Queen Dream CBG

RSP 11275

Grower: Yabba Cannaba

General Information

Sample Name
LD2
Accession Date
October 9, 2019
Reported Plant Sex
Female

The strain rarity visualization shows how distant the strain is from the other cultivars in the Kannapedia database. The y-axis represents genetic distance, getting farther as you go up. The width of the visualization at any position along the y-axis shows how many strains there are in the database at that genetic distance. So, a common strain will have a more bottom-heavy shape, while uncommon and rare cultivars will have a visualization that is generally shifted towards the top.

Rarity: Uncommon
Most Distant Most Similar

Chemical Information

Cannabinoid and terpenoid information provided by the grower.

Cannabinoids

No information provided.

Terpenoids

No information provided.

Genetic Information

Plant Type
Type III

The bell curve in the heterozygosity visualization shows the distribution of heterozygosity levels for cannabis cultivars in the Kannapedia database. The green line shows where this particular strain fits within the distribution. Heterozygosity is associated with heterosis (aka hybrid vigor) but also leads to the production of more variable offspring. When plants have two genetically different parents, heterozygosity levels will be higher than if it has been inbred or backcrossed repeatedly.

Heterozygosity: 0.99%
Least Heterozygous Most Heterozygous

The ratio of reads mapped to Y-contigs to reads mapped to the whole Cannabis genome (Y-ratios) has been demonstrated to be strongly correlated with plant sex typing. This plot shows the distribution of Y-ratios for all samples in our database which were sequenced with the same method (panel or WGS) as this sample and where this sample falls in the distribution.

Y-Ratio Distribution: 0.0433
male female RSP11275

This chart represents the Illumina sequence coverage over the Bt/Bd allele. These are the three regions in the cannabis genome that impact THCA, CBDA, CBGA production. Coverage over the Active CBDAS gene is highly correlated with Type II and Type III plants as described by Etienne de Meijer. Coverage over the THCA gene is highly correlated with Type I and Type II plants but is anti-correlated with Type III plants. Type I plants require coverage over the inactive CBDA loci and no coverage over the Active CBDA gene. Lack of coverage over the Active CBDA and Active THCA allele are presumed to be Type IV plants (CBGA dominant). While deletions of entire THCAS and CBDAS genes are the most common Bt:Bd alleles observed, it is possible to have plants with these genes where functional expression of the enzyme is disrupted by deactivating point mutations (Kojoma et al. 2006).

Bt/Bd Allele Coverage

This chart represents the Illumina sequence coverage over the CBCA synthase gene.

CBCAS Coverage

Variants (THCAS, CBDAS, and CBCAS)

No variants to report

Variants (Select Genes of Interest)

PKSG-4a

UniProt

c.1191_1193delTTA p.Tyr398del disruptive inframe deletion moderate contig700 1938600

