Tiborszallasie

RSP 11210

Grower: John McKay-Colorado State University

General Information

Sample Name
Tibor_1_2016_CSU
Accession Date
June 26, 2019
Reported Plant Sex
not reported

The strain rarity visualization shows how distant the strain is from the other cultivars in the Kannapedia database. The y-axis represents genetic distance, getting farther as you go up. The width of the visualization at any position along the y-axis shows how many strains there are in the database at that genetic distance. So, a common strain will have a more bottom-heavy shape, while uncommon and rare cultivars will have a visualization that is generally shifted towards the top.

Rarity: Rare
Most Distant Most Similar

Chemical Information

Cannabinoid and terpenoid information provided by the grower.

Cannabinoids

No information provided.

Terpenoids

No information provided.

Genetic Information

Plant Type
Type II

The bell curve in the heterozygosity visualization shows the distribution of heterozygosity levels for cannabis cultivars in the Kannapedia database. The green line shows where this particular strain fits within the distribution. Heterozygosity is associated with heterosis (aka hybrid vigor) but also leads to the production of more variable offspring. When plants have two genetically different parents, heterozygosity levels will be higher than if it has been inbred or backcrossed repeatedly.

Heterozygosity: 2.23%
Least Heterozygous Most Heterozygous

This chart represents the Illumina sequence coverage over the Bt/Bd allele. These are the three regions in the cannabis genome that impact THCA, CBDA, CBGA production. Coverage over the Active CBDAS gene is highly correlated with Type II and Type III plants as described by Etienne de Meijer. Coverage over the THCA gene is highly correlated with Type I and Type II plants but is anti-correlated with Type III plants. Type I plants require coverage over the inactive CBDA loci and no coverage over the Active CBDA gene. Lack of coverage over the Active CBDA and Active THCA allele are presumed to be Type IV plants (CBGA dominant). While deletions of entire THCAS and CBDAS genes are the most common Bt:Bd alleles observed, it is possible to have plants with these genes where functional expression of the enzyme is disrupted by deactivating point mutations (Kojoma et al. 2006).

Bt/Bd Allele Coverage

This chart represents the Illumina sequence coverage over the CBCA synthase gene.

CBCAS Coverage

Variants (THCAS, CBDAS, and CBCAS)

CBDAS c.8G>A p.Cys3Tyr missense variant moderate contig1772 2082234

IGV: Start, Jump

G/A
NGS:
0.057
C90:
0.000
CBDAS c.221C>G p.Thr74Ser missense variant moderate contig1772 2082447

IGV: Start, Jump

C/G
NGS:
0.136
C90:
0.057
CBDAS c.503A>G p.Asn168Ser missense variant moderate contig1772 2082729

IGV: Start, Jump

A/G
NGS:
0.024
C90:
0.062
CBDAS c.587A>G p.Asn196Ser missense variant moderate contig1772 2082813

IGV: Start, Jump

A/G
NGS:
0.011
C90:
0.435
CBDAS c.1420A>C p.Lys474Gln missense variant moderate contig1772 2083646

IGV: Start, Jump

A/C
NGS:
0.132
C90:
0.813
CBDAS c.1628G>A p.Arg543His missense variant moderate contig1772 2083854

IGV: Start, Jump

G/A
NGS:
0.033
C90:
0.000
THCAS c.1625C>T p.Pro542Leu missense variant moderate contig741 4416203

IGV: Start, Jump

G/A
NGS:
0.018
C90:
0.000
THCAS c.187A>C p.Ile63Leu missense variant moderate contig741 4417641

IGV: Start, Jump

T/G
NGS:
0.059
C90:
0.679

Variants (Select Genes of Interest)

GPPs1

UniProt

c.744C>G p.Asp248Glu missense variant moderate contig676 168993

IGV: Start, Jump

C/G
NGS:
0.022
C90:
0.000
GPPs1

UniProt

c.845_848delAAAG p.Glu282fs frameshift variant high contig676 169629

IGV: Start, Jump

TGAAA/T
NGS:
0.118
C90:
0.000
GPPs1

UniProt

c.896A>G p.Asn299Ser missense variant moderate contig676 169772

IGV: Start, Jump

A/G
NGS:
0.046
C90:
0.000
EMF1-2

UniProt

c.710A>C p.His237Pro missense variant moderate contig885 810

IGV: Start, Jump

A/C
NGS:
0.090
C90:
0.474
PHL-2 c.73C>T p.Arg25Cys missense variant moderate contig2621 337642

