Arcata Trainwreck

RSP 11176

Grower: NETA

General Information

Sample Name
Arcata Trainwreck _29NOV2016
Accession Date
June 25, 2019
Reported Plant Sex

The strain rarity visualization shows how distant the strain is from the other cultivars in the Kannapedia database. The y-axis represents genetic distance, getting farther as you go up. The width of the visualization at any position along the y-axis shows how many strains there are in the database at that genetic distance. So, a common strain will have a more bottom-heavy shape, while uncommon and rare cultivars will have a visualization that is generally shifted towards the top.

Rarity: Rare
Most Distant Most Similar

Chemical Information

Cannabinoid and terpenoid information provided by the grower.




Caryophyllene oxide
Total Nerolidol
Total Ocimene

Genetic Information

Plant Type
Type I

The bell curve in the heterozygosity visualization shows the distribution of heterozygosity levels for cannabis cultivars in the Kannapedia database. The green line shows where this particular strain fits within the distribution. Heterozygosity is associated with heterosis (aka hybrid vigor) but also leads to the production of more variable offspring. When plants have two genetically different parents, heterozygosity levels will be higher than if it has been inbred or backcrossed repeatedly.

Heterozygosity: 1.99%
Least Heterozygous Most Heterozygous

This chart represents the Illumina sequence coverage over the Bt/Bd allele. These are the three regions in the cannabis genome that impact THCA, CBDA, CBGA production. Coverage over the Active CBDAS gene is highly correlated with Type II and Type III plants as described by Etienne de Meijer. Coverage over the THCA gene is highly correlated with Type I and Type II plants but is anti-correlated with Type III plants. Type I plants require coverage over the inactive CBDA loci and no coverage over the Active CBDA gene. Lack of coverage over the Active CBDA and Active THCA allele are presumed to be Type IV plants (CBGA dominant). While deletions of entire THCAS and CBDAS genes are the most common Bt:Bd alleles observed, it is possible to have plants with these genes where functional expression of the enzyme is disrupted by deactivating point mutations (Kojoma et al. 2006).

Bt/Bd Allele Coverage

This chart represents the Illumina sequence coverage over the CBCA synthase gene.

CBCAS Coverage

Variants (THCAS, CBDAS, and CBCAS)

Gene HGVS.c HGVS.p Annotation Annotation Impact Contig Contig Pos Ref/Alt Var Freq
CBCAS c.1420C>T p.Pro474Ser missense variant moderate contig756 3100726

IGV: Start, Jump


Variants (Select Genes of Interest)



