Feral

RSP 11206

Grower: John McKay-Colorado State University

General Information

Sample Name
IdaliaFT_1_CSU
Accession Date
June 26, 2019
Reported Plant Sex
not reported

The strain rarity visualization shows how distant the strain is from the other cultivars in the Kannapedia database. The y-axis represents genetic distance, getting farther as you go up. The width of the visualization at any position along the y-axis shows how many strains there are in the database at that genetic distance. So, a common strain will have a more bottom-heavy shape, while uncommon and rare cultivars will have a visualization that is generally shifted towards the top.

Rarity: Rare
Most Distant Most Similar

Chemical Information

Cannabinoid and terpenoid information provided by the grower.

Cannabinoids

No information provided.

Terpenoids

No information provided.

Genetic Information

Plant Type
Type III

The bell curve in the heterozygosity visualization shows the distribution of heterozygosity levels for cannabis cultivars in the Kannapedia database. The green line shows where this particular strain fits within the distribution. Heterozygosity is associated with heterosis (aka hybrid vigor) but also leads to the production of more variable offspring. When plants have two genetically different parents, heterozygosity levels will be higher than if it has been inbred or backcrossed repeatedly.

Heterozygosity: 2.34%
Least Heterozygous Most Heterozygous

This chart represents the Illumina sequence coverage over the Bt/Bd allele. These are the three regions in the cannabis genome that impact THCA, CBDA, CBGA production. Coverage over the Active CBDAS gene is highly correlated with Type II and Type III plants as described by Etienne de Meijer. Coverage over the THCA gene is highly correlated with Type I and Type II plants but is anti-correlated with Type III plants. Type I plants require coverage over the inactive CBDA loci and no coverage over the Active CBDA gene. Lack of coverage over the Active CBDA and Active THCA allele are presumed to be Type IV plants (CBGA dominant). While deletions of entire THCAS and CBDAS genes are the most common Bt:Bd alleles observed, it is possible to have plants with these genes where functional expression of the enzyme is disrupted by deactivating point mutations (Kojoma et al. 2006).

Bt/Bd Allele Coverage

This chart represents the Illumina sequence coverage over the CBCA synthase gene.

CBCAS Coverage

Variants (THCAS, CBDAS, and CBCAS)

CBDAS c.8G>A p.Cys3Tyr missense variant moderate contig1772 2082234

IGV: Start, Jump

G/A
NGS:
0.057
C90:
0.000
CBDAS c.1420A>C p.Lys474Gln missense variant moderate contig1772 2083646

IGV: Start, Jump

A/C
NGS:
0.132
C90:
0.813
CBDAS c.1628G>A p.Arg543His missense variant moderate contig1772 2083854

IGV: Start, Jump

G/A
NGS:
0.033
C90:
0.000
CBCAS c.1420C>T p.Pro474Ser missense variant moderate contig756 3100726

IGV: Start, Jump

C/T
NGS:
0.009
C90:
0.000

Variants (Select Genes of Interest)

PKSA-3b

UniProt

c.298G>A p.Ala100Thr missense variant moderate contig705 2271640

IGV: Start, Jump

C/T
NGS:
0.044
C90:
0.177
GPPs1

UniProt

c.160A>G p.Lys54Glu missense variant moderate contig676 168409

IGV: Start, Jump

A/G
NGS:
0.026
C90:
0.000
GPPs1

UniProt

c.472T>A p.Leu158Met missense variant moderate contig676 168721

IGV: Start, Jump

T/A
NGS:
0.020
C90:
0.000
GPPs1

UniProt

c.744C>G p.Asp248Glu missense variant moderate contig676 168993

IGV: Start, Jump

C/G
NGS:
0.022
C90:
0.000
GPPs1

UniProt

c.807_814delGCATTTTT p.His270fs frameshift variant high contig676 169595

IGV: Start, Jump

GTGCATTTT/G
NGS:
0.015
C90:
0.000
GPPs1

UniProt

c.845_848delAAAG p.Glu282fs frameshift variant high contig676 169629

IGV: Start, Jump

TGAAA/T
NGS:
0.118
C90:
0.000
GPPs1

UniProt

c.857_864delCGAAAGAG p.Ala286fs frameshift variant high contig676 169645

IGV: Start, Jump

GGCGAAAGA/G
NGS:
0.009
C90:
0.000
GPPs1

UniProt

c.866_877delTACTAGAGCTAG p.Leu289_Glu293delinsTer stop gained & disruptive inframe deletion high contig676 169655

IGV: Start, Jump

TTACTAGAGCTAG/T
NGS:
0.009
C90:
0.000
GPPs1

UniProt

c.896A>G p.Asn299Ser missense variant moderate contig676 169772

IGV: Start, Jump

A/G
NGS:
0.046
C90:
0.000
GPPs1

UniProt

c.923_927+5delTTTTGGTACT p.Val308fs frameshift variant & splice donor variant & splice region variant & intron variant high contig676 169798

IGV: Start, Jump

GTTTTGGTACT/G
NGS:
0.009
C90:
0.000
GPPs1

UniProt

c.931delT p.Ter311fs frameshift variant & stop lost & splice region variant high contig676 169840

