Cherry Blossom

RSP 11274

Grower: Yabba Cannaba

General Information

Sample Name
CG3
Accession Date
October 9, 2019
Reported Plant Sex
Female

The strain rarity visualization shows how distant the strain is from the other cultivars in the Kannapedia database. The y-axis represents genetic distance, getting farther as you go up. The width of the visualization at any position along the y-axis shows how many strains there are in the database at that genetic distance. So, a common strain will have a more bottom-heavy shape, while uncommon and rare cultivars will have a visualization that is generally shifted towards the top.

Rarity: Rare
Most Distant Most Similar

Chemical Information

Cannabinoid and terpenoid information provided by the grower.

Cannabinoids

No information provided.

Terpenoids

No information provided.

Genetic Information

Plant Type
Type III

The bell curve in the heterozygosity visualization shows the distribution of heterozygosity levels for cannabis cultivars in the Kannapedia database. The green line shows where this particular strain fits within the distribution. Heterozygosity is associated with heterosis (aka hybrid vigor) but also leads to the production of more variable offspring. When plants have two genetically different parents, heterozygosity levels will be higher than if it has been inbred or backcrossed repeatedly.

Heterozygosity: 0.9%
Least Heterozygous Most Heterozygous

The ratio of reads mapped to Y-contigs to reads mapped to the whole Cannabis genome (Y-ratios) has been demonstrated to be strongly correlated with plant sex typing. This plot shows the distribution of Y-ratios for all samples in our database which were sequenced with the same method (panel or WGS) as this sample and where this sample falls in the distribution.

Y-Ratio Distribution: 0.0397
male female RSP11274

This chart represents the Illumina sequence coverage over the Bt/Bd allele. These are the three regions in the cannabis genome that impact THCA, CBDA, CBGA production. Coverage over the Active CBDAS gene is highly correlated with Type II and Type III plants as described by Etienne de Meijer. Coverage over the THCA gene is highly correlated with Type I and Type II plants but is anti-correlated with Type III plants. Type I plants require coverage over the inactive CBDA loci and no coverage over the Active CBDA gene. Lack of coverage over the Active CBDA and Active THCA allele are presumed to be Type IV plants (CBGA dominant). While deletions of entire THCAS and CBDAS genes are the most common Bt:Bd alleles observed, it is possible to have plants with these genes where functional expression of the enzyme is disrupted by deactivating point mutations (Kojoma et al. 2006).

Bt/Bd Allele Coverage

This chart represents the Illumina sequence coverage over the CBCA synthase gene.

CBCAS Coverage

Variants (THCAS, CBDAS, and CBCAS)

No variants to report

Variants (Select Genes of Interest)

PKSG-4a

UniProt

c.493G>A p.Gly165Ser missense variant moderate contig700 1937904

IGV: Start, Jump

G/A
NGS:
0.103
C90:
0.000
PKSG-4a

UniProt

c.1191_1193delTTA p.Tyr398del disruptive inframe deletion moderate contig700 1938600