IGV: Start, Jump

C/T
NGS:
0.002
C90:
0.000
PHL-2 c.455A>C p.Asp152Ala missense variant moderate contig2621 339191

IGV: Start, Jump

A/C
NGS:
0.018
C90:
0.507
PHL-2 c.977A>C p.His326Pro missense variant moderate contig2621 340255

IGV: Start, Jump

A/C
NGS:
0.007
C90:
0.000
PHL-2 c.1837G>A p.Glu613Lys missense variant moderate contig2621 341115

IGV: Start, Jump

G/A
NGS:
0.009
C90:
0.000
PHL-2 c.2564T>A p.Phe855Tyr missense variant moderate contig2621 342607

IGV: Start, Jump

T/A
NGS:
0.064
C90:
0.732
PHL-2 c.2578T>A p.Leu860Ile missense variant moderate contig2621 342621

IGV: Start, Jump

T/A
NGS:
0.068
C90:
0.746
PHL-2 c.2783G>A p.Ser928Asn missense variant moderate contig2621 342826

IGV: Start, Jump

G/A
NGS:
0.107
C90:
0.890
PHL-2 c.2830A>C p.Asn944His missense variant moderate contig2621 342873

IGV: Start, Jump

A/C
NGS:
0.044
C90:
0.000
PHL-2 c.2933G>T p.Arg978Leu missense variant moderate contig2621 342976

IGV: Start, Jump

G/T
NGS:
0.048
C90:
0.297
PHL-2 c.2936T>G p.Val979Gly missense variant moderate contig2621 342979

IGV: Start, Jump

T/G
NGS:
0.048
C90:
0.000
PHL-2 c.3209A>G p.Gln1070Arg missense variant moderate contig2621 343252

IGV: Start, Jump

A/G
NGS:
0.103
C90:
0.885
PHL-2 c.3467A>G p.Gln1156Arg missense variant moderate contig2621 343510