IGV: Start, Jump

AT/A
NGS:
0.009
C90:
0.000
EMF1-2

UniProt

c.3G>T p.Met1? start lost high contig885 103

IGV: Start, Jump

G/T
NGS:
0.007
C90:
0.000
EMF1-2

UniProt

c.349G>A p.Asp117Asn missense variant moderate contig885 449

IGV: Start, Jump

G/A
NGS:
0.004
C90:
0.000
EMF1-2

UniProt

c.572A>G p.Asn191Ser missense variant moderate contig885 672

IGV: Start, Jump

A/G
NGS:
0.004
C90:
0.000
EMF1-2

UniProt

c.710A>C p.His237Pro missense variant moderate contig885 810

IGV: Start, Jump

A/C
NGS:
0.090
C90:
0.474
EMF1-2

UniProt

c.1148C>T p.Ala383Val missense variant moderate contig885 2034

IGV: Start, Jump

C/T
NGS:
0.007
C90:
0.000
EMF1-2

UniProt

c.1187T>C p.Leu396Ser missense variant moderate contig885 2073

IGV: Start, Jump

T/C
NGS:
0.026
C90:
0.000
EMF1-2

UniProt

c.1189G>A p.Ala397Thr missense variant moderate contig885 2075

IGV: Start, Jump

G/A
NGS:
0.007
C90:
0.000
EMF1-2

UniProt

c.1199G>A p.Arg400Lys missense variant moderate contig885 2085

IGV: Start, Jump

G/A
NGS:
0.007
C90:
0.000
EMF1-2

UniProt

c.1331G>A p.Ser444Asn missense variant moderate contig885 2217

IGV: Start, Jump

G/A
NGS:
0.004
C90:
0.000
EMF1-2

UniProt

c.1409G>A p.Arg470Lys missense variant moderate contig885 2295

IGV: Start, Jump

G/A
NGS:
0.007
C90:
0.000
EMF1-2

UniProt

c.1828A>G p.Ile610Val missense variant moderate contig885 2714

IGV: Start, Jump

A/G
NGS:
0.007
C90:
0.000
EMF1-2

UniProt

c.2008C>T p.Pro670Ser missense variant moderate contig885 2894

IGV: Start, Jump

C/T
NGS:
0.007
C90:
0.000
EMF1-2

UniProt

c.2256A>T p.Lys752Asn missense variant moderate contig885 3142

IGV: Start, Jump

A/T
NGS:
0.026
C90:
0.000
EMF1-2

UniProt

c.2653A>G p.Thr885Ala missense variant moderate contig885 3539

IGV: Start, Jump

A/G
NGS:
0.007
C90:
0.000
PHL-2 c.44G>A p.Arg15Lys missense variant moderate contig2621 337613

IGV: Start, Jump

G/A
NGS:
0.015
C90:
0.167
PHL-2 c.932T>C p.Leu311Pro missense variant moderate contig2621 340210

IGV: Start, Jump

T/C
NGS:
0.039
C90:
0.268
PHL-2 c.1057A>G p.Arg353Gly missense variant moderate contig2621 340335

IGV: Start, Jump

A/G
NGS:
0.096
C90:
0.555
PHL-2 c.1096G>A p.Ala366Thr missense variant moderate contig2621 340374

IGV: Start, Jump

G/A
NGS:
0.090
C90:
0.531
PHL-2 c.2564T>A p.Phe855Tyr missense variant moderate contig2621 342607

IGV: Start, Jump

T/A
NGS:
0.064
C90:
0.732
PHL-2 c.2578T>A p.Leu860Ile missense variant moderate contig2621 342621

IGV: Start, Jump

T/A
NGS:
0.068
C90:
0.746
PHL-2 c.2624C>T p.Ser875Phe missense variant moderate contig2621 342667

IGV: Start, Jump

C/T
NGS:
0.042
C90:
0.268
PHL-2 c.2783G>A p.Ser928Asn missense variant moderate contig2621 342826

IGV: Start, Jump

G/A
NGS:
0.107
C90:
0.890
PHL-2 c.2830A>C p.Asn944His missense variant moderate contig2621 342873

IGV: Start, Jump

A/C
NGS:
0.044
C90:
0.000
PHL-2 c.2933G>T p.Arg978Leu missense variant moderate contig2621 342976

IGV: Start, Jump

G/T
NGS:
0.048
C90:
0.297
PHL-2 c.2936T>G p.Val979Gly missense variant moderate contig2621 342979

IGV: Start, Jump

T/G
NGS:
0.048
C90:
0.000
PHL-2 c.3209A>G p.Gln1070Arg missense variant moderate contig2621 343252

IGV: Start, Jump

A/G
NGS:
0.103
C90:
0.885
PHL-2 c.3467A>G p.Gln1156Arg missense variant moderate contig2621 343510

