Master Kush

RSP 11182

Grower: NETA

General Information

Sample Name
Master Kush _29NOV2016
Accession Date
June 26, 2019
Reported Plant Sex
Female

The strain rarity visualization shows how distant the strain is from the other cultivars in the Kannapedia database. The y-axis represents genetic distance, getting farther as you go up. The width of the visualization at any position along the y-axis shows how many strains there are in the database at that genetic distance. So, a common strain will have a more bottom-heavy shape, while uncommon and rare cultivars will have a visualization that is generally shifted towards the top.

Rarity: Rare
Most Distant Most Similar

Chemical Information

Cannabinoid and terpenoid information provided by the grower.

Cannabinoids

THC + THCA
16.3%
CBD + CBDA
0.1%
THCV + THCVA
1.3%
CBC + CBCA
0.1%
CBG + CBGA
0.8%
CBN + CBNA
0.%

Terpenoids

α-Bisabolol
0.004%
Borneol
0.005%
Camphene
0.008%
Carene
n/a
Caryophyllene oxide
n/a
β-Caryophyllene
0.047%
Fenchol
0.002%
Geraniol
n/a
α-Humulene
0.026%
Limonene
0.196%
Linalool
0.011%
Myrcene
0.31%
α-Phellandrene
n/a
Terpinolene
0.005%
α-Terpineol
0.021%
α-Terpinene
n/a
γ-Terpinene
n/a
Total Nerolidol
0.042%
Total Ocimene
0.02%
α-Pinene
0.033%
β-Pinene
0.052%

Genetic Information

Plant Type
Type I

The bell curve in the heterozygosity visualization shows the distribution of heterozygosity levels for cannabis cultivars in the Kannapedia database. The green line shows where this particular strain fits within the distribution. Heterozygosity is associated with heterosis (aka hybrid vigor) but also leads to the production of more variable offspring. When plants have two genetically different parents, heterozygosity levels will be higher than if it has been inbred or backcrossed repeatedly.

Heterozygosity: 1.75%
Least Heterozygous Most Heterozygous

This chart represents the Illumina sequence coverage over the Bt/Bd allele. These are the three regions in the cannabis genome that impact THCA, CBDA, CBGA production. Coverage over the Active CBDAS gene is highly correlated with Type II and Type III plants as described by Etienne de Meijer. Coverage over the THCA gene is highly correlated with Type I and Type II plants but is anti-correlated with Type III plants. Type I plants require coverage over the inactive CBDA loci and no coverage over the Active CBDA gene. Lack of coverage over the Active CBDA and Active THCA allele are presumed to be Type IV plants (CBGA dominant). While deletions of entire THCAS and CBDAS genes are the most common Bt:Bd alleles observed, it is possible to have plants with these genes where functional expression of the enzyme is disrupted by deactivating point mutations (Kojoma et al. 2006).

Bt/Bd Allele Coverage

This chart represents the Illumina sequence coverage over the CBCA synthase gene.

CBCAS Coverage

Variants (THCAS, CBDAS, and CBCAS)

Gene HGVS.c HGVS.p Annotation Annotation Impact Contig Contig Pos Ref/Alt Var Freq
THCAS c.749C>A p.Ala250Asp missense variant moderate contig741 4417079

IGV: Start, Jump

G/T
NGS:
0.127
C90:
0.632

Variants (Select Genes of Interest)

PHL-2 c.1057A>G p.Arg353Gly missense variant moderate contig2621 340335

IGV: Start, Jump

A/G
NGS:
0.096
C90:
0.555
PHL-2 c.1096G>A p.Ala366Thr missense variant moderate contig2621 340374

IGV: Start, Jump

G/A
NGS:
0.090
C90:
0.531
PHL-2 c.1540A>G p.Thr514Ala missense variant moderate contig2621 340818

IGV: Start, Jump

A/G
NGS:
0.042
C90:
0.282
PHL-2 c.2756A>C p.Glu919Ala missense variant moderate contig2621 342799