IGV: Start, Jump

A/G
NGS:
0.064
C90:
0.713
PKSG-2a

UniProt

c.774G>A p.Met258Ile missense variant moderate contig700 1944616

IGV: Start, Jump

C/T
NGS:
0.123
C90:
0.000
PKSG-2a

UniProt

c.67T>A p.Phe23Ile missense variant moderate contig700 1945567

IGV: Start, Jump

A/T
NGS:
0.825
C90:
0.904
PKSG-2a

UniProt

c.31A>T p.Thr11Ser missense variant moderate contig700 1945603

IGV: Start, Jump

T/A
NGS:
0.763
C90:
0.876
PKSG-2b

UniProt

c.1152T>A p.Asn384Lys missense variant moderate contig700 1950486

IGV: Start, Jump

A/T
NGS:
0.715
C90:
0.895
PKSG-2b

UniProt

c.1132C>G p.Leu378Val missense variant moderate contig700 1950506

IGV: Start, Jump

G/C
NGS:
0.717
C90:
0.000
PKSG-2b

UniProt

c.1117A>G p.Ile373Val missense variant moderate contig700 1950521

IGV: Start, Jump

T/C
NGS:
0.807
C90:
0.981
PKSG-2b

UniProt

c.774G>A p.Met258Ile missense variant moderate contig700 1950864

IGV: Start, Jump

C/T
NGS:
0.366
C90:
0.947
PKSG-2b

UniProt

c.31A>T p.Thr11Ser missense variant moderate contig700 1951851

IGV: Start, Jump

T/A
NGS:
0.844
C90:
0.880
PKSG-4b

UniProt

c.558-1G>A splice acceptor variant & intron variant high contig700 2715037

IGV: Start, Jump

C/T
NGS:
0.009
C90:
0.000
PKSG-4b

UniProt

c.353_354insCC p.Gly119fs frameshift variant high contig700 2721319

IGV: Start, Jump

T/TGG
NGS:
0.175
C90:
0.000
PKSG-4b

UniProt

c.324A>C p.Glu108Asp missense variant moderate contig700 2721349

IGV: Start, Jump

T/G
NGS:
0.094
C90:
0.000
PKSG-4b

UniProt

c.323A>G p.Glu108Gly missense variant moderate contig700 2721350

IGV: Start, Jump

T/C
NGS:
0.469
C90:
0.000
PKSG-4b

UniProt

c.316+2T>A splice donor variant & intron variant high contig700 2723818

IGV: Start, Jump

A/T
NGS:
0.070
C90:
0.689
PKSG-4b

UniProt

c.229G>A p.Gly77Ser missense variant moderate contig700 2724206

IGV: Start, Jump

C/T
NGS:
0.042
C90:
0.000
PKSG-4b

UniProt

c.216G>C p.Leu72Phe missense variant moderate contig700 2724219

IGV: Start, Jump

C/G
NGS:
0.044
C90:
0.000
PKSG-4b

UniProt

c.206T>C p.Leu69Ser missense variant moderate contig700 2724229

IGV: Start, Jump

A/G
NGS:
0.044
C90:
0.000
DXR-2

UniProt

c.1319T>C p.Ile440Thr missense variant moderate contig380 285250

IGV: Start, Jump

A/G
NGS:
0.480
C90:
0.000
OAC-2

UniProt

c.260C>G p.Ser87Cys missense variant moderate contig931 109979

IGV: Start, Jump

G/C
NGS:
0.070
C90:
0.000
OAC-2

UniProt

c.220A>G p.Ile74Val missense variant moderate contig931 110019

IGV: Start, Jump

T/C
NGS:
0.011
C90:
0.670
OAC-1

UniProt

c.260C>G p.Ser87Cys missense variant moderate contig931 118104

IGV: Start, Jump

G/C
NGS:
0.053
C90:
0.000
OAC-1

UniProt

c.220A>G p.Ile74Val missense variant moderate contig931 118144

IGV: Start, Jump

T/C
NGS:
0.033
C90:
0.670
OAC-1

UniProt

c.185C>T p.Thr62Ile missense variant moderate contig931 118179

IGV: Start, Jump

G/A
NGS:
0.039
C90:
0.000
OAC-1

UniProt

c.175G>A p.Val59Ile missense variant moderate contig931 118189

IGV: Start, Jump

C/T
NGS:
0.026
C90:
0.000
ELF3

UniProt

c.574A>G p.Asn192Asp missense variant moderate contig97 242280

IGV: Start, Jump

A/G
NGS:
0.042
C90:
0.579
ELF3

UniProt

c.757C>T p.Pro253Ser missense variant moderate contig97 242463

IGV: Start, Jump

C/T
NGS:
0.020
C90:
0.048
ELF3

UniProt

c.772A>G p.Ser258Gly missense variant moderate contig97 242478

IGV: Start, Jump

A/G
NGS:
0.112
C90:
0.000
ELF3

UniProt

c.812G>C p.Gly271Ala missense variant moderate contig97 242518

IGV: Start, Jump

G/C
NGS:
0.114
C90:
0.938
ELF3

UniProt

c.1229+2T>C splice donor variant & intron variant high contig97 243389

IGV: Start, Jump

T/C
NGS:
0.011
C90:
0.000
ELF3

UniProt

c.1466G>A p.Ser489Asn missense variant moderate contig97 244297

IGV: Start, Jump

G/A
NGS:
0.123
C90:
0.000
ELF3

UniProt

c.1966C>G p.Pro656Ala missense variant moderate contig97 244797

IGV: Start, Jump

C/G
NGS:
0.123
C90:
0.632
ELF3

UniProt

c.2140C>T p.Pro714Ser missense variant moderate contig97 244971

IGV: Start, Jump

C/T
NGS:
0.018
C90:
0.038
ELF3

UniProt

c.2141C>G p.Pro714Arg missense variant moderate contig97 244972

IGV: Start, Jump

C/G
NGS:
0.088
C90:
0.335
ELF3

UniProt

c.2198G>T p.Arg733Leu missense variant moderate contig97 245029

IGV: Start, Jump

G/T
NGS:
0.125
C90:
0.531
ELF3

UniProt

c.2212_2217dupCACCAT p.His738_His739dup conservative inframe insertion moderate contig97 245033

