90:
0.464
FLD

UniProt

c.2929T>C p.Phe977Leu missense variant moderate contig1450 2044103

IGV: Start, Jump

A/G
NGS:
0.026
C90:
0.349
FLD

UniProt

c.125G>A p.Ser42Asn missense variant moderate contig1450 2047909

IGV: Start, Jump

C/T
NGS:
0.037
C90:
0.388
AAE1-3

UniProt

c.667G>A p.Val223Ile missense variant moderate contig976 1083187

IGV: Start, Jump

C/T
NGS:
0.048
C90:
0.000
AAE1-3

UniProt

c.634G>C p.Gly212Arg missense variant moderate contig976 1083220

IGV: Start, Jump

C/G
NGS:
0.116
C90:
0.000
AAE1-3

UniProt

c.475G>A p.Gly159Arg missense variant moderate contig976 1083550

IGV: Start, Jump

C/T
NGS:
0.048
C90:
0.000
AAE1-3

UniProt

c.416T>C p.Leu139Pro missense variant moderate contig976 1083609

IGV: Start, Jump

A/G
NGS:
0.061
C90:
0.000
AAE1-3

UniProt

c.382T>C p.Tyr128His missense variant moderate contig976 1083643

IGV: Start, Jump

A/G
NGS:
0.072
C90:
0.000
AAE1-3

UniProt

c.296C>T p.Pro99Leu missense variant moderate contig976 1083729

IGV: Start, Jump

G/A
NGS:
0.046
C90:
0.000
AAE1-3

UniProt

c.293A>G p.Asp98Gly missense variant moderate contig976 1083732

IGV: Start, Jump

T/C
NGS:
0.068
C90:
0.000
AAE1-3

UniProt

c.284A>T p.Glu95Val missense variant moderate contig976 1083741

IGV: Start, Jump

T/A
NGS:
0.053
C90:
0.000
AAE1-3

UniProt

c.181G>A p.Val61Ile missense variant moderate contig976 1083894

IGV: Start, Jump

C/T
NGS:
0.055
C90:
0.000
AAE1-3

UniProt

c.167A>G p.Glu56Gly missense variant moderate contig976 1083908

IGV: Start, Jump

T/C
NGS:
0.070
C90:
0.000
AAE1-3

UniProt

c.125A>G p.Glu42Gly missense variant moderate contig976 1083950

IGV: Start, Jump

T/C
NGS:
0.064
C90:
0.000
AAE1-3

UniProt

c.79A>G p.Thr27Ala missense variant moderate contig976 1083996

IGV: Start, Jump

T/C
NGS:
0.068
C90:
0.000
AAE1-3

UniProt

c.52G>A p.Gly18Ser missense variant moderate contig976 1084023

IGV: Start, Jump

C/T
NGS:
0.064
C90:
0.000
AAE1-3

UniProt

c.3G>A p.Met1? start lost high contig976 1084072

IGV: Start, Jump

C/T
NGS:
0.046
C90:
0.416
FAD7A-1

UniProt

c.175C>G p.Gln59Glu missense variant moderate contig510 69042

IGV: Start, Jump

C/G
NGS:
0.002
C90:
0.000
FAD7A-1

UniProt

c.*318_*342+3delTCTCTCTCTCTCTCTCTCTCTCTATATA splice donor variant & splice region variant & 3 prime UTR variant & intron variant high contig510 71445

IGV: Start, Jump

CTCTCTCTCTCTCTCTCTCTCTCTATATA/C
NGS:
0.002
C90:
0.000
PIE1-1

UniProt

c.811T>C p.Tyr271His missense variant moderate contig1225 2279935

IGV: Start, Jump

T/C
NGS:
0.026
C90:
0.742
PIE1-1

UniProt

c.815C>T p.Pro272Leu missense variant moderate contig1225 2279939

IGV: Start, Jump

C/T
NGS:
0.029
C90:
0.885
PIE1-1

UniProt

c.1222C>G p.Gln408Glu missense variant moderate contig1225 2281482

IGV: Start, Jump

C/G
NGS:
0.096
C90:
0.852
PIE1-1

UniProt

c.3869A>C p.Asn1290Thr missense variant moderate contig1225 2285484

IGV: Start, Jump

A/C
NGS:
0.002
C90:
0.909
PIE1-1

UniProt

c.6251G>A p.Arg2084Lys missense variant moderate contig1225 2288424

IGV: Start, Jump

G/A
NGS:
0.002
C90:
0.230
PIE1-1

UniProt

c.6725C>T p.Ala2242Val missense variant moderate contig1225 2289290

IGV: Start, Jump

C/T
NGS:
0.046
C90:
0.737
GGR

UniProt

c.704A>T p.His235Leu missense variant moderate contig2282 549696

IGV: Start, Jump

A/T
NGS:
0.121
C90:
0.000
PKSB-3

UniProt

c.1850_1852dupTGA p.Met617dup disruptive inframe insertion moderate contig93 3339945

IGV: Start, Jump

A/AGAT
NGS:
0.031
C90:
0.000

Nearest genetic relatives (All Samples)