IGV: Start, Jump

A/C
NGS:
0.064
C90:
0.675
PHL-2 c.2783G>A p.Ser928Asn missense variant moderate contig2621 342826

IGV: Start, Jump

G/A
NGS:
0.107
C90:
0.890
PHL-2 c.3002A>G p.Tyr1001Cys missense variant moderate contig2621 343045

IGV: Start, Jump

A/G
NGS:
0.055
C90:
0.316
PHL-2 c.3027G>T p.Lys1009Asn missense variant moderate contig2621 343070

IGV: Start, Jump

G/T
NGS:
0.055
C90:
0.311
PHL-2 c.3033T>G p.Cys1011Trp missense variant moderate contig2621 343076

IGV: Start, Jump

T/G
NGS:
0.055
C90:
0.292
PHL-2 c.3202A>C p.Thr1068Pro missense variant moderate contig2621 343245

IGV: Start, Jump

A/C
NGS:
0.053
C90:
0.000
PHL-2 c.3209A>G p.Gln1070Arg missense variant moderate contig2621 343252

IGV: Start, Jump

A/G
NGS:
0.103
C90:
0.885
PKSG-4a

UniProt

c.37C>G p.Gln13Glu missense variant moderate contig700 1936734

IGV: Start, Jump

C/G
NGS:
0.031
C90:
0.000
PKSG-4a

UniProt

c.617A>G p.Tyr206Cys missense variant moderate contig700 1938028

IGV: Start, Jump

A/G
NGS:
0.075
C90:
0.000
PKSG-4a

UniProt

c.626_628delATA p.Asn209del disruptive inframe deletion moderate contig700 1938032

IGV: Start, Jump

CAAT/C
NGS:
0.075
C90:
0.000
PKSG-4a

UniProt

c.1191_1193delTTA p.Tyr398del disruptive inframe deletion moderate contig700 1938600

