
RSP 11210

Grower: John McKay-Colorado State University

General Information

Sample Name
Accession Date
June 26, 2019
Reported Plant Sex
not reported

The strain rarity visualization shows how distant the strain is from the other cultivars in the Kannapedia database. The y-axis represents genetic distance, getting farther as you go up. The width of the visualization at any position along the y-axis shows how many strains there are in the database at that genetic distance. So, a common strain will have a more bottom-heavy shape, while uncommon and rare cultivars will have a visualization that is generally shifted towards the top.

Rarity: Uncommon
Most Distant Most Similar

Chemical Information

Cannabinoid and terpenoid information provided by the grower.


No information provided.


No information provided.

Genetic Information

Plant Type
Type II

The bell curve in the heterozygosity visualization shows the distribution of heterozygosity levels for cannabis cultivars in the Kannapedia database. The green line shows where this particular strain fits within the distribution. Heterozygosity is associated with heterosis (aka hybrid vigor) but also leads to the production of more variable offspring. When plants have two genetically different parents, heterozygosity levels will be higher than if it has been inbred or backcrossed repeatedly.

Heterozygosity: 2.23%
Least Heterozygous Most Heterozygous

This chart represents the Illumina sequence coverage over the Bt/Bd allele. These are the three regions in the cannabis genome that impact THCA, CBDA, CBGA production. Coverage over the Active CBDAS gene is highly correlated with Type II and Type III plants as described by Etienne de Meijer. Coverage over the THCA gene is highly correlated with Type I and Type II plants but is anti-correlated with Type III plants. Type I plants require coverage over the inactive CBDA loci and no coverage over the Active CBDA gene. Lack of coverage over the Active CBDA and Active THCA allele are presumed to be Type IV plants (CBGA dominant). While deletions of entire THCAS and CBDAS genes are the most common Bt:Bd alleles observed, it is possible to have plants with these genes where functional expression of the enzyme is disrupted by deactivating point mutations (Kojoma et al. 2006).

Bt/Bd Allele Coverage

This chart represents the Illumina sequence coverage over the CBCA synthase gene.

CBCAS Coverage

Variants (THCAS, CBDAS, and CBCAS)

CBDAS c.8G>A p.Cys3Tyr missense variant moderate contig1772 2082234

IGV: Start, Jump

CBDAS c.221C>G p.Thr74Ser missense variant moderate contig1772 2082447

IGV: Start, Jump

CBDAS c.503A>G p.Asn168Ser missense variant moderate contig1772 2082729

IGV: Start, Jump

CBDAS c.587A>G p.Asn196Ser missense variant moderate contig1772 2082813

IGV: Start, Jump

CBDAS c.1420A>C p.Lys474Gln missense variant moderate contig1772 2083646

IGV: Start, Jump

CBDAS c.1628G>A p.Arg543His missense variant moderate contig1772 2083854

IGV: Start, Jump

THCAS c.1625C>T p.Pro542Leu missense variant moderate contig741 4416203

IGV: Start, Jump

THCAS c.187A>C p.Ile63Leu missense variant moderate contig741 4417641

IGV: Start, Jump


Variants (Select Genes of Interest)



