Unknown-(Cherry Wine)-(004)

RSP 11271

Grower: Keaton Baker

General Information

Sample Name
T-Rex-004
Accession Date
September 26, 2019
Reported Plant Sex
Female

The strain rarity visualization shows how distant the strain is from the other cultivars in the Kannapedia database. The y-axis represents genetic distance, getting farther as you go up. The width of the visualization at any position along the y-axis shows how many strains there are in the database at that genetic distance. So, a common strain will have a more bottom-heavy shape, while uncommon and rare cultivars will have a visualization that is generally shifted towards the top.

Rarity: Uncommon
Most Distant Most Similar

Chemical Information

Cannabinoid and terpenoid information provided by the grower.

Cannabinoids

No information provided.

Terpenoids

No information provided.

Genetic Information

Plant Type
Type III

The bell curve in the heterozygosity visualization shows the distribution of heterozygosity levels for cannabis cultivars in the Kannapedia database. The green line shows where this particular strain fits within the distribution. Heterozygosity is associated with heterosis (aka hybrid vigor) but also leads to the production of more variable offspring. When plants have two genetically different parents, heterozygosity levels will be higher than if it has been inbred or backcrossed repeatedly.

Heterozygosity: 1.15%
Least Heterozygous Most Heterozygous

The ratio of reads mapped to Y-contigs to reads mapped to the whole Cannabis genome (Y-ratios) has been demonstrated to be strongly correlated with plant sex typing. This plot shows the distribution of Y-ratios for all samples in our database which were sequenced with the same method (panel or WGS) as this sample and where this sample falls in the distribution.

Y-Ratio Distribution: 0.0426
male female RSP11271

This chart represents the Illumina sequence coverage over the Bt/Bd allele. These are the three regions in the cannabis genome that impact THCA, CBDA, CBGA production. Coverage over the Active CBDAS gene is highly correlated with Type II and Type III plants as described by Etienne de Meijer. Coverage over the THCA gene is highly correlated with Type I and Type II plants but is anti-correlated with Type III plants. Type I plants require coverage over the inactive CBDA loci and no coverage over the Active CBDA gene. Lack of coverage over the Active CBDA and Active THCA allele are presumed to be Type IV plants (CBGA dominant). While deletions of entire THCAS and CBDAS genes are the most common Bt:Bd alleles observed, it is possible to have plants with these genes where functional expression of the enzyme is disrupted by deactivating point mutations (Kojoma et al. 2006).

Bt/Bd Allele Coverage

This chart represents the Illumina sequence coverage over the CBCA synthase gene.

CBCAS Coverage

Variants (THCAS, CBDAS, and CBCAS)

CBDAS c.221C>G p.Thr74Ser missense variant moderate contig1772 2082447

IGV: Start, Jump

C/G
NGS:
0.136
C90:
0.057
CBDAS c.1420A>C p.Lys474Gln missense variant moderate contig1772 2083646

IGV: Start, Jump

A/C
NGS:
0.132
C90:
0.813

Variants (Select Genes of Interest)