IGV: Start, Jump

AATT/A
NGS:
0.167
C90:
0.000
PKSG-2a

UniProt

c.67T>A p.Phe23Ile missense variant moderate contig700 1945567

IGV: Start, Jump

A/T
NGS:
0.825
C90:
0.904
PKSG-2a

UniProt

c.31A>T p.Thr11Ser missense variant moderate contig700 1945603

IGV: Start, Jump

T/A
NGS:
0.763
C90:
0.876
PKSG-2b

UniProt

c.1152T>A p.Asn384Lys missense variant moderate contig700 1950486

IGV: Start, Jump

A/T
NGS:
0.715
C90:
0.895
PKSG-2b

UniProt

c.1132C>G p.Leu378Val missense variant moderate contig700 1950506

IGV: Start, Jump

G/C
NGS:
0.717
C90:
0.000
PKSG-2b

UniProt

c.1117A>G p.Ile373Val missense variant moderate contig700 1950521

IGV: Start, Jump

T/C
NGS:
0.807
C90:
0.981
PKSG-2b

UniProt

c.948T>G p.Asp316Glu missense variant moderate contig700 1950690

IGV: Start, Jump

A/C
NGS:
0.456
C90:
0.000
PKSG-2b

UniProt

c.945T>G p.Ser315Arg missense variant moderate contig700 1950693

IGV: Start, Jump

A/C
NGS:
0.454
C90:
0.000
PKSG-2b

UniProt

c.944G>A p.Ser315Asn missense variant moderate contig700 1950694

IGV: Start, Jump

C/T
NGS:
0.445
C90:
0.000
PKSG-2b

UniProt

c.934C>G p.His312Asp missense variant moderate contig700 1950704

IGV: Start, Jump

G/C
NGS:
0.410
C90:
0.000
PKSG-2b

UniProt

c.774G>A p.Met258Ile missense variant moderate contig700 1950864

IGV: Start, Jump

C/T
NGS:
0.366
C90:
0.947
PKSG-2b

UniProt

c.718T>A p.Phe240Ile missense variant moderate contig700 1950920

IGV: Start, Jump

A/T
NGS:
0.114
C90:
0.000
PKSG-2b

UniProt

c.592A>G p.Asn198Asp missense variant moderate contig700 1951046

IGV: Start, Jump

T/C
NGS:
0.048
C90:
0.000
PKSG-2b

UniProt

c.588T>G p.Asp196Glu missense variant moderate contig700 1951050

IGV: Start, Jump

A/C
NGS:
0.024
C90:
0.000
PKSG-2b

UniProt

c.560C>T p.Thr187Met missense variant moderate contig700 1951078

IGV: Start, Jump

G/A
NGS:
0.050
C90:
0.000
PKSG-2b

UniProt

c.558G>A p.Met186Ile missense variant moderate contig700 1951080

IGV: Start, Jump

C/T
NGS:
0.050
C90:
0.000
PKSG-2b

UniProt

c.73A>T p.Ile25Leu missense variant moderate contig700 1951809

IGV: Start, Jump

T/A
NGS:
0.011
C90:
0.000
PKSG-2b

UniProt

c.31A>T p.Thr11Ser missense variant moderate contig700 1951851

IGV: Start, Jump

T/A
NGS:
0.844
C90:
0.880
PKSG-4b

UniProt

c.496A>G p.Lys166Glu missense variant moderate contig700 2721177

IGV: Start, Jump

T/C
NGS:
0.651
C90:
0.684
PKSG-4b

UniProt

c.489delT p.Phe163fs frameshift variant high contig700 2721183

IGV: Start, Jump

CA/C
NGS:
0.792
C90:
0.761
PKSG-4b

UniProt

c.485A>G p.Lys162Arg missense variant moderate contig700 2721188

IGV: Start, Jump

T/C
NGS:
0.643
C90:
0.301
PKSG-4b

UniProt

c.431T>G p.Val144Gly missense variant moderate contig700 2721242

IGV: Start, Jump

A/C
NGS:
0.575
C90:
0.679
PKSG-4b

UniProt

c.419A>G p.Asp140Gly missense variant moderate contig700 2721254

IGV: Start, Jump

T/C
NGS:
0.430
C90:
0.440
PKSG-4b

UniProt

c.352_355delACAG p.Thr118fs frameshift variant high contig700 2721317

IGV: Start, Jump

CCTGT/C
NGS:
0.529
C90:
0.000
PKSG-4b

UniProt

c.323A>G p.Glu108Gly missense variant moderate contig700 2721350

IGV: Start, Jump

T/C
NGS:
0.469
C90:
0.000
DXR-2

UniProt

c.1319T>C p.Ile440Thr missense variant moderate contig380 285250

IGV: Start, Jump

A/G
NGS:
0.480
C90:
0.000
OAC-2

UniProt

c.260C>G p.Ser87Cys missense variant moderate contig931 109979

IGV: Start, Jump

G/C
NGS:
0.070
C90:
0.000
ELF3

UniProt

c.358G>A p.Gly120Arg missense variant moderate contig97 242064

IGV: Start, Jump

G/A
NGS:
0.099
C90:
0.493
ELF3

UniProt

c.520A>C p.Asn174His missense variant moderate contig97 242226

IGV: Start, Jump

A/C
NGS:
0.094
C90:
0.502
ELF3

UniProt

c.574A>G p.Asn192Asp missense variant moderate contig97 242280

IGV: Start, Jump

A/G
NGS:
0.042
C90:
0.579
ELF3

UniProt

c.772A>G p.Ser258Gly missense variant moderate contig97 242478

IGV: Start, Jump

A/G
NGS:
0.112
C90:
0.000
ELF3

UniProt

c.812G>C p.Gly271Ala missense variant moderate contig97 242518

IGV: Start, Jump

G/C
NGS:
0.114
C90:
0.938
ELF3

UniProt

c.1230-2_1230-1delAG splice acceptor variant & intron variant high contig97 243676