IGV: Start, Jump

T/TCATCAC
NGS:
0.002
C90:
0.000
aPT4

UniProt

c.80A>G p.Lys27Arg missense variant moderate contig121 2828736

IGV: Start, Jump

A/G
NGS:
0.061
C90:
0.000
aPT4

UniProt

c.97T>C p.Tyr33His missense variant moderate contig121 2828753

IGV: Start, Jump

T/C
NGS:
0.439
C90:
0.000
aPT4

UniProt

c.153A>C p.Lys51Asn missense variant moderate contig121 2828809

IGV: Start, Jump

A/C
NGS:
0.375
C90:
0.000
aPT4

UniProt

c.198A>C p.Lys66Asn missense variant moderate contig121 2828854

IGV: Start, Jump

A/C
NGS:
0.044
C90:
0.000
aPT4

UniProt

c.202T>A p.Leu68Ile missense variant moderate contig121 2828858

IGV: Start, Jump

T/A
NGS:
0.068
C90:
0.000
aPT4

UniProt

c.235_236delGT p.Val79fs frameshift variant high contig121 2829030

IGV: Start, Jump

ATG/A
NGS:
0.417
C90:
0.000
aPT4

UniProt

c.238delT p.Ser80fs frameshift variant high contig121 2829034

IGV: Start, Jump

AT/A
NGS:
0.421
C90:
0.000
aPT4

UniProt

c.916C>T p.His306Tyr missense variant & splice region variant moderate contig121 2832711

