Unknown-(Cherry Wine)-(005)

RSP 11272

Grower: Keaton Baker

General Information

Sample Name
Morning Star-005
Accession Date
September 26, 2019
Reported Plant Sex
Female

The strain rarity visualization shows how distant the strain is from the other cultivars in the Kannapedia database. The y-axis represents genetic distance, getting farther as you go up. The width of the visualization at any position along the y-axis shows how many strains there are in the database at that genetic distance. So, a common strain will have a more bottom-heavy shape, while uncommon and rare cultivars will have a visualization that is generally shifted towards the top.

Rarity: Uncommon
Most Distant Most Similar

Chemical Information

Cannabinoid and terpenoid information provided by the grower.

Cannabinoids

No information provided.

Terpenoids

No information provided.

Genetic Information

Plant Type
Type III

The bell curve in the heterozygosity visualization shows the distribution of heterozygosity levels for cannabis cultivars in the Kannapedia database. The green line shows where this particular strain fits within the distribution. Heterozygosity is associated with heterosis (aka hybrid vigor) but also leads to the production of more variable offspring. When plants have two genetically different parents, heterozygosity levels will be higher than if it has been inbred or backcrossed repeatedly.

Heterozygosity: 1.15%
Least Heterozygous Most Heterozygous

The ratio of reads mapped to Y-contigs to reads mapped to the whole Cannabis genome (Y-ratios) has been demonstrated to be strongly correlated with plant sex typing. This plot shows the distribution of Y-ratios for all samples in our database which were sequenced with the same method (panel or WGS) as this sample and where this sample falls in the distribution.

Y-Ratio Distribution: 0.0393
male female RSP11272

This chart represents the Illumina sequence coverage over the Bt/Bd allele. These are the three regions in the cannabis genome that impact THCA, CBDA, CBGA production. Coverage over the Active CBDAS gene is highly correlated with Type II and Type III plants as described by Etienne de Meijer. Coverage over the THCA gene is highly correlated with Type I and Type II plants but is anti-correlated with Type III plants. Type I plants require coverage over the inactive CBDA loci and no coverage over the Active CBDA gene. Lack of coverage over the Active CBDA and Active THCA allele are presumed to be Type IV plants (CBGA dominant). While deletions of entire THCAS and CBDAS genes are the most common Bt:Bd alleles observed, it is possible to have plants with these genes where functional expression of the enzyme is disrupted by deactivating point mutations (Kojoma et al. 2006).

Bt/Bd Allele Coverage

This chart represents the Illumina sequence coverage over the CBCA synthase gene.

CBCAS Coverage

Variants (THCAS, CBDAS, and CBCAS)

CBDAS c.8G>A p.Cys3Tyr missense variant moderate contig1772 2082234

IGV: Start, Jump

G/A
NGS:
0.057
C90:
0.000
CBDAS c.221C>G p.Thr74Ser missense variant moderate contig1772 2082447

IGV: Start, Jump

C/G
NGS:
0.136
C90:
0.057
CBDAS c.1420A>C p.Lys474Gln missense variant moderate contig1772 2083646

IGV: Start, Jump

A/C
NGS:
0.132
C90:
0.813

Variants (Select Genes of Interest)

GPPs1

UniProt

c.845_848delAAAG p.Glu282fs frameshift variant high contig676 169629

IGV: Start, Jump

TGAAA/T
NGS:
0.118
C90:
0.000
PKSG-4a

UniProt

c.493G>A p.Gly165Ser missense variant moderate contig700 1937904

IGV: Start, Jump

G/A
NGS:
0.103
C90:
0.000
PKSG-4a

UniProt

c.1191_1193delTTA p.Tyr398del disruptive inframe deletion moderate contig700 1938600