IGV: Start, Jump

TAG/T
NGS:
0.088
C90:
0.450
ELF3

UniProt

c.1466G>A p.Ser489Asn missense variant moderate contig97 244297

IGV: Start, Jump

G/A
NGS:
0.123
C90:
0.000
ELF3

UniProt

c.1630A>G p.Thr544Ala missense variant moderate contig97 244461

IGV: Start, Jump

A/G
NGS:
0.103
C90:
0.545
ELF3

UniProt

c.1803_1805delTCA p.His601del disruptive inframe deletion moderate contig97 244625

IGV: Start, Jump

ACAT/A
NGS:
0.092
C90:
0.000
ELF3

UniProt

c.1966C>G p.Pro656Ala missense variant moderate contig97 244797

IGV: Start, Jump

C/G
NGS:
0.123
C90:
0.632
ELF3

UniProt

c.2141C>G p.Pro714Arg missense variant moderate contig97 244972

IGV: Start, Jump

C/G
NGS:
0.088
C90:
0.335
ELF3

UniProt

c.2198G>T p.Arg733Leu missense variant moderate contig97 245029

IGV: Start, Jump

G/T
NGS:
0.125
C90:
0.531
aPT4

UniProt

c.97T>C p.Tyr33His missense variant moderate contig121 2828753

IGV: Start, Jump

T/C
NGS:
0.439
C90:
0.000
aPT4

UniProt

c.153A>C p.Lys51Asn missense variant moderate contig121 2828809

IGV: Start, Jump

A/C
NGS:
0.375
C90:
0.000
aPT4

UniProt

c.775delT p.Tyr259fs frameshift variant high contig121 2831380

IGV: Start, Jump

AT/A
NGS:
0.224
C90:
0.000
aPT4

UniProt

c.1168T>C p.Tyr390His missense variant moderate contig121 2833503

IGV: Start, Jump

T/C
NGS:
0.546
C90:
0.000
aPT1

UniProt

c.406A>G p.Ile136Val missense variant moderate contig121 2839605

IGV: Start, Jump

A/G
NGS:
0.579
C90:
0.761
aPT1

UniProt

c.629C>T p.Thr210Ile missense variant moderate contig121 2840237

IGV: Start, Jump

C/T
NGS:
0.561
C90:
0.598
HDS-2

UniProt

c.82_93delGTAACCGGAACT p.Val28_Thr31del conservative inframe deletion moderate contig95 1989748