IGV: Start, Jump

AATT/A
NGS:
0.167
C90:
0.000
PKSG-2b

UniProt

c.1152T>A p.Asn384Lys missense variant moderate contig700 1950486

IGV: Start, Jump

A/T
NGS:
0.715
C90:
0.895
PKSG-2b

UniProt

c.1132C>G p.Leu378Val missense variant moderate contig700 1950506

IGV: Start, Jump

G/C
NGS:
0.717
C90:
0.000
PKSG-2b

UniProt

c.1117A>G p.Ile373Val missense variant moderate contig700 1950521

IGV: Start, Jump

T/C
NGS:
0.807
C90:
0.981
PKSG-2b

UniProt

c.948T>G p.Asp316Glu missense variant moderate contig700 1950690

IGV: Start, Jump

A/C
NGS:
0.456
C90:
0.000
PKSG-2b

UniProt

c.945T>G p.Ser315Arg missense variant moderate contig700 1950693

IGV: Start, Jump

A/C
NGS:
0.454
C90:
0.000
PKSG-2b

UniProt

c.944G>A p.Ser315Asn missense variant moderate contig700 1950694

IGV: Start, Jump

C/T
NGS:
0.445
C90:
0.000
PKSG-2b

UniProt

c.934C>G p.His312Asp missense variant moderate contig700 1950704

IGV: Start, Jump

G/C
NGS:
0.410
C90:
0.000
PKSG-2b

UniProt

c.31A>T p.Thr11Ser missense variant moderate contig700 1951851

IGV: Start, Jump

T/A
NGS:
0.844
C90:
0.880
PKSG-2b

UniProt

c.-2_1dupATA start lost & conservative inframe insertion high contig700 1951880

IGV: Start, Jump

A/ATAT
NGS:
0.410
C90:
0.000
PKSG-4b

UniProt

c.496A>G p.Lys166Glu missense variant moderate contig700 2721177

IGV: Start, Jump

T/C
NGS:
0.651
C90:
0.684
PKSG-4b

UniProt

c.489delT p.Phe163fs frameshift variant high contig700 2721183

IGV: Start, Jump

CA/C
NGS:
0.792
C90:
0.761
PKSG-4b

UniProt

c.485A>G p.Lys162Arg missense variant moderate contig700 2721188

IGV: Start, Jump

T/C
NGS:
0.643
C90:
0.301
PKSG-4b

UniProt

c.352_355delACAG p.Thr118fs frameshift variant high contig700 2721317

IGV: Start, Jump

CCTGT/C
NGS:
0.529
C90:
0.000
aPT4

UniProt

c.235_236delGT p.Val79fs frameshift variant high contig121 2829030

IGV: Start, Jump

ATG/A
NGS:
0.417
C90:
0.000
aPT4

UniProt

c.238delT p.Ser80fs frameshift variant high contig121 2829034

IGV: Start, Jump

AT/A
NGS:
0.421
C90:
0.000
aPT4

UniProt

c.302A>G p.Asn101Ser missense variant moderate contig121 2829099

IGV: Start, Jump

A/G
NGS:
0.349
C90:
0.000
aPT4

UniProt

c.744+1_744+19delGTAATTTATTTTATTATAA splice donor variant & splice region variant & intron variant high contig121 2831022

IGV: Start, Jump

GGTAATTTATTTTATTATAA/G
NGS:
0.096
C90:
0.000
aPT4

UniProt

c.1168T>C p.Tyr390His missense variant moderate contig121 2833503

IGV: Start, Jump

T/C
NGS:
0.546
C90:
0.000
aPT1

UniProt

c.629C>T p.Thr210Ile missense variant moderate contig121 2840237

IGV: Start, Jump

C/T
NGS:
0.561
C90:
0.598
HDS-2

UniProt

c.82_93delGTAACCGGAACT p.Val28_Thr31del conservative inframe deletion moderate contig95 1989748

IGV: Start, Jump

CGTAACCGGAACT/C
NGS:
0.805
C90:
0.000
HDS-2

UniProt

c.127T>G p.Ser43Ala missense variant moderate contig95 1989794

IGV: Start, Jump

T/G
NGS:
0.721
C90:
0.000

Nearest genetic relatives (All Samples)

0 0.058 0.117 0.175 0.233
clone distance sibling distance more distant
  1. 0.115 Queen Dream CBG (RSP11296)
  2. 0.159 Queen Dream CBG (RSP11283)
  3. 0.160 Queen Dream (RSP11291)
  4. 0.160 Queen Dream CBG (RSP11285)
  5. 0.174 Queen Dream CBG (RSP11297)
  6. 0.177 Hot Blonde (RSP11292)
  7. 0.177 Electra (RSP11366)
  8. 0.185 Trump x Trump (RSP11466)
  9. 0.192 Queen Dream (RSP11289)
  10. 0.194 FL30 7 11 2019 (RSP11361)
  11. 0.195 Queen Dream CBG (RSP11276)
  12. 0.198 Domnesia (RSP11184)
  13. 0.198 Rest (RSP11377)
  14. 0.199 Queen Dream CBG (RSP11295)
  15. 0.205 MBD (RSP11368)
  16. 0.210 Queen Dream CBG (RSP11280)
  17. 0.210 Queen Dream CBG (RSP11287)
  18. 0.212 Doug s Varin (RSP11243)
  19. 0.213 Lift (RSP11378)
  20. 0.215 Suver Haze (RSP11364)

Nearest genetic relatives (Base Tree)