IGV: Start, Jump

AATT/A
NGS:
0.167
C90:
0.000
PKSG-2a

UniProt

c.1117A>G p.Ile373Val missense variant moderate contig700 1944273

IGV: Start, Jump

T/C
NGS:
0.101
C90:
0.967
PKSG-2a

UniProt

c.67T>A p.Phe23Ile missense variant moderate contig700 1945567

IGV: Start, Jump

A/T
NGS:
0.825
C90:
0.904
PKSG-2a

UniProt

c.31A>T p.Thr11Ser missense variant moderate contig700 1945603

IGV: Start, Jump

T/A
NGS:
0.763
C90:
0.876
PKSG-2b

UniProt

c.1152T>A p.Asn384Lys missense variant moderate contig700 1950486

IGV: Start, Jump

A/T
NGS:
0.715
C90:
0.895
PKSG-2b

UniProt

c.1132C>G p.Leu378Val missense variant moderate contig700 1950506

IGV: Start, Jump

G/C
NGS:
0.717
C90:
0.000
PKSG-2b

UniProt

c.1117A>G p.Ile373Val missense variant moderate contig700 1950521

IGV: Start, Jump

T/C
NGS:
0.807
C90:
0.981
PKSG-2b

UniProt

c.774G>A p.Met258Ile missense variant moderate contig700 1950864

IGV: Start, Jump

C/T
NGS:
0.366
C90:
0.947
PKSG-2b

UniProt

c.718T>A p.Phe240Ile missense variant moderate contig700 1950920

IGV: Start, Jump

A/T
NGS:
0.114
C90:
0.000
PKSG-2b

UniProt

c.592A>G p.Asn198Asp missense variant moderate contig700 1951046

IGV: Start, Jump

T/C
NGS:
0.048
C90:
0.000
PKSG-2b

UniProt

c.588T>G p.Asp196Glu missense variant moderate contig700 1951050

IGV: Start, Jump

A/C
NGS:
0.024
C90:
0.000
PKSG-2b

UniProt

c.560C>T p.Thr187Met missense variant moderate contig700 1951078

IGV: Start, Jump

G/A
NGS:
0.050
C90:
0.000
PKSG-2b

UniProt

c.558G>A p.Met186Ile missense variant moderate contig700 1951080

IGV: Start, Jump

C/T
NGS:
0.050
C90:
0.000
PKSG-2b

UniProt

c.241G>A p.Val81Met missense variant moderate contig700 1951397

IGV: Start, Jump

C/T
NGS:
0.154
C90:
0.000
PKSG-2b

UniProt

c.240T>G p.Asp80Glu missense variant moderate contig700 1951398

IGV: Start, Jump

A/C
NGS:
0.156
C90:
0.000
PKSG-2b

UniProt

c.230T>C p.Val77Ala missense variant moderate contig700 1951408

IGV: Start, Jump

A/G
NGS:
0.134
C90:
0.646
PKSG-2b

UniProt

c.224A>G p.Lys75Arg missense variant moderate contig700 1951414

IGV: Start, Jump

T/C
NGS:
0.151
C90:
0.957
PKSG-2b

UniProt

c.188T>G p.Ile63Ser missense variant moderate contig700 1951450

IGV: Start, Jump

A/C
NGS:
0.118
C90:
0.000
PKSG-2b

UniProt

c.187A>T p.Ile63Phe missense variant moderate contig700 1951451

IGV: Start, Jump

T/A
NGS:
0.116
C90:
0.000
PKSG-2b

UniProt

c.167C>G p.Thr56Ser missense variant moderate contig700 1951471

IGV: Start, Jump

G/C
NGS:
0.103
C90:
0.947
PKSG-2b

UniProt

c.31A>T p.Thr11Ser missense variant moderate contig700 1951851

IGV: Start, Jump

T/A
NGS:
0.844
C90:
0.880
PKSG-4b

UniProt

c.556A>G p.Arg186Gly missense variant & splice region variant moderate contig700 2721117