IGV: Start, Jump

CGTAACCGGAACT/C
NGS:
0.805
C90:
0.000
HDS-2

UniProt

c.127T>G p.Ser43Ala missense variant moderate contig95 1989794

IGV: Start, Jump

T/G
NGS:
0.721
C90:
0.000
AAE1-2

UniProt

c.331A>G p.Asn111Asp missense variant moderate contig81 209293

IGV: Start, Jump

A/G
NGS:
0.123
C90:
0.000
AAE1-2

UniProt

c.688G>A p.Asp230Asn missense variant moderate contig81 209650

IGV: Start, Jump

G/A
NGS:
0.018
C90:
0.000
AAE1-2

UniProt

c.948_949insA p.Asp317fs frameshift variant high contig81 209910

IGV: Start, Jump

C/CA
NGS:
0.050
C90:
0.000
AAE1-2

UniProt

c.952delC p.Gln318fs frameshift variant high contig81 209912

IGV: Start, Jump

AC/A
NGS:
0.050
C90:
0.000
AAE1-2

UniProt

c.953A>G p.Gln318Arg missense variant moderate contig81 209915

IGV: Start, Jump

A/G
NGS:
0.050
C90:
0.000
AAE1-2

UniProt

c.955C>T p.Arg319Cys missense variant moderate contig81 209917

IGV: Start, Jump

C/T
NGS:
0.050
C90:
0.000
AAE1-2

UniProt

c.1006A>G p.Lys336Glu missense variant moderate contig81 209968

IGV: Start, Jump

A/G
NGS:
0.116
C90:
0.000
AAE1-2

UniProt

c.1177G>A p.Asp393Asn missense variant moderate contig81 210139

IGV: Start, Jump

G/A
NGS:
0.013
C90:
0.000
AAE1-2

UniProt

c.1541T>C p.Val514Ala missense variant moderate contig81 210503

IGV: Start, Jump

T/C
NGS:
0.050
C90:
0.000
PHL-1

UniProt

c.2623A>G p.Thr875Ala missense variant moderate contig1439 1487174

IGV: Start, Jump

T/C
NGS:
0.123
C90:
0.000
PHL-1

UniProt

c.2551A>G p.Thr851Ala missense variant moderate contig1439 1487246

IGV: Start, Jump

T/C
NGS:
0.116
C90:
0.890
PHL-1

UniProt

c.1387A>G p.Thr463Ala missense variant moderate contig1439 1489811

IGV: Start, Jump

T/C
NGS:
0.107
C90:
0.904
Edestin

UniProt

c.41C>T p.Ala14Val missense variant moderate contig850 3065249

IGV: Start, Jump

G/A
NGS:
0.009
C90:
0.000
Edestin

UniProt

c.16T>C p.Ser6Pro missense variant moderate contig850 3065274

IGV: Start, Jump

A/G
NGS:
0.059
C90:
0.000
TFL1

UniProt

c.304G>A p.Asp102Asn missense variant & splice region variant moderate contig1636 520613

IGV: Start, Jump

C/T
NGS:
0.024
C90:
0.000
TFL1

UniProt

c.302-1G>A splice acceptor variant & intron variant high contig1636 520616

IGV: Start, Jump

C/T
NGS:
0.103
C90:
0.794
FAD4

UniProt

c.121G>T p.Val41Phe missense variant moderate contig784 1690873

IGV: Start, Jump

G/T
NGS:
0.044
C90:
0.000
HDS-1

UniProt

c.1618A>G p.Ile540Val missense variant moderate contig1891 885936

IGV: Start, Jump

T/C
NGS:
0.099
C90:
0.861
HDS-1

UniProt

c.1378G>A p.Val460Ile missense variant moderate contig1891 886370

IGV: Start, Jump

C/T
NGS:
0.167
C90:
0.000
HDS-1

UniProt

c.136G>A p.Val46Ile missense variant moderate contig1891 889256

IGV: Start, Jump

C/T
NGS:
0.088
C90:
0.593
HDS-1

UniProt

c.56C>G p.Ala19Gly missense variant moderate contig1891 889336

IGV: Start, Jump

G/C
NGS:
0.125
C90:
0.943
HDS-1

UniProt

c.35G>A p.Cys12Tyr missense variant moderate contig1891 889357

IGV: Start, Jump

C/T
NGS:
0.094
C90:
0.646
HDS-1

UniProt

c.-108+1_-108+2insG splice donor variant & intron variant high contig1891 889975

IGV: Start, Jump

A/AC
NGS:
0.217
C90:
0.000
PIE1-2

UniProt

c.6773T>C p.Leu2258Ser missense variant moderate contig1460 1184314

IGV: Start, Jump

A/G
NGS:
0.046
C90:
0.675
PIE1-2

UniProt

c.6653A>G p.Asn2218Ser missense variant moderate contig1460 1184434

IGV: Start, Jump

T/C
NGS:
0.059
C90:
0.928
PIE1-2

UniProt

c.6636T>G p.Asp2212Glu missense variant moderate contig1460 1184451

IGV: Start, Jump

A/C
NGS:
0.035
C90:
0.885
PIE1-2

UniProt

c.6623C>T p.Ala2208Val missense variant moderate contig1460 1184464

IGV: Start, Jump

G/A
NGS:
0.044
C90:
0.689
PIE1-2

UniProt

c.3512A>G p.Lys1171Arg missense variant moderate contig1460 1188528

IGV: Start, Jump

T/C
NGS:
0.018
C90:
0.670
PIE1-2

UniProt

c.2083_2085delGTC p.Val695del conservative inframe deletion moderate contig1460 1189954