c.298G>A p.Ala100Thr missense variant moderate contig705 2271640

IGV: Start, Jump



c.3G>T p.Met1? start lost high contig885 103

IGV: Start, Jump



c.349G>A p.Asp117Asn missense variant moderate contig885 449

IGV: Start, Jump



c.572A>G p.Asn191Ser missense variant moderate contig885 672

IGV: Start, Jump



c.710A>C p.His237Pro missense variant moderate contig885 810

IGV: Start, Jump



c.1148C>T p.Ala383Val missense variant moderate contig885 2034

IGV: Start, Jump



c.1187T>C p.Leu396Ser missense variant moderate contig885 2073

IGV: Start, Jump



c.1189G>A p.Ala397Thr missense variant moderate contig885 2075

IGV: Start, Jump



c.1199G>A p.Arg400Lys missense variant moderate contig885 2085

IGV: Start, Jump



c.1332_1336delCCAGC p.Gln445fs frameshift variant high contig885 2217

IGV: Start, Jump



c.1331G>A p.Ser444Asn missense variant moderate contig885 2217

IGV: Start, Jump



c.1409G>A p.Arg470Lys missense variant moderate contig885 2295

IGV: Start, Jump



c.1828A>G p.Ile610Val missense variant moderate contig885 2714

IGV: Start, Jump



c.2008C>T p.Pro670Ser missense variant moderate contig885 2894

IGV: Start, Jump



c.2256A>T p.Lys752Asn missense variant moderate contig885 3142

IGV: Start, Jump



c.2653A>G p.Thr885Ala missense variant moderate contig885 3539

IGV: Start, Jump

PHL-2 c.44G>A p.Arg15Lys missense variant moderate contig2621 337613

IGV: Start, Jump

PHL-2 c.575T>C p.Ile192Thr missense variant moderate contig2621 339568

IGV: Start, Jump

PHL-2 c.932T>C p.Leu311Pro missense variant moderate contig2621 340210

IGV: Start, Jump

PHL-2 c.1057A>G p.Arg353Gly missense variant moderate contig2621 340335

IGV: Start, Jump

PHL-2 c.1096G>A p.Ala366Thr missense variant moderate contig2621 340374

IGV: Start, Jump

PHL-2 c.1837G>A p.Glu613Lys missense variant moderate contig2621 341115

IGV: Start, Jump

PHL-2 c.2564T>A p.Phe855Tyr missense variant moderate contig2621 342607

IGV: Start, Jump

PHL-2 c.2578T>A p.Leu860Ile missense variant moderate contig2621 342621

IGV: Start, Jump

PHL-2 c.2624C>T p.Ser875Phe missense variant moderate contig2621 342667

IGV: Start, Jump

PHL-2 c.2783G>A p.Ser928Asn missense variant moderate contig2621 342826

IGV: Start, Jump

PHL-2 c.2830A>C p.Asn944His missense variant moderate contig2621 342873

IGV: Start, Jump

PHL-2 c.2834A>G p.Asn945Ser missense variant moderate contig2621 342877

IGV: Start, Jump

PHL-2 c.2903_2905dupGCA p.Ser968dup disruptive inframe insertion moderate contig2621 342939