IGV: Start, Jump

A/G
NGS:
0.064
C90:
0.713
PKSG-4a

UniProt

c.37C>G p.Gln13Glu missense variant moderate contig700 1936734

IGV: Start, Jump

C/G
NGS:
0.031
C90:
0.000
PKSG-4a

UniProt

c.49_50insTGG p.Glu16_Gly17insVal disruptive inframe insertion moderate contig700 1936744

IGV: Start, Jump

A/AGGT
NGS:
0.013
C90:
0.000
PKSG-4a

UniProt

c.493G>A p.Gly165Ser missense variant moderate contig700 1937904

IGV: Start, Jump

G/A
NGS:
0.103
C90:
0.000
PKSG-2a

UniProt

c.1117A>G p.Ile373Val missense variant moderate contig700 1944273

IGV: Start, Jump

T/C
NGS:
0.101
C90:
0.967
PKSG-2a

UniProt

c.948T>G p.Asp316Glu missense variant moderate contig700 1944442

IGV: Start, Jump

A/C
NGS:
0.079
C90:
0.000
PKSG-2a

UniProt

c.945T>G p.Ser315Arg missense variant moderate contig700 1944445

IGV: Start, Jump

A/C
NGS:
0.079
C90:
0.000
PKSG-2a

UniProt

c.944G>A p.Ser315Asn missense variant moderate contig700 1944446

IGV: Start, Jump

C/T
NGS:
0.079
C90:
0.000
PKSG-2a

UniProt

c.934C>G p.His312Asp missense variant moderate contig700 1944456

IGV: Start, Jump

G/C
NGS:
0.070
C90:
0.000
PKSG-2b

UniProt

c.1132C>G p.Leu378Val missense variant moderate contig700 1950506

IGV: Start, Jump

G/C
NGS:
0.717
C90:
0.000
PKSG-2b

UniProt

c.1117A>G p.Ile373Val missense variant moderate contig700 1950521

IGV: Start, Jump

T/C
NGS:
0.807
C90:
0.981
PKSG-2b

UniProt

c.948T>G p.Asp316Glu missense variant moderate contig700 1950690

IGV: Start, Jump

A/C
NGS:
0.456
C90:
0.000
PKSG-2b

UniProt

c.945T>G p.Ser315Arg missense variant moderate contig700 1950693

IGV: Start, Jump

A/C
NGS:
0.454
C90:
0.000
PKSG-2b

UniProt

c.944G>A p.Ser315Asn missense variant moderate contig700 1950694

IGV: Start, Jump

C/T
NGS:
0.445
C90:
0.000
PKSG-2b

UniProt

c.934C>G p.His312Asp missense variant moderate contig700 1950704

IGV: Start, Jump

G/C
NGS:
0.410
C90:
0.000
PKSG-2b

UniProt

c.774G>A p.Met258Ile missense variant moderate contig700 1950864

IGV: Start, Jump

C/T
NGS:
0.366
C90:
0.947
PKSG-2b

UniProt

c.67A>T p.Ile23Phe missense variant moderate contig700 1951815

IGV: Start, Jump

T/A
NGS:
0.033
C90:
0.325
PKSG-2b

UniProt

c.31A>T p.Thr11Ser missense variant moderate contig700 1951851

IGV: Start, Jump

T/A
NGS:
0.844
C90:
0.880
PKSG-4b

UniProt

c.557+2T>C splice donor variant & intron variant high contig700 2721114

IGV: Start, Jump

A/G
NGS:
0.011
C90:
0.000
PKSG-4b

UniProt

c.431T>G p.Val144Gly missense variant moderate contig700 2721242

IGV: Start, Jump

A/C
NGS:
0.575
C90:
0.679
PKSG-4b

UniProt

c.352_355delACAG p.Thr118fs frameshift variant high contig700 2721317

IGV: Start, Jump

CCTGT/C
NGS:
0.529
C90:
0.000
PKSG-4b

UniProt

c.347C>A p.Thr116Asn missense variant moderate contig700 2721326

IGV: Start, Jump

G/T
NGS:
0.002
C90:
0.000
PKSG-4b

UniProt

c.323A>G p.Glu108Gly missense variant moderate contig700 2721350

IGV: Start, Jump

T/C
NGS:
0.469
C90:
0.000
PKSG-4b

UniProt

c.316+2T>A splice donor variant & intron variant high contig700 2723818

IGV: Start, Jump

A/T
NGS:
0.070
C90:
0.689
AAE1-1

UniProt

c.1580A>G p.Asn527Ser missense variant moderate contig606 3242691

IGV: Start, Jump

T/C
NGS:
0.004
C90:
0.000
AAE1-1

UniProt

c.1504G>A p.Asp502Asn missense variant moderate contig606 3242767

IGV: Start, Jump

C/T
NGS:
0.004
C90:
0.000
AAE1-1

UniProt

c.946G>A p.Ala316Thr missense variant moderate contig606 3243325

IGV: Start, Jump

C/T
NGS:
0.004
C90:
0.000
AAE1-1

UniProt

c.454A>G p.Lys152Glu missense variant moderate contig606 3243817

IGV: Start, Jump

T/C
NGS:
0.007
C90:
0.000
DXR-2

UniProt

c.1319T>C p.Ile440Thr missense variant moderate contig380 285250

IGV: Start, Jump

A/G
NGS:
0.480
C90:
0.000
OAC-2

UniProt

c.220A>G p.Ile74Val missense variant moderate contig931 110019

IGV: Start, Jump

T/C
NGS:
0.011
C90:
0.670
OAC-2

UniProt

c.185C>T p.Thr62Ile missense variant moderate contig931 110054

IGV: Start, Jump

G/A
NGS:
0.029
C90:
0.000
OAC-1

UniProt

c.260C>G p.Ser87Cys missense variant moderate contig931 118104

IGV: Start, Jump

G/C
NGS:
0.053
C90:
0.000
ELF3

UniProt

c.772A>G p.Ser258Gly missense variant moderate contig97 242478

IGV: Start, Jump

A/G
NGS:
0.112
C90:
0.000
ELF3

UniProt

c.812G>C p.Gly271Ala missense variant moderate contig97 242518

IGV: Start, Jump

G/C
NGS:
0.114
C90:
0.938
ELF3

UniProt

c.1366T>G p.Leu456Val missense variant moderate contig97 244197

IGV: Start, Jump

T/G
NGS:
0.015
C90:
0.000
ELF3

UniProt

c.1466G>A p.Ser489Asn missense variant moderate contig97 244297

IGV: Start, Jump

G/A
NGS:
0.123
C90:
0.000
ELF3

UniProt

c.1571C>T p.Pro524Leu missense variant moderate contig97 244402

IGV: Start, Jump

C/T
NGS:
0.002
C90:
0.000
ELF3

UniProt

c.1630A>G p.Thr544Ala missense variant moderate contig97 244461

IGV: Start, Jump

A/G
NGS:
0.103
C90:
0.545
ELF3

UniProt

c.1803_1805delTCA p.His601del disruptive inframe deletion moderate contig97 244625

IGV: Start, Jump

ACAT/A
NGS:
0.092
C90:
0.000
ELF3

UniProt

c.1966C>G p.Pro656Ala missense variant moderate contig97 244797

IGV: Start, Jump

C/G
NGS:
0.123
C90:
0.632
ELF3

UniProt

c.2198G>T p.Arg733Leu missense variant moderate contig97 245029

IGV: Start, Jump

G/T
NGS:
0.125
C90:
0.531
ELF3

UniProt

c.2207A>T p.His736Leu missense variant moderate contig97 245038

IGV: Start, Jump

A/T
NGS:
0.002
C90:
0.000
ELF5

UniProt

c.520A>G p.Thr174Ala missense variant moderate contig382 880382

IGV: Start, Jump

A/G
NGS:
0.015
C90:
0.048
aPT4

UniProt

c.97T>C p.Tyr33His missense variant moderate contig121 2828753

IGV: Start, Jump

T/C
NGS:
0.439
C90:
0.000
aPT4

UniProt

c.153A>C p.Lys51Asn missense variant moderate contig121 2828809

IGV: Start, Jump

A/C
NGS:
0.375
C90:
0.000
aPT4

UniProt

c.517A>T p.Ile173Leu missense variant & splice region variant moderate contig121 2830795

IGV: Start, Jump

A/T
NGS:
0.022
C90:
0.000
aPT4

UniProt

c.757G>T p.Val253Leu missense variant moderate contig121 2831364

IGV: Start, Jump

G/T
NGS:
0.039
C90:
0.000
aPT4

UniProt

c.1168T>C p.Tyr390His missense variant moderate contig121 2833503

IGV: Start, Jump

T/C
NGS:
0.546
C90:
0.000
aPT1

UniProt

c.95_97delGTT p.Cys32del disruptive inframe deletion moderate contig121 2835800

IGV: Start, Jump

ATGT/A
NGS:
0.118
C90:
0.311
aPT1

UniProt

c.406A>G p.Ile136Val missense variant moderate contig121 2839605

IGV: Start, Jump

A/G
NGS:
0.579
C90:
0.761
aPT1

UniProt

c.727G>T p.Glu243* stop gained high contig121 2841362

IGV: Start, Jump

G/T
NGS:
0.127
C90:
0.100
HDS-2

UniProt

c.82_93delGTAACCGGAACT p.Val28_Thr31del conservative inframe deletion moderate contig95 1989748