c.744C>G p.Asp248Glu missense variant moderate contig676 168993

IGV: Start, Jump



c.845_848delAAAG p.Glu282fs frameshift variant high contig676 169629

IGV: Start, Jump



c.896A>G p.Asn299Ser missense variant moderate contig676 169772

IGV: Start, Jump



c.710A>C p.His237Pro missense variant moderate contig885 810

IGV: Start, Jump

PHL-2 c.73C>T p.Arg25Cys missense variant moderate contig2621 337642

IGV: Start, Jump

PHL-2 c.455A>C p.Asp152Ala missense variant moderate contig2621 339191

IGV: Start, Jump

PHL-2 c.977A>C p.His326Pro missense variant moderate contig2621 340255

IGV: Start, Jump

PHL-2 c.1837G>A p.Glu613Lys missense variant moderate contig2621 341115

IGV: Start, Jump

PHL-2 c.2564T>A p.Phe855Tyr missense variant moderate contig2621 342607

IGV: Start, Jump

PHL-2 c.2578T>A p.Leu860Ile missense variant moderate contig2621 342621

IGV: Start, Jump

PHL-2 c.2783G>A p.Ser928Asn missense variant moderate contig2621 342826

IGV: Start, Jump

PHL-2 c.2830A>C p.Asn944His missense variant moderate contig2621 342873

IGV: Start, Jump

PHL-2 c.2933G>T p.Arg978Leu missense variant moderate contig2621 342976

IGV: Start, Jump

PHL-2 c.2936T>G p.Val979Gly missense variant moderate contig2621 342979

IGV: Start, Jump

PHL-2 c.3209A>G p.Gln1070Arg missense variant moderate contig2621 343252

IGV: Start, Jump

PHL-2 c.3467A>G p.Gln1156Arg missense variant moderate contig2621 343510

IGV: Start, Jump



c.774G>A p.Met258Ile missense variant moderate contig700 1944616

IGV: Start, Jump



c.67T>A p.Phe23Ile missense variant moderate contig700 1945567

IGV: Start, Jump



c.31A>T p.Thr11Ser missense variant moderate contig700 1945603

IGV: Start, Jump



c.1152T>A p.Asn384Lys missense variant moderate contig700 1950486

IGV: Start, Jump



c.1132C>G p.Leu378Val missense variant moderate contig700 1950506

IGV: Start, Jump



c.1117A>G p.Ile373Val missense variant moderate contig700 1950521

IGV: Start, Jump



c.774G>A p.Met258Ile missense variant moderate contig700 1950864

IGV: Start, Jump



c.31A>T p.Thr11Ser missense variant moderate contig700 1951851

IGV: Start, Jump



c.558-1G>A splice acceptor variant & intron variant high contig700 2715037

IGV: Start, Jump



c.353_354insCC p.Gly119fs frameshift variant high contig700 2721319

IGV: Start, Jump



c.324A>C p.Glu108Asp missense variant moderate contig700 2721349

IGV: Start, Jump



c.323A>G p.Glu108Gly missense variant moderate contig700 2721350

IGV: Start, Jump



c.316+2T>A splice donor variant & intron variant high contig700 2723818

IGV: Start, Jump



c.229G>A p.Gly77Ser missense variant moderate contig700 2724206

IGV: Start, Jump



c.216G>C p.Leu72Phe missense variant moderate contig700 2724219

IGV: Start, Jump



c.206T>C p.Leu69Ser missense variant moderate contig700 2724229

IGV: Start, Jump



c.1319T>C p.Ile440Thr missense variant moderate contig380 285250

IGV: Start, Jump



c.260C>G p.Ser87Cys missense variant moderate contig931 109979

IGV: Start, Jump



c.220A>G p.Ile74Val missense variant moderate contig931 110019

IGV: Start, Jump



c.260C>G p.Ser87Cys missense variant moderate contig931 118104

IGV: Start, Jump



c.220A>G p.Ile74Val missense variant moderate contig931 118144

IGV: Start, Jump



c.185C>T p.Thr62Ile missense variant moderate contig931 118179

IGV: Start, Jump



c.175G>A p.Val59Ile missense variant moderate contig931 118189

IGV: Start, Jump



c.574A>G p.Asn192Asp missense variant moderate contig97 242280

IGV: Start, Jump



c.757C>T p.Pro253Ser missense variant moderate contig97 242463

IGV: Start, Jump



c.772A>G p.Ser258Gly missense variant moderate contig97 242478

IGV: Start, Jump



c.812G>C p.Gly271Ala missense variant moderate contig97 242518

IGV: Start, Jump



c.1229+2T>C splice donor variant & intron variant high contig97 243389

IGV: Start, Jump



c.1466G>A p.Ser489Asn missense variant moderate contig97 244297

IGV: Start, Jump



c.1966C>G p.Pro656Ala missense variant moderate contig97 244797

IGV: Start, Jump



c.2140C>T p.Pro714Ser missense variant moderate contig97 244971

IGV: Start, Jump



c.2141C>G p.Pro714Arg missense variant moderate contig97 244972

IGV: Start, Jump



c.2198G>T p.Arg733Leu missense variant moderate contig97 245029

IGV: Start, Jump



c.2212_2217dupCACCAT p.His738_His739dup conservative inframe insertion moderate contig97 245033

IGV: Start, Jump



c.80A>G p.Lys27Arg missense variant moderate contig121 2828736

IGV: Start, Jump



c.97T>C p.Tyr33His missense variant moderate contig121 2828753

IGV: Start, Jump



c.153A>C p.Lys51Asn missense variant moderate contig121 2828809

IGV: Start, Jump



c.198A>C p.Lys66Asn missense variant moderate contig121 2828854

IGV: Start, Jump



c.202T>A p.Leu68Ile missense variant moderate contig121 2828858

IGV: Start, Jump



c.235_236delGT p.Val79fs frameshift variant high contig121 2829030

IGV: Start, Jump



c.238delT p.Ser80fs frameshift variant high contig121 2829034

IGV: Start, Jump



c.916C>T p.His306Tyr missense variant & splice region variant moderate contig121 2832711