IGV: Start, Jump

PHL-2 c.2933G>T p.Arg978Leu missense variant moderate contig2621 342976

IGV: Start, Jump

PHL-2 c.2936T>G p.Val979Gly missense variant moderate contig2621 342979

IGV: Start, Jump

PHL-2 c.3209A>G p.Gln1070Arg missense variant moderate contig2621 343252

IGV: Start, Jump

PHL-2 c.3379C>G p.His1127Asp missense variant moderate contig2621 343422

IGV: Start, Jump

PHL-2 c.3380A>G p.His1127Arg missense variant moderate contig2621 343423

IGV: Start, Jump

PHL-2 c.3381T>A p.His1127Gln missense variant moderate contig2621 343424

IGV: Start, Jump

PHL-2 c.3457A>G p.Thr1153Ala missense variant moderate contig2621 343500

IGV: Start, Jump

PHL-2 c.3467A>G p.Gln1156Arg missense variant moderate contig2621 343510

IGV: Start, Jump

PHL-2 c.3556_3557delAA p.Lys1186fs frameshift variant high contig2621 343598

IGV: Start, Jump



c.67T>A p.Phe23Ile missense variant moderate contig700 1945567

IGV: Start, Jump



c.31A>T p.Thr11Ser missense variant moderate contig700 1945603

IGV: Start, Jump



c.1152T>A p.Asn384Lys missense variant moderate contig700 1950486

IGV: Start, Jump



c.1132C>G p.Leu378Val missense variant moderate contig700 1950506

IGV: Start, Jump



c.1117A>G p.Ile373Val missense variant moderate contig700 1950521

IGV: Start, Jump



c.774G>A p.Met258Ile missense variant moderate contig700 1950864

IGV: Start, Jump



c.718T>A p.Phe240Ile missense variant moderate contig700 1950920

IGV: Start, Jump



c.560C>T p.Thr187Met missense variant moderate contig700 1951078

IGV: Start, Jump



c.558G>A p.Met186Ile missense variant moderate contig700 1951080

IGV: Start, Jump



c.31A>T p.Thr11Ser missense variant moderate contig700 1951851

IGV: Start, Jump



c.-2_1dupATA start lost & conservative inframe insertion high contig700 1951880

IGV: Start, Jump



c.567T>A p.Asn189Lys missense variant moderate contig700 2715027

IGV: Start, Jump



c.535_545delATTGGAGTGGG p.Ile179fs frameshift variant high contig700 2721127

IGV: Start, Jump



c.544G>T p.Gly182Trp missense variant moderate contig700 2721129

IGV: Start, Jump



c.541G>C p.Val181Leu missense variant moderate contig700 2721132

IGV: Start, Jump



c.523C>T p.His175Tyr missense variant moderate contig700 2721150

IGV: Start, Jump



c.489delT p.Phe163fs frameshift variant high contig700 2721183

IGV: Start, Jump



c.352_355delACAG p.Thr118fs frameshift variant high contig700 2721317

IGV: Start, Jump



c.353_354insCC p.Gly119fs frameshift variant high contig700 2721319

IGV: Start, Jump



c.323A>G p.Glu108Gly missense variant moderate contig700 2721350

IGV: Start, Jump



c.316+2T>A splice donor variant & intron variant high contig700 2723818

IGV: Start, Jump



c.229G>A p.Gly77Ser missense variant moderate contig700 2724206

IGV: Start, Jump



c.216G>C p.Leu72Phe missense variant moderate contig700 2724219

IGV: Start, Jump



c.206T>C p.Leu69Ser missense variant moderate contig700 2724229

IGV: Start, Jump



c.143G>A p.Arg48Gln missense variant moderate contig700 2724292

IGV: Start, Jump



c.1580A>G p.Asn527Ser missense variant moderate contig606 3242691

IGV: Start, Jump



c.1504G>A p.Asp502Asn missense variant moderate contig606 3242767

IGV: Start, Jump



c.946G>A p.Ala316Thr missense variant moderate contig606 3243325

IGV: Start, Jump



c.454A>G p.Lys152Glu missense variant moderate contig606 3243817

IGV: Start, Jump



c.1319T>C p.Ile440Thr missense variant moderate contig380 285250

IGV: Start, Jump



c.196T>C p.Phe66Leu missense variant moderate contig83 1803173

IGV: Start, Jump



c.172G>T p.Asp58Tyr missense variant moderate contig83 1803197

IGV: Start, Jump



c.161T>A p.Leu54His missense variant moderate contig83 1803208

IGV: Start, Jump



c.358G>A p.Gly120Arg missense variant moderate contig97 242064

IGV: Start, Jump



c.520A>C p.Asn174His missense variant moderate contig97 242226

IGV: Start, Jump



c.574A>G p.Asn192Asp missense variant moderate contig97 242280

IGV: Start, Jump



c.772A>G p.Ser258Gly missense variant moderate contig97 242478

IGV: Start, Jump



c.812G>C p.Gly271Ala missense variant moderate contig97 242518

IGV: Start, Jump



c.1230-2_1230-1delAG splice acceptor variant & intron variant high contig97 243676

IGV: Start, Jump



c.1466G>A p.Ser489Asn missense variant moderate contig97 244297

IGV: Start, Jump



c.1630A>G p.Thr544Ala missense variant moderate contig97 244461

IGV: Start, Jump



c.1803_1805delTCA p.His601del disruptive inframe deletion moderate contig97 244625

IGV: Start, Jump



c.1966C>G p.Pro656Ala missense variant moderate contig97 244797

IGV: Start, Jump



c.2141C>G p.Pro714Arg missense variant moderate contig97 244972

IGV: Start, Jump



c.2198G>T p.Arg733Leu missense variant moderate contig97 245029

IGV: Start, Jump



c.2216A>G p.His739Arg missense variant moderate contig97 245047

IGV: Start, Jump



c.35A>C p.Gln12Pro missense variant moderate contig121 2828691

IGV: Start, Jump



c.80A>G p.Lys27Arg missense variant moderate contig121 2828736

IGV: Start, Jump



c.202T>A p.Leu68Ile missense variant moderate contig121 2828858

IGV: Start, Jump



c.216A>T p.Lys72Asn missense variant moderate contig121 2828872

IGV: Start, Jump



c.916C>T p.His306Tyr missense variant & splice region variant moderate contig121 2832711

IGV: Start, Jump



c.1111C>A p.Leu371Ile missense variant moderate contig121 2833296

IGV: Start, Jump



c.1168T>C p.Tyr390His missense variant moderate contig121 2833503

IGV: Start, Jump



c.160A>C p.Thr54Pro missense variant moderate contig121 2835867

IGV: Start, Jump



c.406A>G p.Ile136Val missense variant moderate contig121 2839605

IGV: Start, Jump



c.670T>A p.Ser224Thr missense variant moderate contig121 2840278

IGV: Start, Jump



c.727G>T p.Glu243* stop gained high contig121 2841362

IGV: Start, Jump



c.864C>G p.Asn288Lys missense variant moderate contig121 2842407

IGV: Start, Jump



c.82_93delGTAACCGGAACT p.Val28_Thr31del conservative inframe deletion moderate contig95 1989748