IGV: Start, Jump

C/T
NGS:
0.015
C90:
0.000
aPT4

UniProt

c.1168T>C p.Tyr390His missense variant moderate contig121 2833503

IGV: Start, Jump

T/C
NGS:
0.546
C90:
0.000
aPT1

UniProt

c.95_97delGTT p.Cys32del disruptive inframe deletion moderate contig121 2835800

IGV: Start, Jump

ATGT/A
NGS:
0.118
C90:
0.311
aPT1

UniProt

c.160A>C p.Thr54Pro missense variant moderate contig121 2835867

IGV: Start, Jump

A/C
NGS:
0.086
C90:
0.048
aPT1

UniProt

c.406A>G p.Ile136Val missense variant moderate contig121 2839605

IGV: Start, Jump

A/G
NGS:
0.579
C90:
0.761
aPT1

UniProt

c.670T>A p.Ser224Thr missense variant moderate contig121 2840278

IGV: Start, Jump

T/A
NGS:
0.077
C90:
0.000
aPT1

UniProt

c.727G>T p.Glu243* stop gained high contig121 2841362

IGV: Start, Jump

G/T
NGS:
0.127
C90:
0.100
aPT1

UniProt

c.864C>G p.Asn288Lys missense variant moderate contig121 2842407

IGV: Start, Jump

C/G
NGS:
0.075
C90:
0.062
AAE1-2

UniProt

c.205T>A p.Ser69Thr missense variant moderate contig81 209167

IGV: Start, Jump

T/A
NGS:
0.013
C90:
0.000
AAE1-2

UniProt

c.331A>G p.Asn111Asp missense variant moderate contig81 209293

IGV: Start, Jump

A/G
NGS:
0.123
C90:
0.000
AAE1-2

UniProt

c.1006A>G p.Lys336Glu missense variant moderate contig81 209968

IGV: Start, Jump

A/G
NGS:
0.116
C90:
0.000
AAE1-2

UniProt

c.1415G>A p.Ser472Asn missense variant moderate contig81 210377

IGV: Start, Jump

G/A
NGS:
0.070
C90:
0.000
AAE1-2

UniProt

c.1417A>G p.Thr473Ala missense variant moderate contig81 210379

IGV: Start, Jump

A/G
NGS:
0.070
C90:
0.000
AAE1-2

UniProt

c.1434G>T p.Glu478Asp missense variant moderate contig81 210396

IGV: Start, Jump

G/T
NGS:
0.075
C90:
0.000
AAE1-2

UniProt

c.1541T>C p.Val514Ala missense variant moderate contig81 210503

IGV: Start, Jump

T/C
NGS:
0.050
C90:
0.000
PHL-1

UniProt

c.2623A>G p.Thr875Ala missense variant moderate contig1439 1487174

IGV: Start, Jump

T/C
NGS:
0.123
C90:
0.000
PHL-1

UniProt

c.2551A>G p.Thr851Ala missense variant moderate contig1439 1487246

IGV: Start, Jump

T/C
NGS:
0.116
C90:
0.890
PHL-1

UniProt

c.1387A>G p.Thr463Ala missense variant moderate contig1439 1489811

IGV: Start, Jump

T/C
NGS:
0.107
C90:
0.904
TFL1

UniProt

c.302-1G>A splice acceptor variant & intron variant high contig1636 520616

IGV: Start, Jump

C/T
NGS:
0.103
C90:
0.794
HDS-1

UniProt

c.1618A>G p.Ile540Val missense variant moderate contig1891 885936

IGV: Start, Jump

T/C
NGS:
0.099
C90:
0.861
HDS-1

UniProt

c.1378G>A p.Val460Ile missense variant moderate contig1891 886370

IGV: Start, Jump

C/T
NGS:
0.167
C90:
0.000
HDS-1

UniProt

c.-108+1_-108+2insG splice donor variant & intron variant high contig1891 889975

IGV: Start, Jump

A/AC
NGS:
0.217
C90:
0.000
FAD2

UniProt

c.124C>A p.Pro42Thr missense variant moderate contig1460 1084136

IGV: Start, Jump

G/T
NGS:
0.007
C90:
0.000
PIE1-2

UniProt

c.6653A>G p.Asn2218Ser missense variant moderate contig1460 1184434

IGV: Start, Jump

T/C
NGS:
0.059
C90:
0.928
PIE1-2

UniProt

c.5932A>G p.Ile1978Val missense variant moderate contig1460 1185552

IGV: Start, Jump

T/C
NGS:
0.061
C90:
0.268
PIE1-2

UniProt

c.5884G>A p.Gly1962Ser missense variant moderate contig1460 1185715

IGV: Start, Jump

C/T
NGS:
0.004
C90:
0.019
PIE1-2

UniProt

c.3554G>A p.Arg1185Lys missense variant moderate contig1460 1188486

IGV: Start, Jump

C/T
NGS:
0.002
C90:
0.014
PIE1-2

UniProt

c.3506A>C p.Glu1169Ala missense variant moderate contig1460 1188534

IGV: Start, Jump

T/G
NGS:
0.004
C90:
0.014
PIE1-2

UniProt

c.3505G>A p.Glu1169Lys missense variant moderate contig1460 1188535

IGV: Start, Jump

C/T
NGS:
0.004
C90:
0.000
PIE1-2

UniProt

c.2083_2085delGTC p.Val695del conservative inframe deletion moderate contig1460 1189954

IGV: Start, Jump

GGAC/G
NGS:
0.046
C90:
0.880
PIE1-2

UniProt

c.2072A>G p.His691Arg missense variant moderate contig1460 1189968

IGV: Start, Jump

T/C
NGS:
0.046
C90:
0.789
PIE1-2

UniProt

c.2027A>T p.Gln676Leu missense variant moderate contig1460 1190013

IGV: Start, Jump

T/A
NGS:
0.004
C90:
0.014
PIE1-2

UniProt

c.1872T>A p.Asp624Glu missense variant moderate contig1460 1190252

IGV: Start, Jump

A/T
NGS:
0.086
C90:
0.990
PIE1-2

UniProt

c.1846A>G p.Lys616Glu missense variant moderate contig1460 1190278

IGV: Start, Jump

T/C
NGS:
0.002
C90:
0.000
PIE1-2

UniProt

c.1656T>G p.Asn552Lys missense variant moderate contig1460 1191574

IGV: Start, Jump

A/C
NGS:
0.009
C90:
0.043
PIE1-2

UniProt

c.1630G>C p.Ala544Pro missense variant moderate contig1460 1191600

IGV: Start, Jump

C/G
NGS:
0.070
C90:
0.933
PIE1-2

UniProt

c.1289A>G p.Asp430Gly missense variant moderate contig1460 1192109

IGV: Start, Jump

T/C
NGS:
0.079
C90:
0.000
PIE1-2

UniProt

c.1156T>G p.Trp386Gly missense variant moderate contig1460 1192242

IGV: Start, Jump

A/C
NGS:
0.009
C90:
0.976
PIE1-2

UniProt

c.1019_1048dupATGTGGGTGAACCAACCCAGATGGAGGATA p.Asn340_Asp349dup conservative inframe insertion moderate contig1460 1192349