IGV: Start, Jump

CGTAACCGGAACT/C
NGS:
0.805
C90:
0.000
HDS-2

UniProt

c.127T>C p.Ser43Pro missense variant moderate contig95 1989794

IGV: Start, Jump

T/C
NGS:
0.002
C90:
0.000
HDS-2

UniProt

c.127T>G p.Ser43Ala missense variant moderate contig95 1989794

IGV: Start, Jump

T/G
NGS:
0.721
C90:
0.000
AAE1-2

UniProt

c.205T>A p.Ser69Thr missense variant moderate contig81 209167

IGV: Start, Jump

T/A
NGS:
0.013
C90:
0.000
AAE1-2

UniProt

c.331A>G p.Asn111Asp missense variant moderate contig81 209293

IGV: Start, Jump

A/G
NGS:
0.123
C90:
0.000
AAE1-2

UniProt

c.374A>G p.His125Arg missense variant moderate contig81 209336

IGV: Start, Jump

A/G
NGS:
0.026
C90:
0.000
AAE1-2

UniProt

c.409C>T p.Arg137Cys missense variant moderate contig81 209371

IGV: Start, Jump

C/T
NGS:
0.009
C90:
0.000
AAE1-2

UniProt

c.948_949insA p.Asp317fs frameshift variant high contig81 209910

IGV: Start, Jump

C/CA
NGS:
0.050
C90:
0.000
AAE1-2

UniProt

c.952delC p.Gln318fs frameshift variant high contig81 209912

IGV: Start, Jump

AC/A
NGS:
0.050
C90:
0.000
AAE1-2

UniProt

c.953A>G p.Gln318Arg missense variant moderate contig81 209915

IGV: Start, Jump

A/G
NGS:
0.050
C90:
0.000
AAE1-2

UniProt

c.955C>T p.Arg319Cys missense variant moderate contig81 209917

IGV: Start, Jump

C/T
NGS:
0.050
C90:
0.000
AAE1-2

UniProt

c.1006A>G p.Lys336Glu missense variant moderate contig81 209968

IGV: Start, Jump

A/G
NGS:
0.116
C90:
0.000
AAE1-2

UniProt

c.1415G>A p.Ser472Asn missense variant moderate contig81 210377

IGV: Start, Jump

G/A
NGS:
0.070
C90:
0.000
AAE1-2

UniProt

c.1417A>G p.Thr473Ala missense variant moderate contig81 210379

IGV: Start, Jump

A/G
NGS:
0.070
C90:
0.000
AAE1-2

UniProt

c.1434G>T p.Glu478Asp missense variant moderate contig81 210396

IGV: Start, Jump

G/T
NGS:
0.075
C90:
0.000
PHL-1

UniProt

c.2623A>G p.Thr875Ala missense variant moderate contig1439 1487174

IGV: Start, Jump

T/C
NGS:
0.123
C90:
0.000
PHL-1

UniProt

c.2551A>G p.Thr851Ala missense variant moderate contig1439 1487246

IGV: Start, Jump

T/C
NGS:
0.116
C90:
0.890
PHL-1

UniProt

c.1387A>G p.Thr463Ala missense variant moderate contig1439 1489811

IGV: Start, Jump

T/C
NGS:
0.107
C90:
0.904
Edestin

UniProt

c.40G>A p.Ala14Thr missense variant moderate contig850 3065250

IGV: Start, Jump

C/T
NGS:
0.011
C90:
0.000
Edestin

UniProt

c.17C>T p.Ser6Leu missense variant moderate contig850 3065273

IGV: Start, Jump

G/A
NGS:
0.011
C90:
0.000
Edestin

UniProt

c.16T>C p.Ser6Pro missense variant moderate contig850 3065274

IGV: Start, Jump

A/G
NGS:
0.059
C90:
0.000
TFL1

UniProt

c.304G>A p.Asp102Asn missense variant & splice region variant moderate contig1636 520613

IGV: Start, Jump

C/T
NGS:
0.024
C90:
0.000
TFL1

UniProt

c.302-1G>A splice acceptor variant & intron variant high contig1636 520616

IGV: Start, Jump

C/T
NGS:
0.103
C90:
0.794
HDS-1

UniProt

c.1618A>G p.Ile540Val missense variant moderate contig1891 885936

IGV: Start, Jump

T/C
NGS:
0.099
C90:
0.861
HDS-1

UniProt

c.109G>A p.Val37Ile missense variant moderate contig1891 889283

IGV: Start, Jump

C/T
NGS:
0.002
C90:
0.000
HDS-1

UniProt

c.56C>G p.Ala19Gly missense variant moderate contig1891 889336

IGV: Start, Jump

G/C
NGS:
0.125
C90:
0.943
HDS-1

UniProt

c.-108+1_-108+2insG splice donor variant & intron variant high contig1891 889975

IGV: Start, Jump

A/AC
NGS:
0.217
C90:
0.000
PIE1-2

UniProt

c.6653A>G p.Asn2218Ser missense variant moderate contig1460 1184434

IGV: Start, Jump

T/C
NGS:
0.059
C90:
0.928
PIE1-2

UniProt

c.5932A>G p.Ile1978Val missense variant moderate contig1460 1185552

IGV: Start, Jump

T/C
NGS:
0.061
C90:
0.268
PIE1-2

UniProt

c.2083_2085delGTC p.Val695del conservative inframe deletion moderate contig1460 1189954