IGV: Start, Jump

T/C
NGS:
0.022
C90:
0.000
PKSG-4b

UniProt

c.496A>G p.Lys166Glu missense variant moderate contig700 2721177

IGV: Start, Jump

T/C
NGS:
0.651
C90:
0.684
PKSG-4b

UniProt

c.489delT p.Phe163fs frameshift variant high contig700 2721183

IGV: Start, Jump

CA/C
NGS:
0.792
C90:
0.761
PKSG-4b

UniProt

c.485A>G p.Lys162Arg missense variant moderate contig700 2721188

IGV: Start, Jump

T/C
NGS:
0.643
C90:
0.301
PKSG-4b

UniProt

c.431T>G p.Val144Gly missense variant moderate contig700 2721242

IGV: Start, Jump

A/C
NGS:
0.575
C90:
0.679
PKSG-4b

UniProt

c.419A>G p.Asp140Gly missense variant moderate contig700 2721254

IGV: Start, Jump

T/C
NGS:
0.430
C90:
0.440
PKSG-4b

UniProt

c.352_355delACAG p.Thr118fs frameshift variant high contig700 2721317

IGV: Start, Jump

CCTGT/C
NGS:
0.529
C90:
0.000
PKSG-4b

UniProt

c.324A>C p.Glu108Asp missense variant moderate contig700 2721349

IGV: Start, Jump

T/G
NGS:
0.094
C90:
0.000
PKSG-4b

UniProt

c.323A>G p.Glu108Gly missense variant moderate contig700 2721350

IGV: Start, Jump

T/C
NGS:
0.469
C90:
0.000
aPT4

UniProt

c.97T>C p.Tyr33His missense variant moderate contig121 2828753

IGV: Start, Jump

T/C
NGS:
0.439
C90:
0.000
aPT4

UniProt

c.153A>C p.Lys51Asn missense variant moderate contig121 2828809

IGV: Start, Jump

A/C
NGS:
0.375
C90:
0.000
aPT4

UniProt

c.235_236delGT p.Val79fs frameshift variant high contig121 2829030

IGV: Start, Jump

ATG/A
NGS:
0.417
C90:
0.000
aPT4

UniProt

c.238delT p.Ser80fs frameshift variant high contig121 2829034

IGV: Start, Jump

AT/A
NGS:
0.421
C90:
0.000
aPT4

UniProt

c.302A>G p.Asn101Ser missense variant moderate contig121 2829099

IGV: Start, Jump

A/G
NGS:
0.349
C90:
0.000
aPT4

UniProt

c.744+1_744+19delGTAATTTATTTTATTATAA splice donor variant & splice region variant & intron variant high contig121 2831022

IGV: Start, Jump

GGTAATTTATTTTATTATAA/G
NGS:
0.096
C90:
0.000
HDS-2

UniProt

c.82_93delGTAACCGGAACT p.Val28_Thr31del conservative inframe deletion moderate contig95 1989748

IGV: Start, Jump

CGTAACCGGAACT/C
NGS:
0.805
C90:
0.000
HDS-2

UniProt

c.127T>G p.Ser43Ala missense variant moderate contig95 1989794

IGV: Start, Jump

T/G
NGS:
0.721
C90:
0.000

Nearest genetic relatives (All Samples)

0 0.067 0.133 0.200 0.267
clone distance sibling distance more distant
  1. 0.116 Cherry Blossom (RSP11320)
  2. 0.168 Cherry Blossom (RSP11316)
  3. 0.176 Cherry Blossom (RSP11327)
  4. 0.203 Unknown- Cherry Wine - 001 (RSP11268)
  5. 0.205 Cherry Blossom (RSP11314)
  6. 0.210 Unknown- Cherry Wine - 002 (RSP11269)
  7. 0.217 Cherry Blossom (RSP11323)
  8. 0.220 Cherry Blossom (RSP11321)
  9. 0.227 Unknown- Cherry Wine - 005 (RSP11272)
  10. 0.232 Cherry Blossom (RSP11318)
  11. 0.233 Cherry Blossom (RSP11319)
  12. 0.237 Cherry Blossom (RSP11302)
  13. 0.243 Cherry Blossom (RSP11308)
  14. 0.244 Cherry Blossom (RSP11335)
  15. 0.247 Cherry Blossom (RSP11304)
  16. 0.248 Queen Dream CBG (RSP11295)
  17. 0.249 Cherry Blossom (RSP11311)
  18. 0.250 Cherry Blossom (RSP11299)
  19. 0.255 Cherry Blossom (RSP11322)
  20. 0.258 Cherry Blossom (RSP11326)

Nearest genetic relatives (Base Tree)