0 0.083 0.167 0.250 0.333
clone distance sibling distance more distant
  1. 0.210 Liberty Haze (RSP11000)
  2. 0.222 UP Sunrise (RSP10989)
  3. 0.229 Cbot-2019-001 (RSP11129)
  4. 0.255 Blueberry Cheesecake (RSP10684)
  5. 0.271 Gold Cracker (RSP11048)
  6. 0.275 RKM-2018-006 (RSP11097)
  7. 0.278 RKM-2018-028 (RSP11120)
  8. 0.281 Recon (RSP10755)
  9. 0.288 Durban Poison (RSP11014)
  10. 0.288 RKM-2018-020 (RSP11112)
  11. 0.291 Cbot-2019-006 (RSP11134)
  12. 0.294 Queen Jesus (RSP10105)
  13. 0.302 RKM-2018-009 (RSP11100)
  14. 0.302 Golden Goat 2 (RSP10991)
  15. 0.304 Cbot-2019-004 (RSP11132)
  16. 0.307 RKM-2018-003 (RSP11094)
  17. 0.309 Kimbo Slice (RSP10997)
  18. 0.310 Blue Dream (RSP11033)
  19. 0.310 RKM-2018-031 (RSP11123)
  20. 0.311 Kush Hemp E1 (RSP11128)

Most genetically distant strains (All Samples)

0 0.117 0.233 0.350 0.467
clone distance sibling distance more distant
  1. 0.462 Cherry Blossom (RSP11298)
  2. 0.446 GMO x Zkittlez #43 (RSP11976)
  3. 0.437 Cherry Blossom (RSP11309)
  4. 0.436 CHEM4 (RSP12090)
  5. 0.431 Fatso (RSP11741)
  6. 0.430 Chem 91 (RSP11185)
  7. 0.430 Star Dawg (RSP11352)
  8. 0.424 RKM-2018-002 (RSP11093)
  9. 0.423 BagSeed (RSP12501)
  10. 0.422 R3in134 (SRR14708220)
  11. 0.420 New York City Deisel (RSP11225)
  12. 0.420 80E (RSP11211)
  13. 0.420 80E (RSP11213)
  14. 0.415 BagSeed (RSP12627)
  15. 0.414 Tiger Tail -30- (RSP11484)
  16. 0.412 R1in136 (SRR14708226)
  17. 0.412 IUP2 (SRR14708257)
  18. 0.412 CS Indica (RSP11658)
  19. 0.412 Cherry Blossom (RSP11323)
  20. 0.411 R3in134 (SRR14708218)

Most genetically distant strains (Base Tree)

0 0.108 0.217 0.325 0.433
clone distance sibling distance more distant
  1. 0.432 RKM-2018-002 (RSP11093)
  2. 0.403 Feral (RSP10890)
  3. 0.401 Skywalker OG (RSP10837)
  4. 0.399 JL yellow (RSP11075)
  5. 0.388 Ivory (RSP10668)
  6. 0.386 RKM-2018-034 (RSP11126)
  7. 0.385 RKM-2018-026 (RSP11118)
  8. 0.383 Carmagnola (RSP11037)
  9. 0.380 Monoica (RSP10241)
  10. 0.378 RKM-2018-004 (RSP11096)
  11. 0.376 Jiangji (RSP10653)
  12. 0.368 Santhica27 (RSP11047)
  13. 0.368 Kyrgyz Gold (RSP11054)
  14. 0.365 Carmagnola (RSP10979)
  15. 0.362 KYRG-11 (RSP11051)
  16. 0.359 Sour Raspberry (RSP10551)
  17. 0.357 Tisza (RSP11044)
  18. 0.356 Lovrin (RSP10658)
  19. 0.354 Fedora 17 (RSP10661)
  20. 0.346 Futura 75 (RSP10664)

Nearest genetic relative in Phylos dataset

Phylos Strain SRR4448357
Overlapping SNPs:
69
Concordance:
43

Nearest genetic relative in Lynch dataset

Lynch Strain SRR3495223
Overlapping SNPs:
11
Concordance:
11

Blockchain Registration Information

Transaction ID
f3e3cbe081de028c91dd8a856cbb31d69873e09d84ce5fec8b864136da3f5746
Stamping Certificate
Download PDF (865.9 KB)
SHASUM Hash
f6f11f8c77b2583b7149ab6019500ac21382d1fbca1e6d42abe3c298353f8c50
QR code for RSP11275

Kannapedia uses cookies

By clicking Allow All, you agree to the storing of cookies on your device to enhance site navigation, analyze site usage, and assist in our marketing efforts.

Customize Settings