IGV: Start, Jump

GGAC/G
NGS:
0.046
C90:
0.880
PIE1-2

UniProt

c.2072A>G p.His691Arg missense variant moderate contig1460 1189968

IGV: Start, Jump

T/C
NGS:
0.046
C90:
0.789
PIE1-2

UniProt

c.1872T>A p.Asp624Glu missense variant moderate contig1460 1190252

IGV: Start, Jump

A/T
NGS:
0.086
C90:
0.990
PIE1-2

UniProt

c.1630G>C p.Ala544Pro missense variant moderate contig1460 1191600

IGV: Start, Jump

C/G
NGS:
0.070
C90:
0.933
PIE1-2

UniProt

c.1289A>G p.Asp430Gly missense variant moderate contig1460 1192109

IGV: Start, Jump

T/C
NGS:
0.079
C90:
0.000
PIE1-2

UniProt

c.982G>A p.Glu328Lys missense variant moderate contig1460 1192416

IGV: Start, Jump

C/T
NGS:
0.050
C90:
0.976
PIE1-2

UniProt

c.710C>T p.Pro237Leu missense variant moderate contig1460 1193804

IGV: Start, Jump

G/A
NGS:
0.072
C90:
0.866
PIE1-2

UniProt

c.706T>C p.Tyr236His missense variant moderate contig1460 1193808

IGV: Start, Jump

A/G
NGS:
0.059
C90:
0.737
PIE1-2

UniProt

c.637T>A p.Ser213Thr missense variant moderate contig1460 1194421

IGV: Start, Jump

A/T
NGS:
0.079
C90:
0.885
EMF2

UniProt

c.1772A>G p.Gln591Arg missense variant moderate contig954 3059929

IGV: Start, Jump

A/G
NGS:
0.092
C90:
0.876
FT

UniProt

c.35_43dupATAATAATA p.Asn12_Asn14dup disruptive inframe insertion moderate contig1561 3124441

IGV: Start, Jump

T/TTAATAATAA
NGS:
0.048
C90:
0.000
FT

UniProt

c.29_43dupATAATAATAATAATA p.Asn10_Asn14dup disruptive inframe insertion moderate contig1561 3124441

IGV: Start, Jump

T/TTAATAATAATAATAA
NGS:
0.026
C90:
0.000
FT

UniProt

c.23_43dupATAATAATAATAATAATAATA p.Asn8_Asn14dup disruptive inframe insertion moderate contig1561 3124441

IGV: Start, Jump

T/TTAATAATAATAATAATAATAA
NGS:
0.020
C90:
0.000
FT

UniProt

c.240C>G p.Asn80Lys missense variant moderate contig1561 3124664

IGV: Start, Jump

C/G
NGS:
0.075
C90:
0.000
AAE1-3

UniProt

c.722G>A p.Arg241Lys missense variant moderate contig976 1083132

IGV: Start, Jump

C/T
NGS:
0.070
C90:
0.000
AAE1-3

UniProt

c.659G>A p.Arg220Gln missense variant moderate contig976 1083195

IGV: Start, Jump

C/T
NGS:
0.077
C90:
0.000
AAE1-3

UniProt

c.634G>C p.Gly212Arg missense variant moderate contig976 1083220

IGV: Start, Jump

C/G
NGS:
0.116
C90:
0.000
AAE1-3

UniProt

c.199A>G p.Asn67Asp missense variant moderate contig976 1083876

IGV: Start, Jump

T/C
NGS:
0.079
C90:
0.000
AAE1-3

UniProt

c.188A>G p.Asn63Ser missense variant moderate contig976 1083887

IGV: Start, Jump

T/C
NGS:
0.077
C90:
0.000
FAD7A-1

UniProt

c.*340_*343-4delTATATATATATATATATAGATA splice donor variant & splice region variant & 3 prime UTR variant & intron variant high contig510 71467