0 0.100 0.200 0.300 0.400
clone distance sibling distance more distant
  1. 0.298 QUEEN JESUS (RSP10105)
  2. 0.317 Blueberry Cheesecake (RSP10684)
  3. 0.338 Liberty Haze (RSP11000)
  4. 0.341 Blueberry Cheesecake (RSP10672)
  5. 0.348 Cbot-2019-004 (RSP11132)
  6. 0.351 UP Sunrise (RSP10989)
  7. 0.358 RKM-2018-006 (RSP11097)
  8. 0.359 RKM-2018-019 (RSP11111)
  9. 0.366 Durban Poison (RSP11014)
  10. 0.367 Cbot-2019-005 (RSP11133)
  11. 0.377 Cherry (RSP11142)
  12. 0.378 Tygra (RSP10667)
  13. 0.379 RKM-2018-005 (RSP11096)
  14. 0.379 RKM-2018-028 (RSP11120)
  15. 0.382 Tisza (RSP10659)
  16. 0.385 Hermaphrodite ResearchSample2 (RSP11050)
  17. 0.386 Italian Kiss (RSP11034)
  18. 0.387 Sour Raspberry (RSP10551)
  19. 0.389 Cherry (RSP11143)
  20. 0.389 Cbot-2019-001 (RSP11129)

Most genetically distant strains (All Samples)

0 0.133 0.267 0.400 0.533
clone distance sibling distance more distant
  1. 0.508 White Label 1 (RSP11336)
  2. 0.491 80E (RSP11213)
  3. 0.483 RKM-2018-026 (RSP11118)
  4. 0.483 80E (RSP11211)
  5. 0.469 Garlic (RSP11341)
  6. 0.468 Chem 91 (RSP11185)
  7. 0.464 80E (RSP11212)
  8. 0.462 Star Dawg (RSP11352)
  9. 0.457 Abacus (RSP11266)
  10. 0.455 RKM-2018-002 (RSP11093)
  11. 0.452 Dominion Skunk (RSP11354)
  12. 0.450 Red Eye OG (RSP11190)
  13. 0.449 Skywalker OG (RSP10837)
  14. 0.441 Glueberry OG (RSP11222)
  15. 0.440 Rugburn OG (RSP11353)
  16. 0.439 501st OG (RSP11241)
  17. 0.438 JL 4th Gen 4 (RSP11198)
  18. 0.438 RKM-2018-013 (RSP11104)
  19. 0.437 SFVxTK (RSP11072)
  20. 0.436 JL yellow (RSP11075)

Most genetically distant strains (Base Tree)

0 0.125 0.250 0.375 0.500
clone distance sibling distance more distant
  1. 0.481 RKM-2018-026 (RSP11118)
  2. 0.455 RKM-2018-002 (RSP11093)
  3. 0.444 Skywalker OG (RSP10837)
  4. 0.441 Cbot-2019-006 (RSP11134)
  5. 0.436 Kush Hemp E1 (RSP11128)
  6. 0.435 JL yellow (RSP11075)
  7. 0.422 Monoica (RSP10241)
  8. 0.421 RKM-2018-032 (RSP11124)
  9. 0.421 Skunk 18 (RSP11038)
  10. 0.420 RKM-2018-033 (RSP11125)
  11. 0.419 RKM-2018-023 (RSP11115)
  12. 0.417 RKM-2018-009 (RSP11100)
  13. 0.417 Hermaphrodite Research Sample1 (RSP11049)
  14. 0.416 RKM-2018-020 (RSP11112)
  15. 0.416 Pie Hoe (RSP11073)
  16. 0.415 Golden Goat 2 (RSP10991)
  17. 0.415 RKM-2018-022 (RSP11114)
  18. 0.414 RKM-2018-027 (RSP11119)
  19. 0.413 Blueberry Cheesecake (RSP10680)
  20. 0.412 Santhica27 (RSP11047)

Nearest genetic relative in Phylos dataset

Phylos Strain SRR8346543
Overlapping SNPs:
70
Concordance:
42

Nearest genetic relative in Lynch dataset

Lynch Strain SRR3495209
Overlapping SNPs:
3
Concordance:
3

Blockchain Registration Information

Transaction ID
62c68eb3751c85da10b0a55e70e42842d073781338258396c3d916e35034931e
Stamping Certificate
Download PDF (859.8 KB)
SHASUM Hash
b68349d3dbf2ef71750471c1f446acd1aeec45e94ee259352bd9505a39fec08a
QR code for RSP11274

Kannapedia uses cookies

By clicking Allow All, you agree to the storing of cookies on your device to enhance site navigation, analyze site usage, and assist in our marketing efforts.

Customize Settings