IGV: Start, Jump

AATT/A
NGS:
0.167
C90:
0.000
PKSG-2a

UniProt

c.67T>A p.Phe23Ile missense variant moderate contig700 1945567

IGV: Start, Jump

A/T
NGS:
0.825
C90:
0.904
PKSG-2a

UniProt

c.31A>T p.Thr11Ser missense variant moderate contig700 1945603

IGV: Start, Jump

T/A
NGS:
0.763
C90:
0.876
PKSG-2b

UniProt

c.1117A>G p.Ile373Val missense variant moderate contig700 1950521

IGV: Start, Jump

T/C
NGS:
0.807
C90:
0.981
PKSG-2b

UniProt

c.774G>A p.Met258Ile missense variant moderate contig700 1950864

IGV: Start, Jump

C/T
NGS:
0.366
C90:
0.947
PKSG-2b

UniProt

c.31A>T p.Thr11Ser missense variant moderate contig700 1951851

IGV: Start, Jump

T/A
NGS:
0.844
C90:
0.880
PKSG-4b

UniProt

c.496A>G p.Lys166Glu missense variant moderate contig700 2721177

IGV: Start, Jump

T/C
NGS:
0.651
C90:
0.684
PKSG-4b

UniProt

c.489delT p.Phe163fs frameshift variant high contig700 2721183

IGV: Start, Jump

CA/C
NGS:
0.792
C90:
0.761
PKSG-4b

UniProt

c.485A>G p.Lys162Arg missense variant moderate contig700 2721188

IGV: Start, Jump

T/C
NGS:
0.643
C90:
0.301
PKSG-4b

UniProt

c.431T>G p.Val144Gly missense variant moderate contig700 2721242

IGV: Start, Jump

A/C
NGS:
0.575
C90:
0.679
PKSG-4b

UniProt

c.419A>G p.Asp140Gly missense variant moderate contig700 2721254

IGV: Start, Jump

T/C
NGS:
0.430
C90:
0.440
PKSG-4b

UniProt

c.352_355delACAG p.Thr118fs frameshift variant high contig700 2721317

IGV: Start, Jump

CCTGT/C
NGS:
0.529
C90:
0.000
PKSG-4b

UniProt

c.324A>C p.Glu108Asp missense variant moderate contig700 2721349

IGV: Start, Jump

T/G
NGS:
0.094
C90:
0.000
PKSG-4b

UniProt

c.323A>G p.Glu108Gly missense variant moderate contig700 2721350

IGV: Start, Jump

T/C
NGS:
0.469
C90:
0.000
DXR-2

UniProt

c.1319T>C p.Ile440Thr missense variant moderate contig380 285250

IGV: Start, Jump

A/G
NGS:
0.480
C90:
0.000
aPT4

UniProt

c.97T>C p.Tyr33His missense variant moderate contig121 2828753

IGV: Start, Jump

T/C
NGS:
0.439
C90:
0.000
aPT4

UniProt

c.153A>C p.Lys51Asn missense variant moderate contig121 2828809

IGV: Start, Jump

A/C
NGS:
0.375
C90:
0.000
aPT4

UniProt

c.235_236delGT p.Val79fs frameshift variant high contig121 2829030

IGV: Start, Jump

ATG/A
NGS:
0.417
C90:
0.000
aPT4

UniProt

c.238delT p.Ser80fs frameshift variant high contig121 2829034

IGV: Start, Jump

AT/A
NGS:
0.421
C90:
0.000
aPT4

UniProt

c.302A>G p.Asn101Ser missense variant moderate contig121 2829099

IGV: Start, Jump

A/G
NGS:
0.349
C90:
0.000
aPT4

UniProt

c.744+1_744+19delGTAATTTATTTTATTATAA splice donor variant & splice region variant & intron variant high contig121 2831022

IGV: Start, Jump

GGTAATTTATTTTATTATAA/G
NGS:
0.096
C90:
0.000
HDS-2

UniProt

c.82_93delGTAACCGGAACT p.Val28_Thr31del conservative inframe deletion moderate contig95 1989748

IGV: Start, Jump

CGTAACCGGAACT/C
NGS:
0.805
C90:
0.000
HDS-2

UniProt

c.127T>G p.Ser43Ala missense variant moderate contig95 1989794

IGV: Start, Jump

T/G
NGS:
0.721
C90:
0.000

Nearest genetic relatives (All Samples)

0 0.050 0.100 0.150 0.200
clone distance sibling distance more distant
  1. 0.076 Cherry Blossom (RSP11332)
  2. 0.115 Cherry Blossom (RSP11320)
  3. 0.126 Cherry Blossom (RSP11313)
  4. 0.137 Cherry Blossom (RSP11299)
  5. 0.153 Cherry Blossom (RSP11322)
  6. 0.154 Cherry Blossom (RSP11304)
  7. 0.154 Cherry Blossom (RSP11325)
  8. 0.165 Cherry Blossom (RSP11330)
  9. 0.171 Cherry Blossom (RSP11317)
  10. 0.172 Cherry Blossom (RSP11324)
  11. 0.174 Cherry Blossom (RSP11315)
  12. 0.175 Cherry Blossom (RSP11309)
  13. 0.177 Cherry Blossom (RSP11310)
  14. 0.178 Cherry Wine (RSP11307)
  15. 0.179 Cherry Wine (RSP11305)
  16. 0.183 Cherry Blossom (RSP11327)
  17. 0.188 Cherry Blossom CBG (RSP11303)
  18. 0.190 Cherry Blossom (RSP11301)
  19. 0.190 Cherry Blossom (RSP11333)
  20. 0.191 Cherry Blossom (RSP11306)

Nearest genetic relatives (Base Tree)