IGV: Start, Jump

C/CTATCCTCCATCTGGGTTGGTTCACCCACAT
NGS:
0.009
C90:
0.000
PIE1-2

UniProt

c.982G>A p.Glu328Lys missense variant moderate contig1460 1192416

IGV: Start, Jump

C/T
NGS:
0.050
C90:
0.976
PIE1-2

UniProt

c.710C>T p.Pro237Leu missense variant moderate contig1460 1193804

IGV: Start, Jump

G/A
NGS:
0.072
C90:
0.866
PIE1-2

UniProt

c.706T>C p.Tyr236His missense variant moderate contig1460 1193808

IGV: Start, Jump

A/G
NGS:
0.059
C90:
0.737
PIE1-2

UniProt

c.637T>A p.Ser213Thr missense variant moderate contig1460 1194421

IGV: Start, Jump

A/T
NGS:
0.079
C90:
0.885
EMF2

UniProt

c.434C>T p.Ser145Phe missense variant moderate contig954 3049270

IGV: Start, Jump

C/T
NGS:
0.018
C90:
0.057
EMF2

UniProt

c.1772A>G p.Gln591Arg missense variant moderate contig954 3059929

IGV: Start, Jump

A/G
NGS:
0.092
C90:
0.876
EMF1-1

UniProt

c.627_629dupTGT p.Val210dup disruptive inframe insertion moderate contig883 270231

IGV: Start, Jump

A/ATGT
NGS:
0.007
C90:
0.000
FT

UniProt

c.38_43dupATAATA p.Asn13_Asn14dup disruptive inframe insertion moderate contig1561 3124441

IGV: Start, Jump

T/TTAATAA
NGS:
0.004
C90:
0.000
FT

UniProt

c.35_43dupATAATAATA p.Asn12_Asn14dup disruptive inframe insertion moderate contig1561 3124441

IGV: Start, Jump

T/TTAATAATAA
NGS:
0.048
C90:
0.000
FT

UniProt

c.240C>G p.Asn80Lys missense variant moderate contig1561 3124664

IGV: Start, Jump

C/G
NGS:
0.075
C90:
0.000
FT

UniProt

c.259+1_259+2insTA splice donor variant & intron variant high contig1561 3124684

IGV: Start, Jump

G/GTA
NGS:
0.015
C90:
0.077
AAE1-3

UniProt

c.634G>C p.Gly212Arg missense variant moderate contig976 1083220

IGV: Start, Jump

C/G
NGS:
0.116
C90:
0.000
AAE1-3

UniProt

c.416T>C p.Leu139Pro missense variant moderate contig976 1083609

IGV: Start, Jump

A/G
NGS:
0.061
C90:
0.000
AAE1-3

UniProt

c.382T>C p.Tyr128His missense variant moderate contig976 1083643

IGV: Start, Jump

A/G
NGS:
0.072
C90:
0.000
AAE1-3

UniProt

c.327G>A p.Trp109* stop gained high contig976 1083698

IGV: Start, Jump

C/T
NGS:
0.004
C90:
0.000
AAE1-3

UniProt

c.293A>G p.Asp98Gly missense variant moderate contig976 1083732

IGV: Start, Jump

T/C
NGS:
0.068
C90:
0.000
AAE1-3

UniProt

c.287C>T p.Thr96Ile missense variant moderate contig976 1083738

IGV: Start, Jump

G/A
NGS:
0.002
C90:
0.000
AAE1-3

UniProt

c.215A>T p.Glu72Val missense variant moderate contig976 1083860

IGV: Start, Jump

T/A
NGS:
0.004
C90:
0.000
AAE1-3

UniProt

c.167A>G p.Glu56Gly missense variant moderate contig976 1083908

IGV: Start, Jump

T/C
NGS:
0.070
C90:
0.000
AAE1-3

UniProt

c.141A>G p.Ile47Met missense variant moderate contig976 1083934

IGV: Start, Jump

T/C
NGS:
0.004
C90:
0.000
AAE1-3

UniProt

c.125A>G p.Glu42Gly missense variant moderate contig976 1083950

IGV: Start, Jump

T/C
NGS:
0.064
C90:
0.000
AAE1-3

UniProt

c.79A>G p.Thr27Ala missense variant moderate contig976 1083996

IGV: Start, Jump

T/C
NGS:
0.068
C90:
0.000
AAE1-3

UniProt

c.52G>A p.Gly18Ser missense variant moderate contig976 1084023

IGV: Start, Jump

C/T
NGS:
0.064
C90:
0.000
PIE1-1

UniProt

c.773A>G p.Asn258Ser missense variant & splice region variant moderate contig1225 2279897