IGV: Start, Jump



c.127T>G p.Ser43Ala missense variant moderate contig95 1989794

IGV: Start, Jump



c.331A>G p.Asn111Asp missense variant moderate contig81 209293

IGV: Start, Jump



c.688G>A p.Asp230Asn missense variant moderate contig81 209650

IGV: Start, Jump



c.1415G>A p.Ser472Asn missense variant moderate contig81 210377

IGV: Start, Jump



c.1417A>G p.Thr473Ala missense variant moderate contig81 210379

IGV: Start, Jump



c.1434G>T p.Glu478Asp missense variant moderate contig81 210396

IGV: Start, Jump



c.1541T>C p.Val514Ala missense variant moderate contig81 210503

IGV: Start, Jump



c.2623A>G p.Thr875Ala missense variant moderate contig1439 1487174

IGV: Start, Jump



c.2551A>G p.Thr851Ala missense variant moderate contig1439 1487246

IGV: Start, Jump



c.1387A>G p.Thr463Ala missense variant moderate contig1439 1489811

IGV: Start, Jump



c.314_315delCA p.Thr105fs frameshift variant high contig1636 520601

IGV: Start, Jump



c.1618A>G p.Ile540Val missense variant moderate contig1891 885936

IGV: Start, Jump



c.1475C>A p.Pro492Gln missense variant moderate contig1891 886162

IGV: Start, Jump



c.1393G>A p.Ala465Thr missense variant & splice region variant moderate contig1891 886355