IGV: Start, Jump



c.1168T>C p.Tyr390His missense variant moderate contig121 2833503

IGV: Start, Jump



c.95_97delGTT p.Cys32del disruptive inframe deletion moderate contig121 2835800

IGV: Start, Jump



c.160A>C p.Thr54Pro missense variant moderate contig121 2835867

IGV: Start, Jump



c.406A>G p.Ile136Val missense variant moderate contig121 2839605

IGV: Start, Jump



c.670T>A p.Ser224Thr missense variant moderate contig121 2840278

IGV: Start, Jump



c.727G>T p.Glu243* stop gained high contig121 2841362

IGV: Start, Jump



c.864C>G p.Asn288Lys missense variant moderate contig121 2842407

IGV: Start, Jump



c.205T>A p.Ser69Thr missense variant moderate contig81 209167

IGV: Start, Jump



c.331A>G p.Asn111Asp missense variant moderate contig81 209293

IGV: Start, Jump



c.1006A>G p.Lys336Glu missense variant moderate contig81 209968

IGV: Start, Jump



c.1415G>A p.Ser472Asn missense variant moderate contig81 210377

IGV: Start, Jump



c.1417A>G p.Thr473Ala missense variant moderate contig81 210379

IGV: Start, Jump



c.1434G>T p.Glu478Asp missense variant moderate contig81 210396

IGV: Start, Jump



c.1541T>C p.Val514Ala missense variant moderate contig81 210503

IGV: Start, Jump



c.2623A>G p.Thr875Ala missense variant moderate contig1439 1487174

IGV: Start, Jump



c.2551A>G p.Thr851Ala missense variant moderate contig1439 1487246

IGV: Start, Jump



c.1387A>G p.Thr463Ala missense variant moderate contig1439 1489811

IGV: Start, Jump



c.302-1G>A splice acceptor variant & intron variant high contig1636 520616

IGV: Start, Jump



c.1618A>G p.Ile540Val missense variant moderate contig1891 885936

IGV: Start, Jump



c.1378G>A p.Val460Ile missense variant moderate contig1891 886370

IGV: Start, Jump



c.-108+1_-108+2insG splice donor variant & intron variant high contig1891 889975

IGV: Start, Jump



c.124C>A p.Pro42Thr missense variant moderate contig1460 1084136

IGV: Start, Jump



c.6653A>G p.Asn2218Ser missense variant moderate contig1460 1184434

IGV: Start, Jump



c.5932A>G p.Ile1978Val missense variant moderate contig1460 1185552

IGV: Start, Jump



c.5884G>A p.Gly1962Ser missense variant moderate contig1460 1185715

IGV: Start, Jump



c.3554G>A p.Arg1185Lys missense variant moderate contig1460 1188486

IGV: Start, Jump



c.3506A>C p.Glu1169Ala missense variant moderate contig1460 1188534

IGV: Start, Jump



c.3505G>A p.Glu1169Lys missense variant moderate contig1460 1188535

IGV: Start, Jump



c.2083_2085delGTC p.Val695del conservative inframe deletion moderate contig1460 1189954

IGV: Start, Jump



c.2072A>G p.His691Arg missense variant moderate contig1460 1189968

IGV: Start, Jump



c.2027A>T p.Gln676Leu missense variant moderate contig1460 1190013

IGV: Start, Jump



c.1872T>A p.Asp624Glu missense variant moderate contig1460 1190252

IGV: Start, Jump



c.1846A>G p.Lys616Glu missense variant moderate contig1460 1190278

IGV: Start, Jump



c.1656T>G p.Asn552Lys missense variant moderate contig1460 1191574

IGV: Start, Jump



c.1630G>C p.Ala544Pro missense variant moderate contig1460 1191600

IGV: Start, Jump



c.1289A>G p.Asp430Gly missense variant moderate contig1460 1192109

IGV: Start, Jump



c.1156T>G p.Trp386Gly missense variant moderate contig1460 1192242

IGV: Start, Jump



c.1019_1048dupATGTGGGTGAACCAACCCAGATGGAGGATA p.Asn340_Asp349dup conservative inframe insertion moderate contig1460 1192349

IGV: Start, Jump



c.982G>A p.Glu328Lys missense variant moderate contig1460 1192416

IGV: Start, Jump



c.710C>T p.Pro237Leu missense variant moderate contig1460 1193804

IGV: Start, Jump



c.706T>C p.Tyr236His missense variant moderate contig1460 1193808

IGV: Start, Jump



c.637T>A p.Ser213Thr missense variant moderate contig1460 1194421

IGV: Start, Jump



c.434C>T p.Ser145Phe missense variant moderate contig954 3049270

IGV: Start, Jump



c.1772A>G p.Gln591Arg missense variant moderate contig954 3059929

IGV: Start, Jump



c.627_629dupTGT p.Val210dup disruptive inframe insertion moderate contig883 270231