IGV: Start, Jump

GGAC/G
NGS:
0.046
C90:
0.880
PIE1-2

UniProt

c.2072A>G p.His691Arg missense variant moderate contig1460 1189968

IGV: Start, Jump

T/C
NGS:
0.046
C90:
0.789
PIE1-2

UniProt

c.1872T>A p.Asp624Glu missense variant moderate contig1460 1190252

IGV: Start, Jump

A/T
NGS:
0.086
C90:
0.990
PIE1-2

UniProt

c.1630G>C p.Ala544Pro missense variant moderate contig1460 1191600

IGV: Start, Jump

C/G
NGS:
0.070
C90:
0.933
PIE1-2

UniProt

c.1289A>G p.Asp430Gly missense variant moderate contig1460 1192109

IGV: Start, Jump

T/C
NGS:
0.079
C90:
0.000
PIE1-2

UniProt

c.1019_1048dupATGTGGGTGAACCAACCCAGATGGAGGATA p.Asn340_Asp349dup conservative inframe insertion moderate contig1460 1192349

IGV: Start, Jump

C/CTATCCTCCATCTGGGTTGGTTCACCCACAT
NGS:
0.009
C90:
0.000
PIE1-2

UniProt

c.982G>A p.Glu328Lys missense variant moderate contig1460 1192416

IGV: Start, Jump

C/T
NGS:
0.050
C90:
0.976
PIE1-2

UniProt

c.710C>T p.Pro237Leu missense variant moderate contig1460 1193804

IGV: Start, Jump

G/A
NGS:
0.072
C90:
0.866
PIE1-2

UniProt

c.706T>C p.Tyr236His missense variant moderate contig1460 1193808

IGV: Start, Jump

A/G
NGS:
0.059
C90:
0.737
PIE1-2

UniProt

c.637T>A p.Ser213Thr missense variant moderate contig1460 1194421

IGV: Start, Jump

A/T
NGS:
0.079
C90:
0.885
EMF2

UniProt

c.434C>T p.Ser145Phe missense variant moderate contig954 3049270

IGV: Start, Jump

C/T
NGS:
0.018
C90:
0.057
EMF2

UniProt

c.1772A>G p.Gln591Arg missense variant moderate contig954 3059929

IGV: Start, Jump

A/G
NGS:
0.092
C90:
0.876
EMF1-1

UniProt

c.62C>G p.Thr21Ser missense variant moderate contig883 268910

IGV: Start, Jump

C/G
NGS:
0.007
C90:
0.000
EMF1-1

UniProt

c.389G>A p.Arg130Gln missense variant moderate contig883 269878

IGV: Start, Jump

G/A
NGS:
0.007
C90:
0.000
EMF1-1

UniProt

c.476A>T p.Asn159Ile missense variant moderate contig883 269965

IGV: Start, Jump

A/T
NGS:
0.007
C90:
0.000
EMF1-1

UniProt

c.590A>T p.Lys197Ile missense variant moderate contig883 270079

IGV: Start, Jump

A/T
NGS:
0.007
C90:
0.000
FT

UniProt

c.13C>G p.Leu5Val missense variant moderate contig1561 3124437

IGV: Start, Jump

C/G
NGS:
0.031
C90:
0.153
FT

UniProt

c.41_43dupATA p.Asn14dup disruptive inframe insertion moderate contig1561 3124441

IGV: Start, Jump

T/TTAA
NGS:
0.020
C90:
0.000
FT

UniProt

c.43_44insATAATAATAATAATAATAATAATAATAATAATA p.Asn14_Ser15insAsnAsnAsnAsnAsnAsnAsnAsnAsnAsnAsn disruptive inframe insertion moderate contig1561 3124441

IGV: Start, Jump

T/TTAATAATAATAATAATAATAATAATAATAATAA
NGS:
0.004
C90:
0.000
FT

UniProt

c.43_44insATAATAATAATAATAATAATAATAATAATAATAATA p.Asn14_Ser15insAsnAsnAsnAsnAsnAsnAsnAsnAsnAsnAsnAsn disruptive inframe insertion moderate contig1561 3124441