IGV: Start, Jump



c.1378G>A p.Val460Ile missense variant moderate contig1891 886370

IGV: Start, Jump



c.56C>G p.Ala19Gly missense variant moderate contig1891 889336

IGV: Start, Jump



c.35G>A p.Cys12Tyr missense variant moderate contig1891 889357

IGV: Start, Jump



c.-108+1_-108+2insG splice donor variant & intron variant high contig1891 889975

IGV: Start, Jump



c.148G>A p.Val50Ile missense variant moderate contig1460 1084112

IGV: Start, Jump



c.94A>G p.Thr32Ala missense variant moderate contig1460 1084166

IGV: Start, Jump



c.6773T>C p.Leu2258Ser missense variant moderate contig1460 1184314

IGV: Start, Jump



c.6653A>G p.Asn2218Ser missense variant moderate contig1460 1184434

IGV: Start, Jump



c.6636T>G p.Asp2212Glu missense variant moderate contig1460 1184451

IGV: Start, Jump



c.6623C>T p.Ala2208Val missense variant moderate contig1460 1184464

IGV: Start, Jump



c.6149G>A p.Arg2050Lys missense variant moderate contig1460 1185335

IGV: Start, Jump



c.1872T>A p.Asp624Glu missense variant moderate contig1460 1190252

IGV: Start, Jump



c.1630G>C p.Ala544Pro missense variant moderate contig1460 1191600

IGV: Start, Jump



c.1289A>G p.Asp430Gly missense variant moderate contig1460 1192109

IGV: Start, Jump



c.982G>A p.Glu328Lys missense variant moderate contig1460 1192416

IGV: Start, Jump



c.710C>T p.Pro237Leu missense variant moderate contig1460 1193804

IGV: Start, Jump



c.706T>C p.Tyr236His missense variant moderate contig1460 1193808

IGV: Start, Jump



c.637T>A p.Ser213Thr missense variant moderate contig1460 1194421

IGV: Start, Jump



c.1772A>G p.Gln591Arg missense variant moderate contig954 3059929

IGV: Start, Jump



c.62C>G p.Thr21Ser missense variant moderate contig883 268910

IGV: Start, Jump



c.242A>G p.Lys81Arg missense variant moderate contig883 269731

IGV: Start, Jump



c.389G>A p.Arg130Gln missense variant moderate contig883 269878

IGV: Start, Jump



c.476A>T p.Asn159Ile missense variant moderate contig883 269965

IGV: Start, Jump



c.590A>T p.Lys197Ile missense variant moderate contig883 270079

IGV: Start, Jump



c.2981T>C p.Met994Thr missense variant moderate contig1450 2044012

IGV: Start, Jump



c.2964C>A p.Asp988Glu missense variant moderate contig1450 2044029

IGV: Start, Jump



c.2929T>C p.Phe977Leu missense variant moderate contig1450 2044103

IGV: Start, Jump



c.125G>A p.Ser42Asn missense variant moderate contig1450 2047909

IGV: Start, Jump



c.667G>A p.Val223Ile missense variant moderate contig976 1083187

IGV: Start, Jump



c.634G>C p.Gly212Arg missense variant moderate contig976 1083220

IGV: Start, Jump



c.475G>A p.Gly159Arg missense variant moderate contig976 1083550

IGV: Start, Jump



c.416T>C p.Leu139Pro missense variant moderate contig976 1083609

IGV: Start, Jump



c.382T>C p.Tyr128His missense variant moderate contig976 1083643

IGV: Start, Jump



c.296C>T p.Pro99Leu missense variant moderate contig976 1083729

IGV: Start, Jump



c.293A>G p.Asp98Gly missense variant moderate contig976 1083732

IGV: Start, Jump



c.284A>T p.Glu95Val missense variant moderate contig976 1083741

IGV: Start, Jump



c.181G>A p.Val61Ile missense variant moderate contig976 1083894

IGV: Start, Jump



c.167A>G p.Glu56Gly missense variant moderate contig976 1083908

IGV: Start, Jump



c.125A>G p.Glu42Gly missense variant moderate contig976 1083950

IGV: Start, Jump



c.79A>G p.Thr27Ala missense variant moderate contig976 1083996

IGV: Start, Jump



c.52G>A p.Gly18Ser missense variant moderate contig976 1084023

IGV: Start, Jump



c.3G>A p.Met1? start lost high contig976 1084072

IGV: Start, Jump



c.175C>G p.Gln59Glu missense variant moderate contig510 69042

IGV: Start, Jump



c.*318_*342+3delTCTCTCTCTCTCTCTCTCTCTCTATATA splice donor variant & splice region variant & 3 prime UTR variant & intron variant high contig510 71445

IGV: Start, Jump



c.811T>C p.Tyr271His missense variant moderate contig1225 2279935

IGV: Start, Jump



c.815C>T p.Pro272Leu missense variant moderate contig1225 2279939

IGV: Start, Jump



c.1222C>G p.Gln408Glu missense variant moderate contig1225 2281482

IGV: Start, Jump



c.3869A>C p.Asn1290Thr missense variant moderate contig1225 2285484

IGV: Start, Jump



c.6251G>A p.Arg2084Lys missense variant moderate contig1225 2288424

IGV: Start, Jump



c.6725C>T p.Ala2242Val missense variant moderate contig1225 2289290

IGV: Start, Jump



c.704A>T p.His235Leu missense variant moderate contig2282 549696

IGV: Start, Jump



c.1850_1852dupTGA p.Met617dup disruptive inframe insertion moderate contig93 3339945

IGV: Start, Jump


Nearest genetic relatives (All Samples)

0 0.075 0.150 0.225 0.300
clone distance sibling distance more distant
  1. 0.194 Eagle Scout T-111 (RSP11625)
  2. 0.247 Banana Kush (RSP11739)
  3. 0.262 MENDO BREATH (RSP11242)
  4. 0.269 Kimbo Slice (RSP10997)
  5. 0.274 JL Cross 25 (RSP11526)
  6. 0.277 JL Cross 6 (RSP11507)
  7. 0.277 Carmagnola (RSP11039)
  8. 0.278 Wedding Cake x MAC (RSP11464)
  9. 0.280 North Traveler (RSP11166)
  10. 0.281 JABBA S STASH (RSP11348)
  11. 0.285 KYRG-151 (RSP11052)
  12. 0.286 Mendo Breath (RSP11747)
  13. 0.287 Miss X (RSP10999)
  14. 0.289 USO 31 (RSP10981)
  15. 0.290 VIR 369 (SRR14708231)
  16. 0.290 Ringo s Angel (RSP10085)
  17. 0.290 C-930 lot 211005 (RSP12603)
  18. 0.291 Hermaphrodite ResearchSample2 (RSP11050)
  19. 0.291 Harlox (RSP11178)
  20. 0.292 Santhica 27 (RSP10665)

Nearest genetic relatives (Base Tree)