IGV: Start, Jump



c.38_43dupATAATA p.Asn13_Asn14dup disruptive inframe insertion moderate contig1561 3124441

IGV: Start, Jump



c.35_43dupATAATAATA p.Asn12_Asn14dup disruptive inframe insertion moderate contig1561 3124441

IGV: Start, Jump



c.240C>G p.Asn80Lys missense variant moderate contig1561 3124664

IGV: Start, Jump



c.259+1_259+2insTA splice donor variant & intron variant high contig1561 3124684

IGV: Start, Jump



c.634G>C p.Gly212Arg missense variant moderate contig976 1083220

IGV: Start, Jump



c.416T>C p.Leu139Pro missense variant moderate contig976 1083609

IGV: Start, Jump



c.382T>C p.Tyr128His missense variant moderate contig976 1083643

IGV: Start, Jump



c.327G>A p.Trp109* stop gained high contig976 1083698

IGV: Start, Jump



c.293A>G p.Asp98Gly missense variant moderate contig976 1083732

IGV: Start, Jump



c.287C>T p.Thr96Ile missense variant moderate contig976 1083738

IGV: Start, Jump



c.215A>T p.Glu72Val missense variant moderate contig976 1083860

IGV: Start, Jump



c.167A>G p.Glu56Gly missense variant moderate contig976 1083908

IGV: Start, Jump



c.141A>G p.Ile47Met missense variant moderate contig976 1083934

IGV: Start, Jump



c.125A>G p.Glu42Gly missense variant moderate contig976 1083950

IGV: Start, Jump



c.79A>G p.Thr27Ala missense variant moderate contig976 1083996

IGV: Start, Jump



c.52G>A p.Gly18Ser missense variant moderate contig976 1084023

IGV: Start, Jump



c.773A>G p.Asn258Ser missense variant & splice region variant moderate contig1225 2279897

IGV: Start, Jump



c.1222C>G p.Gln408Glu missense variant moderate contig1225 2281482

IGV: Start, Jump



c.1758T>G p.Asn586Lys missense variant moderate contig1225 2282186

IGV: Start, Jump



c.3607G>A p.Glu1203Lys missense variant moderate contig1225 2285222

IGV: Start, Jump



c.3608A>C p.Glu1203Ala missense variant moderate contig1225 2285223

IGV: Start, Jump



c.3619G>A p.Val1207Met missense variant moderate contig1225 2285234

IGV: Start, Jump



c.3656G>A p.Arg1219Lys missense variant moderate contig1225 2285271

IGV: Start, Jump



c.32C>A p.Thr11Lys missense variant moderate contig2282 549024

IGV: Start, Jump



c.317C>T p.Pro106Leu missense variant moderate contig2282 549309

IGV: Start, Jump



c.358_359delGC p.Ala120fs frameshift variant high contig2282 549348

IGV: Start, Jump



c.382C>T p.Leu128Phe missense variant moderate contig2282 549374

IGV: Start, Jump



c.541G>A p.Val181Ile missense variant moderate contig2282 549533

IGV: Start, Jump



c.704A>T p.His235Leu missense variant moderate contig2282 549696

IGV: Start, Jump



c.721G>A p.Ala241Thr missense variant moderate contig93 3337039

IGV: Start, Jump


Nearest genetic relatives (All Samples)

0 0.058 0.117 0.175 0.233
clone distance sibling distance more distant
  1. 0.200 Tisza (RSP11044)
  2. 0.202 C-930 lot 211005 (RSP12603)
  3. 0.204 Tisza (RSP11045)
  4. 0.205 Tisza (RSP10659)
  5. 0.208 Carmagnola USO 31 (RSP11204)
  6. 0.210 Fibranova (SRR14708276)
  7. 0.211 Uniko B (SRR14708278)
  8. 0.215 Carmagnola (RSP10979)
  9. 0.216 Carmagnola (RSP11202)
  10. 0.218 Fedora 17 (RSP11203)
  11. 0.219 Carmagnola (RSP10978)
  12. 0.219 Ivory (RSP10668)
  13. 0.219 Carmagnola (RSP10976)
  14. 0.221 Fedora 17 (SRR14708222)
  15. 0.222 Santhica 27 (RSP10665)
  16. 0.223 Kompolti (SRR14708277)
  17. 0.225 Eletta Campana (RSP11209)
  18. 0.226 Futura 75 (RSP10664)
  19. 0.226 VIR 201 (SRR14708232)
  20. 0.226 VIR 469 (SRR14708243)