GPPs1

UniProt

c.845_848delAAAG p.Glu282fs frameshift variant high contig676 169629

IGV: Start, Jump

TGAAA/T
NGS:
0.118
C90:
0.000
PKSG-2a

UniProt

c.67T>A p.Phe23Ile missense variant moderate contig700 1945567

IGV: Start, Jump

A/T
NGS:
0.825
C90:
0.904
PKSG-2a

UniProt

c.31A>T p.Thr11Ser missense variant moderate contig700 1945603

IGV: Start, Jump

T/A
NGS:
0.763
C90:
0.876
PKSG-2b

UniProt

c.1152T>A p.Asn384Lys missense variant moderate contig700 1950486

IGV: Start, Jump

A/T
NGS:
0.715
C90:
0.895
PKSG-2b

UniProt

c.1132C>G p.Leu378Val missense variant moderate contig700 1950506

IGV: Start, Jump

G/C
NGS:
0.717
C90:
0.000
PKSG-2b

UniProt

c.1117A>G p.Ile373Val missense variant moderate contig700 1950521

IGV: Start, Jump

T/C
NGS:
0.807
C90:
0.981
PKSG-2b

UniProt

c.774G>A p.Met258Ile missense variant moderate contig700 1950864

IGV: Start, Jump

C/T
NGS:
0.366
C90:
0.947
PKSG-2b

UniProt

c.31A>T p.Thr11Ser missense variant moderate contig700 1951851

IGV: Start, Jump

T/A
NGS:
0.844
C90:
0.880
PKSG-4b

UniProt

c.496A>G p.Lys166Glu missense variant moderate contig700 2721177

IGV: Start, Jump

T/C
NGS:
0.651
C90:
0.684
PKSG-4b

UniProt

c.489delT p.Phe163fs frameshift variant high contig700 2721183

IGV: Start, Jump

CA/C
NGS:
0.792
C90:
0.761
PKSG-4b

UniProt

c.485A>G p.Lys162Arg missense variant moderate contig700 2721188

IGV: Start, Jump

T/C
NGS:
0.643
C90:
0.301
PKSG-4b

UniProt

c.431T>G p.Val144Gly missense variant moderate contig700 2721242

IGV: Start, Jump

A/C
NGS:
0.575
C90:
0.679
PKSG-4b

UniProt

c.419A>G p.Asp140Gly missense variant moderate contig700 2721254

IGV: Start, Jump

T/C
NGS:
0.430
C90:
0.440
PKSG-4b

UniProt

c.352_355delACAG p.Thr118fs frameshift variant high contig700 2721317

IGV: Start, Jump

CCTGT/C
NGS:
0.529
C90:
0.000
PKSG-4b

UniProt

c.323A>G p.Glu108Gly missense variant moderate contig700 2721350

IGV: Start, Jump

T/C
NGS:
0.469
C90:
0.000
DXR-2

UniProt

c.1319T>C p.Ile440Thr missense variant moderate contig380 285250

IGV: Start, Jump

A/G
NGS:
0.480
C90:
0.000
aPT4

UniProt

c.97T>C p.Tyr33His missense variant moderate contig121 2828753

IGV: Start, Jump

T/C
NGS:
0.439
C90:
0.000
aPT4

UniProt

c.153A>C p.Lys51Asn missense variant moderate contig121 2828809

IGV: Start, Jump

A/C
NGS:
0.375
C90:
0.000
aPT4

UniProt

c.235_236delGT p.Val79fs frameshift variant high contig121 2829030

IGV: Start, Jump

ATG/A
NGS:
0.417
C90:
0.000
aPT4

UniProt

c.238delT p.Ser80fs frameshift variant high contig121 2829034

IGV: Start, Jump

AT/A
NGS:
0.421
C90:
0.000
aPT4

UniProt

c.302A>G p.Asn101Ser missense variant moderate contig121 2829099

IGV: Start, Jump

A/G
NGS:
0.349
C90:
0.000
aPT4

UniProt

c.744+1_744+19delGTAATTTATTTTATTATAA splice donor variant & splice region variant & intron variant high contig121 2831022

IGV: Start, Jump

GGTAATTTATTTTATTATAA/G
NGS:
0.096
C90:
0.000

Nearest genetic relatives (All Samples)

0 0.067 0.133 0.200 0.267
clone distance sibling distance more distant
  1. 0.150 Cherry Blossom (RSP11334)
  2. 0.176 Cherry Blossom CBG (RSP11303)
  3. 0.176 Cherry Blossom (RSP11335)
  4. 0.178 Cherry Blossom (RSP11308)
  5. 0.180 Unknown- Cherry Wine - 003 (RSP11270)
  6. 0.184 Cherry Blossom (RSP11315)
  7. 0.190 Unknown- Cherry Wine - 002 (RSP11269)
  8. 0.202 Cherry Blossom (RSP11321)
  9. 0.207 Cherry Blossom (RSP11325)
  10. 0.207 Unknown- Cherry Wine - 005 (RSP11272)
  11. 0.210 Cherry Blossom (RSP11320)
  12. 0.216 Cherry Blossom (RSP11310)
  13. 0.229 Cherry Blossom (RSP11324)
  14. 0.229 Cherry Blossom (RSP11299)
  15. 0.230 Cherry Blossom (RSP11332)
  16. 0.232 Unknown- Cherry Wine - 001 (RSP11268)
  17. 0.235 Cherry Blossom (RSP11317)
  18. 0.258 Cherry Blossom (RSP11311)
  19. 0.260 Sweet Grass (RSP11146)
  20. 0.265 Cherry Blossom (RSP11326)

Nearest genetic relatives (Base Tree)