IGV: Start, Jump

CTATATATATATATATATAGATA/C
NGS:
0.007
C90:
0.000
FAD7A-1

UniProt

c.*342+1A>C splice donor variant & intron variant high contig510 71471

IGV: Start, Jump

A/C
NGS:
0.004
C90:
0.000
PIE1-1

UniProt

c.811T>C p.Tyr271His missense variant moderate contig1225 2279935

IGV: Start, Jump

T/C
NGS:
0.026
C90:
0.742
PIE1-1

UniProt

c.815C>T p.Pro272Leu missense variant moderate contig1225 2279939

IGV: Start, Jump

C/T
NGS:
0.029
C90:
0.885
PIE1-1

UniProt

c.1222C>G p.Gln408Glu missense variant moderate contig1225 2281482

IGV: Start, Jump

C/G
NGS:
0.096
C90:
0.852
PIE1-1

UniProt

c.3614A>G p.Lys1205Arg missense variant moderate contig1225 2285229

IGV: Start, Jump

A/G
NGS:
0.029
C90:
0.660
PIE1-1

UniProt

c.3619G>A p.Val1207Met missense variant moderate contig1225 2285234

IGV: Start, Jump

G/A
NGS:
0.042
C90:
0.000
PIE1-1

UniProt

c.6725C>T p.Ala2242Val missense variant moderate contig1225 2289290

IGV: Start, Jump

C/T
NGS:
0.046
C90:
0.737
GGR

UniProt

c.704A>T p.His235Leu missense variant moderate contig2282 549696

IGV: Start, Jump

A/T
NGS:
0.121
C90:
0.000
PKSB-3

UniProt

c.1652A>G p.Glu551Gly missense variant moderate contig93 3339759

IGV: Start, Jump

A/G
NGS:
0.088
C90:
0.000
PKSB-3

UniProt

c.1901C>G p.Ala634Gly missense variant moderate contig93 3340008

IGV: Start, Jump

C/G
NGS:
0.059
C90:
0.000

Nearest genetic relatives (All Samples)

0 0.067 0.133 0.200 0.267
clone distance sibling distance more distant
  1. 0.187 Blueberry Cheesecake (RSP10646)
  2. 0.205 Domnesia (RSP11184)
  3. 0.210 Trump x Trump (RSP11466)
  4. 0.211 Harlox (RSP10641)
  5. 0.216 Electra (RSP11366)
  6. 0.221 Black 84 (RSP11188)
  7. 0.227 Lift (RSP11378)
  8. 0.229 Doug s Varin (RSP11243)
  9. 0.230 Lifter (RSP11365)
  10. 0.233 Liberty Haze (RSP11000)
  11. 0.235 Joy (RSP11380)
  12. 0.236 Liberty Haze (RSP10946)
  13. 0.237 Flo (RSP11232)
  14. 0.238 Blueberry Cheesecake (RSP10684)
  15. 0.239 Thank You Jerry (RSP11459)
  16. 0.241 Serious Happiness (RSP10763)
  17. 0.242 Super Silver Haze (RSP10632)
  18. 0.242 Suver Haze (RSP11364)
  19. 0.243 Northern Lights #5 X Haze (RSP10628)
  20. 0.248 Alaska USA (RSP11171)

Nearest genetic relatives (Base Tree)

0 0.083 0.167 0.250 0.333
clone distance sibling distance more distant
  1. 0.230 Liberty Haze (RSP11000)
  2. 0.240 Blueberry Cheesecake (RSP10684)
  3. 0.254 RKM-2018-031 (RSP11123)
  4. 0.257 RKM-2018-028 (RSP11120)
  5. 0.259 Queen Jesus (RSP10105)
  6. 0.267 Cbot-2019-006 (RSP11134)
  7. 0.277 Durban Poison (RSP11014)
  8. 0.277 Gold Cracker (RSP11048)
  9. 0.286 RKM-2018-020 (RSP11112)
  10. 0.288 Hermaphrodite ResearchSample2 (RSP11050)
  11. 0.288 RKM-2018-003 (RSP11094)
  12. 0.290 Cbot-2019-004 (RSP11132)
  13. 0.291 RKM-2018-022 (RSP11114)
  14. 0.292 RKM-2018-006 (RSP11097)
  15. 0.297 RKM-2018-009 (RSP11100)
  16. 0.301 RKM-2018-018 (RSP11110)
  17. 0.301 RKM-2018-033 (RSP11125)
  18. 0.302 RKM-2018-019 (RSP11111)
  19. 0.305 Black Beauty (RSP11035)
  20. 0.306 Hermaphrodite Research Sample1 (RSP11049)