IGV: Start, Jump

A/G
NGS:
0.033
C90:
0.895
PIE1-1

UniProt

c.1222C>G p.Gln408Glu missense variant moderate contig1225 2281482

IGV: Start, Jump

C/G
NGS:
0.096
C90:
0.852
PIE1-1

UniProt

c.1758T>G p.Asn586Lys missense variant moderate contig1225 2282186

IGV: Start, Jump

T/G
NGS:
0.007
C90:
0.043
PIE1-1

UniProt

c.3607G>A p.Glu1203Lys missense variant moderate contig1225 2285222

IGV: Start, Jump

G/A
NGS:
0.004
C90:
0.000
PIE1-1

UniProt

c.3608A>C p.Glu1203Ala missense variant moderate contig1225 2285223

IGV: Start, Jump

A/C
NGS:
0.004
C90:
0.014
PIE1-1

UniProt

c.3619G>A p.Val1207Met missense variant moderate contig1225 2285234

IGV: Start, Jump

G/A
NGS:
0.042
C90:
0.000
PIE1-1

UniProt

c.3656G>A p.Arg1219Lys missense variant moderate contig1225 2285271

IGV: Start, Jump

G/A
NGS:
0.004
C90:
0.014
GGR

UniProt

c.32C>A p.Thr11Lys missense variant moderate contig2282 549024

IGV: Start, Jump

C/A
NGS:
0.009
C90:
0.000
GGR

UniProt

c.317C>T p.Pro106Leu missense variant moderate contig2282 549309

IGV: Start, Jump

C/T
NGS:
0.035
C90:
0.220
GGR

UniProt

c.358_359delGC p.Ala120fs frameshift variant high contig2282 549348

IGV: Start, Jump

ACG/A
NGS:
0.009
C90:
0.000
GGR

UniProt

c.382C>T p.Leu128Phe missense variant moderate contig2282 549374

IGV: Start, Jump

C/T
NGS:
0.024
C90:
0.000
GGR

UniProt

c.541G>A p.Val181Ile missense variant moderate contig2282 549533

IGV: Start, Jump

G/A
NGS:
0.009
C90:
0.000
GGR

UniProt

c.704A>T p.His235Leu missense variant moderate contig2282 549696

IGV: Start, Jump

A/T
NGS:
0.121
C90:
0.000
PKSB-3

UniProt

c.721G>A p.Ala241Thr missense variant moderate contig93 3337039

IGV: Start, Jump

G/A
NGS:
0.002
C90:
0.000

Nearest genetic relatives (All Samples)

0 0.067 0.133 0.200 0.267
clone distance sibling distance more distant
  1. 0.203 Tisza (RSP11045)
  2. 0.205 Tisza (RSP11044)
  3. 0.207 Tisza (RSP10659)
  4. 0.220 Carmagnola USO 31 (RSP11204)
  5. 0.221 Fedora 17 (RSP11203)
  6. 0.225 Santhica 27 (RSP10665)
  7. 0.225 Carmagnola (RSP11202)
  8. 0.229 Carmagnola (RSP10978)
  9. 0.232 Futura 75 (RSP10664)
  10. 0.232 Carmagnola (RSP10980)
  11. 0.234 Fedora 17 (RSP10661)
  12. 0.235 Carmagnola (RSP10982)
  13. 0.237 Carmagnola (RSP11039)
  14. 0.238 Lovrin (RSP10658)
  15. 0.238 Carmagnola (RSP11037)
  16. 0.238 Carmagnola (RSP10979)
  17. 0.239 Feral (RSP11206)
  18. 0.240 Carmagnola (RSP10976)
  19. 0.241 Santhica27 (RSP11047)
  20. 0.242 Eletta Campana (RSP11209)

Nearest genetic relatives (Base Tree)