Nearest genetic relatives (Base Tree)

0 0.083 0.167 0.250 0.333
clone distance sibling distance more distant
  1. 0.209 Tisza (RSP11044)
  2. 0.223 Tisza (RSP10659)
  3. 0.232 Carmagnola (RSP10979)
  4. 0.237 Futura 75 (RSP10664)
  5. 0.239 Carmagnola (RSP11037)
  6. 0.248 Ivory (RSP10668)
  7. 0.250 Santhica27 (RSP11047)
  8. 0.253 Lovrin (RSP10658)
  9. 0.254 Fedora 17 (RSP10661)
  10. 0.256 Tygra (RSP10667)
  11. 0.265 Feral (RSP10890)
  12. 0.266 Monoica (RSP10241)
  13. 0.266 USO 31 (RSP10981)
  14. 0.268 Kyrgyz Gold (RSP11054)
  15. 0.269 KYRG-11 (RSP11051)
  16. 0.312 Kimbo Slice (RSP10997)
  17. 0.312 Jiangji (RSP10653)
  18. 0.314 Liberty Haze (RSP11000)
  19. 0.316 Recon (RSP10755)
  20. 0.324 RKM-2018-029 (RSP11121)

Most genetically distant strains (All Samples)

0 0.125 0.250 0.375 0.500
clone distance sibling distance more distant
  1. 0.477 JL yellow (RSP11075)
  2. 0.465 JL 3rd Gen Mother (RSP11197)
  3. 0.455 JL 3rd Gen Mother (RSP11214)
  4. 0.433 AVIDEKEL 2 0 (RSP11174)
  5. 0.432 JL x NSPM1 4 (RSP11482)
  6. 0.431 Chematonic -Cannatonic x Chemdawg- (RSP11394)
  7. 0.430 JL 4th Gen 2 (RSP11194)
  8. 0.430 Skunk#18 (RSP11038)
  9. 0.426 Cherry Blossom (RSP11300)
  10. 0.422 Cherry Blossom (RSP11318)
  11. 0.421 JL 4th Gen 5 (RSP11199)
  12. 0.420 Lemon Skunk (RSP11229)
  13. 0.418 RKM-2018-002 (RSP11093)
  14. 0.417 Cherry Blossom (RSP11312)
  15. 0.417 UP Wendigo (RSP11261)
  16. 0.415 Cherry Blossom (RSP11301)
  17. 0.415 Fatso (RSP11741)
  18. 0.414 Queen Dream (RSP11278)
  19. 0.412 Medxotic (RSP11410)
  20. 0.411 UP Green Flash (RSP11259)

Most genetically distant strains (Base Tree)

0 0.125 0.250 0.375 0.500
clone distance sibling distance more distant
  1. 0.469 JL yellow (RSP11075)
  2. 0.413 RKM-2018-002 (RSP11093)
  3. 0.409 Skunk#18 (RSP11038)
  4. 0.405 RKM-2018-006 (RSP11097)
  5. 0.402 Cbot-2019-005 (RSP11133)
  6. 0.401 Kush Hemp E1 (RSP11128)
  7. 0.398 RKM-2018-027 (RSP11119)
  8. 0.394 RKM-2018-023 (RSP11115)
  9. 0.394 RKM-2018-028 (RSP11120)
  10. 0.391 RKM-2018-022 (RSP11114)
  11. 0.388 Sour Raspberry (RSP10551)
  12. 0.384 Cbot-2019-001 (RSP11129)
  13. 0.383 Skywalker OG (RSP10837)
  14. 0.382 RKM-2018-018 (RSP11110)
  15. 0.380 Gold Cracker (RSP11048)
  16. 0.378 Italian Kiss (RSP11034)
  17. 0.378 Blue Dream (RSP11033)
  18. 0.377 RKM-2018-003 (RSP11094)
  19. 0.377 RKM-2018-009 (RSP11100)
  20. 0.376 RKM-2018-032 (RSP11124)

Nearest genetic relative in Phylos dataset

Phylos Strain SRR4448807
Overlapping SNPs:

Nearest genetic relative in Lynch dataset

Lynch Strain SRR3495319
Overlapping SNPs:

Blockchain Registration Information

Transaction ID
Stamping Certificate
Download PDF (860.1 KB)
QR code for RSP11210

Kannapedia uses cookies

By clicking Allow All, you agree to the storing of cookies on your device to enhance site navigation, analyze site usage, and assist in our marketing efforts.

Customize Settings