0 0.083 0.167 0.250 0.333
clone distance sibling distance more distant
  1. 0.260 Kimbo Slice (RSP10997)
  2. 0.285 RKM-2018-019 (RSP11111)
  3. 0.297 Hermaphrodite ResearchSample2 (RSP11050)
  4. 0.297 Tisza (RSP10659)
  5. 0.299 KYRG-11 (RSP11051)
  6. 0.302 Tisza (RSP11044)
  7. 0.305 Carmagnola (RSP11037)
  8. 0.307 Recon (RSP10755)
  9. 0.307 Tygra (RSP10667)
  10. 0.310 Liberty Haze (RSP11000)
  11. 0.310 USO 31 (RSP10981)
  12. 0.312 Ivory (RSP10668)
  13. 0.312 Kyrgyz Gold (RSP11054)
  14. 0.315 Queen Jesus (RSP10105)
  15. 0.316 Feral (RSP10890)
  16. 0.324 Lovrin (RSP10658)
  17. 0.324 Blueberry Cheesecake (RSP10680)
  18. 0.325 Carmagnola (RSP10979)
  19. 0.325 RKM-2018-004 (RSP11096)
  20. 0.326 Hermaphrodite Research Sample1 (RSP11049)

Most genetically distant strains (All Samples)

0 0.117 0.233 0.350 0.467
clone distance sibling distance more distant
  1. 0.461 JL yellow (RSP11075)
  2. 0.460 Cherry Blossom (RSP11328)
  3. 0.439 JL 3rd Gen Mother (RSP11214)
  4. 0.434 Cherry Blossom (RSP11300)
  5. 0.427 JL X NSPM1 21 (RSP11474)
  6. 0.425 JL Tent 1 yellow stake (RSP11488)
  7. 0.422 Cherry Blossom (RSP11332)
  8. 0.421 JL 3rd Gen Mother (RSP11197)
  9. 0.421 JL Tent 4 (RSP11491)
  10. 0.420 JL 4th Gen 5 (RSP11199)
  11. 0.419 JL x NSPM1 1 5 (RSP11479)
  12. 0.418 Cherry Blossom (RSP11325)
  13. 0.418 Cherry Blossom (RSP11330)
  14. 0.417 Cherry Blossom (RSP11301)
  15. 0.417 JL Cross 23 (RSP11524)
  16. 0.415 JL Cross 7 (RSP11508)
  17. 0.415 JL Cross 15 (RSP11516)
  18. 0.415 JL X NSPM1 5 (RSP11467)
  19. 0.414 JL X NSPM1 30 (RSP11476)
  20. 0.414 Cherry Blossom (RSP11309)

Most genetically distant strains (Base Tree)

0 0.117 0.233 0.350 0.467
clone distance sibling distance more distant
  1. 0.461 JL yellow (RSP11075)
  2. 0.394 Cbot-2019-001 (RSP11129)
  3. 0.382 RKM-2018-027 (RSP11119)
  4. 0.380 Cherry (RSP11142)
  5. 0.376 Skywalker OG (RSP10837)
  6. 0.374 CST (RSP11002)
  7. 0.373 RKM-2018-026 (RSP11118)
  8. 0.370 RKM-2018-023 (RSP11115)
  9. 0.367 RKM-2018-002 (RSP11093)
  10. 0.366 Cherry (RSP11143)
  11. 0.366 RKM-2018-020 (RSP11112)
  12. 0.361 Blue Dream (RSP11033)
  13. 0.360 UP Sunrise (RSP10989)
  14. 0.356 Blueberry Cheesecake (RSP10672)
  15. 0.356 Golden Goat 2 (RSP10991)
  16. 0.355 RKM-2018-018 (RSP11110)
  17. 0.355 Cbot-2019-005 (RSP11133)
  18. 0.355 Kush Hemp E1 (RSP11128)
  19. 0.354 Durban Poison (RSP11014)
  20. 0.352 RKM-2018-006 (RSP11097)

Nearest genetic relative in Phylos dataset

Phylos Strain SRR8349075
Overlapping SNPs:

Nearest genetic relative in Lynch dataset

Lynch Strain SRR3495246
Overlapping SNPs:

Blockchain Registration Information

Transaction ID
Stamping Certificate
Download PDF (849.2 KB)
QR code for RSP11176

Kannapedia uses cookies

By clicking Allow All, you agree to the storing of cookies on your device to enhance site navigation, analyze site usage, and assist in our marketing efforts.

Customize Settings