0 0.092 0.183 0.275 0.367
clone distance sibling distance more distant
  1. 0.294 Cbot-2019-004 (RSP11132)
  2. 0.300 Durban Poison (RSP11014)
  3. 0.314 Tygra (RSP10667)
  4. 0.318 Recon (RSP10755)
  5. 0.319 Liberty Haze (RSP11000)
  6. 0.326 UP Sunrise (RSP10989)
  7. 0.330 Cherry (RSP11143)
  8. 0.334 Blueberry Cheesecake (RSP10684)
  9. 0.343 Lovrin (RSP10658)
  10. 0.345 Santhica27 (RSP11047)
  11. 0.346 Tisza (RSP10659)
  12. 0.346 Monoica (RSP10241)
  13. 0.349 Hermaphrodite ResearchSample2 (RSP11050)
  14. 0.349 Feral (RSP10890)
  15. 0.350 USO 31 (RSP10981)
  16. 0.350 KYRG-11 (RSP11051)
  17. 0.352 QUEEN JESUS (RSP10105)
  18. 0.354 Jiangji (RSP10653)
  19. 0.354 CST (RSP11002)
  20. 0.354 Kyrgyz Gold (RSP11054)

Most genetically distant strains (All Samples)

0 0.125 0.250 0.375 0.500
clone distance sibling distance more distant
  1. 0.468 Chem 91 (RSP11185)
  2. 0.444 501st OG (RSP11241)
  3. 0.443 Red Eye OG (RSP11190)
  4. 0.443 RKM-2018-002 (RSP11093)
  5. 0.439 New York City Deisel (RSP11225)
  6. 0.435 JL 4th Gen 5 (RSP11199)
  7. 0.434 Super Sour Diesel (RSP11191)
  8. 0.431 Abacus (RSP11266)
  9. 0.431 RKM-2018-001 (RSP11092)
  10. 0.431 Jacks Cleaner (RSP11347)
  11. 0.430 RKM-2018-024 (RSP11116)
  12. 0.429 RKM-2018-032 (RSP11124)
  13. 0.429 RKM-2018-021 (RSP11113)
  14. 0.427 Sour D (RSP11343)
  15. 0.427 RKM-2018-017 (RSP11109)
  16. 0.426 Garlic (RSP11341)
  17. 0.425 TI (RSP11149)
  18. 0.421 JL yellow (RSP11075)
  19. 0.420 RKM-2018-013 (RSP11104)
  20. 0.419 Hermaphrodite Research Sample1 (RSP11049)

Most genetically distant strains (Base Tree)

0 0.117 0.233 0.350 0.467
clone distance sibling distance more distant
  1. 0.446 RKM-2018-002 (RSP11093)
  2. 0.427 RKM-2018-032 (RSP11124)
  3. 0.426 JL yellow (RSP11075)
  4. 0.423 Hermaphrodite Research Sample1 (RSP11049)
  5. 0.421 RKM-2018-018 (RSP11110)
  6. 0.421 Skywalker OG (RSP10837)
  7. 0.413 RKM-2018-026 (RSP11118)
  8. 0.410 Cbot-2019-006 (RSP11134)
  9. 0.408 RKM-2018-033 (RSP11125)
  10. 0.408 RKM-2018-028 (RSP11120)
  11. 0.406 Skunk 18 (RSP11038)
  12. 0.405 Kush Hemp E1 (RSP11128)
  13. 0.404 Black Beauty (RSP11035)
  14. 0.402 RKM-2018-022 (RSP11114)
  15. 0.402 RKM-2018-005 (RSP11096)
  16. 0.401 RKM-2018-009 (RSP11100)
  17. 0.399 Italian Kiss (RSP11034)
  18. 0.399 RKM-2018-029 (RSP11121)
  19. 0.398 RKM-2018-031 (RSP11123)
  20. 0.398 Blue Dream (RSP11033)

Nearest genetic relative in Phylos dataset

Phylos Strain SRR8347192
Overlapping SNPs:
70
Concordance:
43

Nearest genetic relative in Lynch dataset

Lynch Strain SRR3495320
Overlapping SNPs:
10
Concordance:
10

Blockchain Registration Information

Transaction ID
3a130b9f6ea84e9d71e4dfde973d7688f3d31f8306daf4c0f5152b2a43719ea8
Stamping Certificate
Download PDF (853.9 KB)
SHASUM Hash
ca9ce155ce0ff0a7e7b2a6f80fbd9f550e39e1766e99395376b20787fd196cb7
QR code for RSP11271

Kannapedia uses cookies

By clicking Allow All, you agree to the storing of cookies on your device to enhance site navigation, analyze site usage, and assist in our marketing efforts.

Customize Settings