0 0.092 0.183 0.275 0.367
clone distance sibling distance more distant
  1. 0.260 UP Sunrise (RSP10989)
  2. 0.265 Liberty Haze (RSP11000)
  3. 0.267 Cherry (RSP11142)
  4. 0.268 Cbot-2019-001 (RSP11129)
  5. 0.280 Blueberry Cheesecake (RSP10684)
  6. 0.296 Durban Poison (RSP11014)
  7. 0.303 Recon (RSP10755)
  8. 0.306 Cherry (RSP11143)
  9. 0.313 QUEEN JESUS (RSP10105)
  10. 0.317 RKM-2018-031 (RSP11123)
  11. 0.327 CST (RSP11002)
  12. 0.330 Cbot-2019-004 (RSP11132)
  13. 0.333 Blueberry Cheesecake (RSP10672)
  14. 0.336 Cbot-2019-005 (RSP11133)
  15. 0.337 RKM-2018-020 (RSP11112)
  16. 0.337 Tisza (RSP10659)
  17. 0.339 RKM-2018-003 (RSP11094)
  18. 0.343 RKM-2018-006 (RSP11097)
  19. 0.347 Tygra (RSP10667)
  20. 0.349 Kimbo Slice (RSP10997)

Most genetically distant strains (All Samples)

0 0.117 0.233 0.350 0.467
clone distance sibling distance more distant
  1. 0.454 RKM-2018-002 (RSP11093)
  2. 0.445 Star Dawg (RSP11352)
  3. 0.445 RKM-2018-026 (RSP11118)
  4. 0.443 Chem 91 (RSP11185)
  5. 0.435 Abacus (RSP11266)
  6. 0.432 New York City Deisel (RSP11225)
  7. 0.429 JL yellow (RSP11075)
  8. 0.424 Red Eye OG (RSP11190)
  9. 0.419 White Label 1 (RSP11336)
  10. 0.418 Kush Hemp E1 (RSP11128)
  11. 0.418 Sour D (RSP11343)
  12. 0.417 JL 4th Gen 2 (RSP11194)
  13. 0.416 JL 4th Gen 5 (RSP11199)
  14. 0.416 Rugburn OG (RSP11353)
  15. 0.416 Super Sour Diesel (RSP11191)
  16. 0.415 501st OG (RSP11241)
  17. 0.414 Garlic (RSP11341)
  18. 0.414 Glueberry OG (RSP11222)
  19. 0.413 Danny Noonan (RSP11070)
  20. 0.413 JL 3rd Gen Mother (RSP11214)

Most genetically distant strains (Base Tree)

0 0.117 0.233 0.350 0.467
clone distance sibling distance more distant
  1. 0.455 RKM-2018-002 (RSP11093)
  2. 0.446 RKM-2018-026 (RSP11118)
  3. 0.435 JL yellow (RSP11075)
  4. 0.426 Kush Hemp E1 (RSP11128)
  5. 0.414 Skunk 18 (RSP11038)
  6. 0.410 RKM-2018-018 (RSP11110)
  7. 0.410 Skywalker OG (RSP10837)
  8. 0.407 Hermaphrodite Research Sample1 (RSP11049)
  9. 0.407 RKM-2018-022 (RSP11114)
  10. 0.404 RKM-2018-032 (RSP11124)
  11. 0.401 RKM-2018-034 (RSP11126)
  12. 0.397 RKM-2018-023 (RSP11115)
  13. 0.396 RKM-2018-005 (RSP11096)
  14. 0.395 Pie Hoe (RSP11073)
  15. 0.394 Golden Goat 2 (RSP10991)
  16. 0.393 Black Beauty (RSP11035)
  17. 0.387 RKM-2018-028 (RSP11120)
  18. 0.386 RKM-2018-033 (RSP11125)
  19. 0.383 Sour Raspberry (RSP10551)
  20. 0.382 Cbot-2019-006 (RSP11134)

Nearest genetic relative in Phylos dataset

Phylos Strain SRR8346901
Overlapping SNPs:
70
Concordance:
46

Nearest genetic relative in Lynch dataset

Lynch Strain SRR3495303
Overlapping SNPs:
2
Concordance:
2

Blockchain Registration Information

Transaction ID
895b1dcba1e342a68256b190375c5c2b2e476a0f2a20201b7f8f20ab3db6379c
Stamping Certificate
Download PDF (853.5 KB)
SHASUM Hash
332099f2e14345454faf40d4a4f4dc17556e6c8cea111fb7900208b69587e879
QR code for RSP11272

Kannapedia uses cookies

By clicking Allow All, you agree to the storing of cookies on your device to enhance site navigation, analyze site usage, and assist in our marketing efforts.

Customize Settings