IGV: Start, Jump

T/TTAATAATAATAATAATAATAATAATAATAATAATAA
NGS:
0.004
C90:
0.000
FT

UniProt

c.175C>G p.Leu59Val missense variant moderate contig1561 3124599

IGV: Start, Jump

C/G
NGS:
0.004
C90:
0.000
FT

UniProt

c.196A>G p.Ile66Val missense variant moderate contig1561 3124620

IGV: Start, Jump

A/G
NGS:
0.004
C90:
0.033
FT

UniProt

c.240C>G p.Asn80Lys missense variant moderate contig1561 3124664

IGV: Start, Jump

C/G
NGS:
0.075
C90:
0.000
FT

UniProt

c.420C>A p.Ser140Arg missense variant moderate contig1561 3126659

IGV: Start, Jump

C/A
NGS:
0.004
C90:
0.000
FLD

UniProt

c.2869C>T p.His957Tyr missense variant moderate contig1450 2044163

IGV: Start, Jump

G/A
NGS:
0.011
C90:
0.000
FLD

UniProt

c.2831A>G p.Glu944Gly missense variant moderate contig1450 2044201

IGV: Start, Jump

T/C
NGS:
0.011
C90:
0.000
AAE1-3

UniProt

c.722G>A p.Arg241Lys missense variant moderate contig976 1083132

IGV: Start, Jump

C/T
NGS:
0.070
C90:
0.000
AAE1-3

UniProt

c.659G>A p.Arg220Gln missense variant moderate contig976 1083195

IGV: Start, Jump

C/T
NGS:
0.077
C90:
0.000
AAE1-3

UniProt

c.634G>C p.Gly212Arg missense variant moderate contig976 1083220

IGV: Start, Jump

C/G
NGS:
0.116
C90:
0.000
AAE1-3

UniProt

c.199A>G p.Asn67Asp missense variant moderate contig976 1083876

IGV: Start, Jump

T/C
NGS:
0.079
C90:
0.000
AAE1-3

UniProt

c.188A>G p.Asn63Ser missense variant moderate contig976 1083887

IGV: Start, Jump

T/C
NGS:
0.077
C90:
0.000
FAD7A-1

UniProt

c.*341_*343-7delATATATATATATATATAG splice donor variant & splice region variant & 3 prime UTR variant & intron variant high contig510 71468

IGV: Start, Jump

TATATATATATATATATAG/T
NGS:
0.013
C90:
0.000
PIE1-1

UniProt

c.1222C>G p.Gln408Glu missense variant moderate contig1225 2281482

IGV: Start, Jump

C/G
NGS:
0.096
C90:
0.852
PIE1-1

UniProt

c.3619G>A p.Val1207Met missense variant moderate contig1225 2285234

IGV: Start, Jump

G/A
NGS:
0.042
C90:
0.000
GGR

UniProt

c.317C>T p.Pro106Leu missense variant moderate contig2282 549309

IGV: Start, Jump

C/T
NGS:
0.035
C90:
0.220
GGR

UniProt

c.376G>C p.Glu126Gln missense variant moderate contig2282 549368

IGV: Start, Jump

G/C
NGS:
0.015
C90:
0.110
GGR

UniProt

c.382C>T p.Leu128Phe missense variant moderate contig2282 549374

IGV: Start, Jump

C/T
NGS:
0.024
C90:
0.000
GGR

UniProt

c.456T>A p.His152Gln missense variant moderate contig2282 549448

IGV: Start, Jump

T/A
NGS:
0.068
C90:
0.000
GGR

UniProt

c.460G>A p.Asp154Asn missense variant moderate contig2282 549452

IGV: Start, Jump

G/A
NGS:
0.070
C90:
0.000
GGR

UniProt

c.514A>T p.Ile172Phe missense variant moderate contig2282 549506

IGV: Start, Jump

A/T
NGS:
0.004
C90:
0.000
GGR

UniProt

c.581C>T p.Ala194Val missense variant moderate contig2282 549573

IGV: Start, Jump

C/T
NGS:
0.015
C90:
0.105
GGR

UniProt

c.704A>T p.His235Leu missense variant moderate contig2282 549696

IGV: Start, Jump

A/T
NGS:
0.121
C90:
0.000
GGR

UniProt

c.746G>A p.Gly249Glu missense variant moderate contig2282 549738

IGV: Start, Jump

G/A
NGS:
0.002
C90:
0.000
GGR

UniProt

c.810A>C p.Glu270Asp missense variant moderate contig2282 549802

IGV: Start, Jump

A/C
NGS:
0.007
C90:
0.000
GGR

UniProt

c.826A>G p.Arg276Gly missense variant moderate contig2282 549818

IGV: Start, Jump

A/G
NGS:
0.002
C90:
0.000
PKSB-3

UniProt

c.188A>T p.Tyr63Phe missense variant moderate contig93 3333945

IGV: Start, Jump

A/T
NGS:
0.002
C90:
0.000
PKSB-3

UniProt

c.1652A>G p.Glu551Gly missense variant moderate contig93 3339759

IGV: Start, Jump

A/G
NGS:
0.088
C90:
0.000
PKSB-3

UniProt

c.1880_1891delATGGCCATGGCC p.His627_Gly630del disruptive inframe deletion moderate contig93 3339981

IGV: Start, Jump

CTGGCCATGGCCA/C
NGS:
0.004
C90:
0.000
PKSB-3

UniProt

c.1901C>G p.Ala634Gly missense variant moderate contig93 3340008

IGV: Start, Jump

C/G
NGS:
0.059
C90:
0.000

Nearest genetic relatives (All Samples)

0 0.067 0.133 0.200 0.267
clone distance sibling distance more distant
  1. 0.229 Fedora 17 (RSP11203)
  2. 0.231 Feral (RSP10890)
  3. 0.234 Feral (RSP10892)
  4. 0.236 Feral (RSP11205)
  5. 0.239 Tiborszallasie (RSP11210)
  6. 0.241 Carmagnola USO 31 (RSP11204)
  7. 0.242 Carmagnola (RSP11039)
  8. 0.242 Santhica 27 (RSP10665)
  9. 0.242 Feral (RSP10891)
  10. 0.243 Carmagnola (RSP10982)
  11. 0.243 Tisza (RSP11045)
  12. 0.243 Carmagnola (RSP10977)
  13. 0.244 Carmagnola (RSP11037)
  14. 0.245 Carmagnola (RSP10980)
  15. 0.245 Futura 75 (RSP10664)
  16. 0.246 CS (RSP11208)
  17. 0.246 Lovrin (RSP10658)
  18. 0.247 Eletta Campana (RSP11209)
  19. 0.249 Tisza (RSP11044)
  20. 0.251 Carmagnola (RSP11202)