0 0.075 0.150 0.225 0.300
clone distance sibling distance more distant
  1. 0.265 KYRG-151 (RSP11052)
  2. 0.266 Kimbo Slice (RSP10997)
  3. 0.269 MENDO BREATH (RSP11242)
  4. 0.278 RINGO S ANGEL (RSP10085)
  5. 0.280 Serious Happiness (RSP10763)
  6. 0.280 RKM-2018-019 (RSP11111)
  7. 0.282 Santhica 27 (RSP10665)
  8. 0.282 North Traveler (RSP11166)
  9. 0.283 North Traveler (RSP11163)
  10. 0.285 JABBA S STASH (RSP11348)
  11. 0.285 Sunday Driver (RSP11071)
  12. 0.286 Tisza (RSP10659)
  13. 0.288 Feral (RSP11205)
  14. 0.291 Carmagnola (RSP11039)
  15. 0.292 Carmagnola (RSP10982)
  16. 0.292 KYRG-11 (RSP11051)
  17. 0.293 Fedora 17 (RSP11203)
  18. 0.293 Harlox (RSP11178)
  19. 0.293 USO 31 (RSP10983)
  20. 0.294 USO 31 (RSP10981)

Nearest genetic relatives (Base Tree)

0 0.083 0.167 0.250 0.333
clone distance sibling distance more distant
  1. 0.271 Kimbo Slice (RSP10997)
  2. 0.279 RKM-2018-019 (RSP11111)
  3. 0.280 Tisza (RSP10659)
  4. 0.294 KYRG-11 (RSP11051)
  5. 0.295 Tisza (RSP11044)
  6. 0.299 Ivory (RSP10668)
  7. 0.300 RKM-2018-005 (RSP11096)
  8. 0.303 Kyrgyz Gold (RSP11054)
  9. 0.303 USO 31 (RSP10981)
  10. 0.306 Recon (RSP10755)
  11. 0.311 Feral (RSP10890)
  12. 0.311 Carmagnola (RSP11037)
  13. 0.312 Fedora 17 (RSP10661)
  14. 0.312 Lovrin (RSP10658)
  15. 0.313 Carmagnola (RSP10979)
  16. 0.316 Jiangji (RSP10653)
  17. 0.319 RKM-2018-029 (RSP11121)
  18. 0.319 Hermaphrodite ResearchSample2 (RSP11050)
  19. 0.321 Monoica (RSP10241)
  20. 0.321 Futura 75 (RSP10664)

Most genetically distant strains (All Samples)

0 0.125 0.250 0.375 0.500
clone distance sibling distance more distant
  1. 0.480 Cherry Blossom (RSP11328)
  2. 0.455 Cherry Blossom (RSP11301)
  3. 0.449 Cherry Blossom (RSP11300)
  4. 0.444 Cherry Blossom (RSP11330)
  5. 0.442 JL yellow (RSP11075)
  6. 0.442 Cherry Blossom (RSP11332)
  7. 0.441 Cherry Blossom (RSP11325)
  8. 0.441 Cherry Blossom (RSP11322)
  9. 0.436 Cherry Blossom (RSP11306)
  10. 0.433 Cherry Blossom (RSP11323)
  11. 0.430 Cherry Blossom (RSP11309)
  12. 0.430 Cherry Blossom (RSP11318)
  13. 0.428 Avidekel (RSP10938)
  14. 0.421 Cherry Blossom CBG (RSP11303)
  15. 0.421 JL 3rd Gen Mother (RSP11197)
  16. 0.421 Wife (RSP11148)
  17. 0.419 Cherry Blossom (RSP11333)
  18. 0.417 Unknown- Cherry Wine - 001 (RSP11268)
  19. 0.416 Cherry Blossom (RSP11311)
  20. 0.416 Cherry Blossom (RSP11317)

Most genetically distant strains (Base Tree)

0 0.117 0.233 0.350 0.467
clone distance sibling distance more distant
  1. 0.446 JL yellow (RSP11075)
  2. 0.390 Cbot-2019-001 (RSP11129)
  3. 0.388 Cbot-2019-005 (RSP11133)
  4. 0.381 RKM-2018-027 (RSP11119)
  5. 0.375 Cherry (RSP11143)
  6. 0.374 RKM-2018-020 (RSP11112)
  7. 0.374 CST (RSP11002)
  8. 0.371 Cherry (RSP11142)
  9. 0.371 RKM-2018-026 (RSP11118)
  10. 0.367 UP Sunrise (RSP10989)
  11. 0.367 RKM-2018-023 (RSP11115)
  12. 0.367 Kush Hemp E1 (RSP11128)
  13. 0.366 Blueberry Cheesecake (RSP10672)
  14. 0.366 RKM-2018-006 (RSP11097)
  15. 0.363 Gold Cracker (RSP11048)
  16. 0.357 RKM-2018-002 (RSP11093)
  17. 0.357 RKM-2018-003 (RSP11094)
  18. 0.355 The Gift (RSP10988)
  19. 0.355 Blue Dream (RSP11033)
  20. 0.353 Italian Kiss (RSP11034)

Nearest genetic relative in Phylos dataset

Phylos Strain SRR8349075
Overlapping SNPs:
111
Concordance:
108

Nearest genetic relative in Lynch dataset

Lynch Strain SRR3495246
Overlapping SNPs:
6
Concordance:
6

Blockchain Registration Information

Transaction ID
423a9f34a2010d77f64a9136389ed9c13e87c1d9d0ad76df914c8f58e75144f0
Stamping Certificate
Download PDF (849.2 KB)
SHASUM Hash
6ec376830b58371b83f00babe0889eae01bbc67ea0bd0e9654151075cebf81a7
QR code for RSP11176

Kannapedia uses cookies

By clicking Allow All, you agree to the storing of cookies on your device to enhance site navigation, analyze site usage, and assist in our marketing efforts.

Customize Settings