Most genetically distant strains (All Samples)

0 0.117 0.233 0.350 0.467
clone distance sibling distance more distant
  1. 0.453 JL yellow (RSP11075)
  2. 0.436 Cherry Blossom (RSP11328)
  3. 0.435 Cherry Blossom (RSP11323)
  4. 0.434 JL 3rd Gen Mother (RSP11214)
  5. 0.430 JL 3rd Gen Mother (RSP11197)
  6. 0.429 Cherry Blossom (RSP11311)
  7. 0.428 Tiger Tail -30- (RSP11484)
  8. 0.424 Cherry Blossom (RSP11317)
  9. 0.422 Unknown--Cherry Wine---001- (RSP11268)
  10. 0.422 Cherry Blossom (RSP11334)
  11. 0.421 Cherry Blossom (RSP11314)
  12. 0.420 Cherry Blossom (RSP11301)
  13. 0.420 80E (RSP11213)
  14. 0.416 Cherry Blossom (RSP11298)
  15. 0.415 CS Indica (RSP11658)
  16. 0.414 JL 4th Gen 2 (RSP11194)
  17. 0.414 Cherry Blossom (RSP11306)
  18. 0.414 Right Mark (RSP11628)
  19. 0.413 JL 4th Gen 5 (RSP11199)
  20. 0.410 Cherry Blossom (RSP11309)

Most genetically distant strains (Base Tree)

0 0.117 0.233 0.350 0.467
clone distance sibling distance more distant
  1. 0.455 JL yellow (RSP11075)
  2. 0.399 Cbot-2019-005 (RSP11133)
  3. 0.392 Feral (RSP10890)
  4. 0.387 Skywalker OG (RSP10837)
  5. 0.387 Monoica (RSP10241)
  6. 0.384 Carmagnola (RSP11037)
  7. 0.378 Ivory (RSP10668)
  8. 0.376 RKM-2018-034 (RSP11126)
  9. 0.374 Kimbo Slice (RSP10997)
  10. 0.372 USO 31 (RSP10981)
  11. 0.368 Carmagnola (RSP10979)
  12. 0.368 Santhica27 (RSP11047)
  13. 0.364 Kyrgyz Gold (RSP11054)
  14. 0.364 Fedora 17 (RSP10661)
  15. 0.363 Cherry (RSP11143)
  16. 0.362 RKM-2018-026 (RSP11118)
  17. 0.361 Futura 75 (RSP10664)
  18. 0.360 Cbot-2019-001 (RSP11129)
  19. 0.360 Tisza (RSP11044)
  20. 0.359 KYRG-11 (RSP11051)

Nearest genetic relative in Phylos dataset

Phylos Strain SRR4448400
Overlapping SNPs:
104
Concordance:
70

Nearest genetic relative in Lynch dataset

Lynch Strain SRR3495180
Overlapping SNPs:
6
Concordance:
6

Blockchain Registration Information

Transaction ID
794b64c5fbcbe4cb24fcf2046c4d2dbaca546df8d7a5f9eb1f7a33e63a040a6d
Stamping Certificate
Download PDF (844.6 KB)
SHASUM Hash
a0e494050ce01dc54cc39a0b23c3c5f3470e56c3c788ebd2ac4cddb1ea0107da
QR code for RSP11182

Kannapedia uses cookies

By clicking Allow All, you agree to the storing of cookies on your device to enhance site navigation, analyze site usage, and assist in our marketing efforts.

Customize Settings