0 0.092 0.183 0.275 0.367
clone distance sibling distance more distant
  1. 0.199 Tisza (RSP11044)
  2. 0.201 Tisza (RSP10659)
  3. 0.232 Carmagnola (RSP10979)
  4. 0.232 Futura 75 (RSP10664)
  5. 0.235 Santhica27 (RSP11047)
  6. 0.236 Carmagnola (RSP11037)
  7. 0.237 Fedora 17 (RSP10661)
  8. 0.240 Tygra (RSP10667)
  9. 0.243 Lovrin (RSP10658)
  10. 0.245 Feral (RSP10890)
  11. 0.250 Ivory (RSP10668)
  12. 0.253 Monoica (RSP10241)
  13. 0.260 USO 31 (RSP10981)
  14. 0.263 Kyrgyz Gold (RSP11054)
  15. 0.278 KYRG-11 (RSP11051)
  16. 0.299 Jiangji (RSP10653)
  17. 0.311 Kimbo Slice (RSP10997)
  18. 0.313 RKM-2018-029 (RSP11121)
  19. 0.321 Recon (RSP10755)
  20. 0.335 Liberty Haze (RSP11000)

Most genetically distant strains (All Samples)

0 0.117 0.233 0.350 0.467
clone distance sibling distance more distant
  1. 0.450 JL yellow (RSP11075)
  2. 0.446 Cherry Blossom (RSP11318)
  3. 0.442 Cherry Blossom (RSP11323)
  4. 0.436 JL 3rd Gen Mother (RSP11214)
  5. 0.434 Cherry Blossom (RSP11300)
  6. 0.433 AVIDEKEL 2 0 (RSP11174)
  7. 0.430 Cherry Blossom (RSP11301)
  8. 0.426 Cherry Blossom (RSP11312)
  9. 0.426 JL 3rd Gen Mother (RSP11197)
  10. 0.425 Unknown- Cherry Wine - 001 (RSP11268)
  11. 0.421 Cherry Blossom (RSP11328)
  12. 0.418 Cherry Blossom (RSP11298)
  13. 0.414 Cbot-2019-005 (RSP11133)
  14. 0.413 Cherry Blossom (RSP11309)
  15. 0.413 Unknown- Cherry Wine - 002 (RSP11269)
  16. 0.412 Wife (RSP11148)
  17. 0.412 JL 4th Gen 2 (RSP11194)
  18. 0.410 Lemon Skunk (RSP11229)
  19. 0.410 Queen Dream (RSP11278)
  20. 0.409 Skunk 18 (RSP11030)

Most genetically distant strains (Base Tree)

0 0.117 0.233 0.350 0.467
clone distance sibling distance more distant
  1. 0.450 JL yellow (RSP11075)
  2. 0.426 Cbot-2019-005 (RSP11133)
  3. 0.405 Kush Hemp E1 (RSP11128)
  4. 0.402 RKM-2018-006 (RSP11097)
  5. 0.401 RKM-2018-002 (RSP11093)
  6. 0.401 Skunk 18 (RSP11038)
  7. 0.398 RKM-2018-028 (RSP11120)
  8. 0.389 RKM-2018-023 (RSP11115)
  9. 0.389 Sour Raspberry (RSP10551)
  10. 0.389 RKM-2018-018 (RSP11110)
  11. 0.386 Cbot-2019-004 (RSP11132)
  12. 0.385 UP Sunrise (RSP10989)
  13. 0.384 RKM-2018-003 (RSP11094)
  14. 0.384 Blue Dream (RSP11033)
  15. 0.383 Cbot-2019-001 (RSP11129)
  16. 0.383 RKM-2018-027 (RSP11119)
  17. 0.379 RKM-2018-022 (RSP11114)
  18. 0.378 Gold Cracker (RSP11048)
  19. 0.376 RKM-2018-009 (RSP11100)
  20. 0.375 Hermaphrodite Research Sample1 (RSP11049)

Nearest genetic relative in Phylos dataset

Phylos Strain SRR4448807
Overlapping SNPs:
101
Concordance:
66

Nearest genetic relative in Lynch dataset

Lynch Strain SRR3495319
Overlapping SNPs:
12
Concordance:
11

Blockchain Registration Information

Transaction ID
6e12ff7cf165b60d8f9a631be96ec13853333d87135a2627546db1d1ded5d3cd
Stamping Certificate
Download PDF (860.1 KB)
SHASUM Hash
057ab86ebe2b8c17f33855e1495cf0b405291ba99b6853c451a5cfbbfa120fac
QR code for RSP11210

Kannapedia uses cookies

By clicking Allow All, you agree to the storing of cookies on your device to enhance site navigation, analyze site usage, and assist in our marketing efforts.

Customize Settings