Nearest genetic relatives (Base Tree)

0 0.092 0.183 0.275 0.367
clone distance sibling distance more distant
  1. 0.233 Feral (RSP10890)
  2. 0.241 Futura 75 (RSP10664)
  3. 0.245 Tisza (RSP11044)
  4. 0.247 Fedora 17 (RSP10661)
  5. 0.249 Carmagnola (RSP11037)
  6. 0.252 Lovrin (RSP10658)
  7. 0.254 Tisza (RSP10659)
  8. 0.265 USO 31 (RSP10981)
  9. 0.265 Santhica27 (RSP11047)
  10. 0.267 Monoica (RSP10241)
  11. 0.267 Carmagnola (RSP10979)
  12. 0.268 Ivory (RSP10668)
  13. 0.271 Tygra (RSP10667)
  14. 0.282 Kyrgyz Gold (RSP11054)
  15. 0.292 KYRG-11 (RSP11051)
  16. 0.304 Jiangji (RSP10653)
  17. 0.315 RKM-2018-029 (RSP11121)
  18. 0.323 Recon (RSP10755)
  19. 0.325 Kimbo Slice (RSP10997)
  20. 0.339 The Gift (RSP10988)

Most genetically distant strains (All Samples)

0 0.125 0.250 0.375 0.500
clone distance sibling distance more distant
  1. 0.483 Cherry Blossom (RSP11323)
  2. 0.457 Cherry Blossom (RSP11318)
  3. 0.453 Cherry Blossom (RSP11301)
  4. 0.452 Unknown- Cherry Wine - 001 (RSP11268)
  5. 0.447 JL yellow (RSP11075)
  6. 0.446 JL 3rd Gen Mother (RSP11197)
  7. 0.445 JL 3rd Gen Mother (RSP11214)
  8. 0.443 Cherry Blossom (RSP11328)
  9. 0.441 Cherry Blossom (RSP11298)
  10. 0.441 Unknown- Cherry Wine - 002 (RSP11269)
  11. 0.438 Cherry Blossom (RSP11300)
  12. 0.436 Cherry Blossom (RSP11321)
  13. 0.434 Cherry Blossom (RSP11334)
  14. 0.434 Unknown- Cherry Wine - 003 (RSP11270)
  15. 0.433 Cherry Blossom (RSP11325)
  16. 0.430 Queen Dream (RSP11278)
  17. 0.426 Cherry Blossom (RSP11312)
  18. 0.426 AVIDEKEL 2 0 (RSP11174)
  19. 0.425 Wife (RSP11148)
  20. 0.424 Queen Dream CBG (RSP11284)

Most genetically distant strains (Base Tree)

0 0.117 0.233 0.350 0.467
clone distance sibling distance more distant
  1. 0.436 JL yellow (RSP11075)
  2. 0.421 Cbot-2019-005 (RSP11133)
  3. 0.406 Cbot-2019-004 (RSP11132)
  4. 0.405 UP Sunrise (RSP10989)
  5. 0.403 RKM-2018-006 (RSP11097)
  6. 0.402 RKM-2018-002 (RSP11093)
  7. 0.402 Skunk 18 (RSP11038)
  8. 0.397 RKM-2018-028 (RSP11120)
  9. 0.389 RKM-2018-023 (RSP11115)
  10. 0.388 RKM-2018-018 (RSP11110)
  11. 0.386 RKM-2018-027 (RSP11119)
  12. 0.386 Cbot-2019-001 (RSP11129)
  13. 0.384 RKM-2018-003 (RSP11094)
  14. 0.383 Hermaphrodite Research Sample1 (RSP11049)
  15. 0.381 RKM-2018-009 (RSP11100)
  16. 0.381 Kush Hemp E1 (RSP11128)
  17. 0.380 Hermaphrodite ResearchSample2 (RSP11050)
  18. 0.380 RKM-2018-033 (RSP11125)
  19. 0.380 Sour Raspberry (RSP10551)
  20. 0.379 Italian Kiss (RSP11034)

Nearest genetic relative in Phylos dataset

Phylos Strain SRR4450138
Overlapping SNPs:
9
Concordance:
6

Nearest genetic relative in Lynch dataset

Lynch Strain SRR3495319
Overlapping SNPs:
12
Concordance:
9

Blockchain Registration Information

Transaction ID
a54b7c1f586d05616a66abaeef3e0d60737ed6766c3dff2ff1edf5be2ddd9c32
Stamping Certificate
Download PDF (853.6 KB)
SHASUM Hash
992243bd5792d18d9a9dd956bb1bad1bd2adf03be7291bc841d2d5f01a9909c5
QR code for RSP11206

Kannapedia uses cookies

By clicking Allow All, you agree to the storing of cookies on your device to enhance site navigation, analyze site usage, and assist in our marketing efforts.

Customize Settings