Queen Dream CBG

RSP 11280

Grower: Yabba Cannaba

General Information

Sample Name
HK3
Accession Date
October 9, 2019
Reported Plant Sex
Female

The strain rarity visualization shows how distant the strain is from the other cultivars in the Kannapedia database. The y-axis represents genetic distance, getting farther as you go up. The width of the visualization at any position along the y-axis shows how many strains there are in the database at that genetic distance. So, a common strain will have a more bottom-heavy shape, while uncommon and rare cultivars will have a visualization that is generally shifted towards the top.

Rarity: Uncommon
Most Distant Most Similar

Chemical Information

Cannabinoid and terpenoid information provided by the grower.

Cannabinoids

No information provided.

Terpenoids

No information provided.

Genetic Information

Plant Type
Type III

The bell curve in the heterozygosity visualization shows the distribution of heterozygosity levels for cannabis cultivars in the Kannapedia database. The green line shows where this particular strain fits within the distribution. Heterozygosity is associated with heterosis (aka hybrid vigor) but also leads to the production of more variable offspring. When plants have two genetically different parents, heterozygosity levels will be higher than if it has been inbred or backcrossed repeatedly.

Heterozygosity: 1.02%
Least Heterozygous Most Heterozygous

The ratio of reads mapped to Y-contigs to reads mapped to the whole Cannabis genome (Y-ratios) has been demonstrated to be strongly correlated with plant sex typing. This plot shows the distribution of Y-ratios for all samples in our database which were sequenced with the same method (panel or WGS) as this sample and where this sample falls in the distribution.

Y-Ratio Distribution: 0.0430
male female RSP11280

This chart represents the Illumina sequence coverage over the Bt/Bd allele. These are the three regions in the cannabis genome that impact THCA, CBDA, CBGA production. Coverage over the Active CBDAS gene is highly correlated with Type II and Type III plants as described by Etienne de Meijer. Coverage over the THCA gene is highly correlated with Type I and Type II plants but is anti-correlated with Type III plants. Type I plants require coverage over the inactive CBDA loci and no coverage over the Active CBDA gene. Lack of coverage over the Active CBDA and Active THCA allele are presumed to be Type IV plants (CBGA dominant). While deletions of entire THCAS and CBDAS genes are the most common Bt:Bd alleles observed, it is possible to have plants with these genes where functional expression of the enzyme is disrupted by deactivating point mutations (Kojoma et al. 2006).

Bt/Bd Allele Coverage

This chart represents the Illumina sequence coverage over the CBCA synthase gene.

CBCAS Coverage

Variants (THCAS, CBDAS, and CBCAS)

No variants to report

Variants (Select Genes of Interest)

GPPs1

UniProt

c.845_848delAAAG p.Glu282fs frameshift variant high contig676 169629

IGV: Start, Jump

TGAAA/T
NGS:
0.118
C90:
0.000
PKSG-4a

UniProt

c.493G>A p.Gly165Ser missense variant moderate contig700 1937904

IGV: Start, Jump

G/A
NGS:
0.103
C90:
0.000
PKSG-4a

UniProt

c.1191_1193delTTA p.Tyr398del disruptive inframe deletion moderate contig700 1938600

IGV: Start, Jump

AATT/A
NGS:
0.167
C90:
0.000
PKSG-2a

UniProt

c.67T>A p.Phe23Ile missense variant moderate contig700 1945567

IGV: Start, Jump

A/T
NGS:
0.825
C90:
0.904
PKSG-2a

UniProt

c.31A>T p.Thr11Ser missense variant moderate contig700 1945603

IGV: Start, Jump

T/A
NGS:
0.763
C90:
0.876
PKSG-2b

UniProt

c.1152T>A p.Asn384Lys missense variant moderate contig700 1950486

IGV: Start, Jump

A/T
NGS:
0.715
C90:
0.895
PKSG-2b

UniProt

c.1132C>G p.Leu378Val missense variant moderate contig700 1950506

IGV: Start, Jump

G/C
NGS:
0.717
C90:
0.000
PKSG-2b

UniProt

c.1117A>G p.Ile373Val missense variant moderate contig700 1950521

IGV: Start, Jump

T/C
NGS:
0.807
C90:
0.981
PKSG-2b

UniProt

c.948T>G p.Asp316Glu missense variant moderate contig700 1950690

IGV: Start, Jump

A/C
NGS:
0.456
C90:
0.000
PKSG-2b

UniProt

c.945T>G p.Ser315Arg missense variant moderate contig700 1950693

IGV: Start, Jump

A/C
NGS:
0.454
C90:
0.000
PKSG-2b

UniProt

c.944G>A p.Ser315Asn missense variant moderate contig700 1950694

IGV: Start, Jump

C/T
NGS:
0.445
C90:
0.000
PKSG-2b

UniProt

c.934C>G p.His312Asp missense variant moderate contig700 1950704

IGV: Start, Jump

G/C
NGS:
0.410
C90:
0.000
PKSG-2b

UniProt

c.774G>A p.Met258Ile missense variant moderate contig700 1950864

IGV: Start, Jump

C/T
NGS:
0.366
C90:
0.947
PKSG-2b

UniProt

c.31A>T p.Thr11Ser missense variant moderate contig700 1951851

IGV: Start, Jump

T/A
NGS:
0.844
C90:
0.880
PKSG-2b

UniProt

c.-2_1dupATA start lost & conservative inframe insertion high contig700 1951880

IGV: Start, Jump

A/ATAT
NGS:
0.410
C90:
0.000
PKSG-4b

UniProt

c.496A>G p.Lys166Glu missense variant moderate contig700 2721177

IGV: Start, Jump

T/C
NGS:
0.651
C90:
0.684
PKSG-4b

UniProt

c.489delT p.Phe163fs frameshift variant high contig700 2721183

IGV: Start, Jump

CA/C
NGS:
0.792
C90:
0.761
PKSG-4b

UniProt

c.485A>G p.Lys162Arg missense variant moderate contig700 2721188

IGV: Start, Jump

T/C
NGS:
0.643
C90:
0.301
PKSG-4b

UniProt

c.352_355delACAG p.Thr118fs frameshift variant high contig700 2721317

IGV: Start, Jump

CCTGT/C
NGS:
0.529
C90:
0.000
PKSG-4b

UniProt

c.324A>C p.Glu108Asp missense variant moderate contig700 2721349

IGV: Start, Jump

T/G
NGS:
0.094
C90:
0.000
PKSG-4b

UniProt

c.323A>G p.Glu108Gly missense variant moderate contig700 2721350

IGV: Start, Jump

T/C
NGS:
0.469
C90:
0.000
DXR-2

UniProt

c.1319T>C p.Ile440Thr missense variant moderate contig380 285250

IGV: Start, Jump

A/G
NGS:
0.480
C90:
0.000
DXR-2

UniProt

c.431C>G p.Ala144Gly missense variant moderate contig380 287760

IGV: Start, Jump

G/C
NGS:
0.182
C90:
0.550
aPT4

UniProt

c.16G>A p.Val6Ile missense variant moderate contig121 2828672

IGV: Start, Jump

G/A
NGS:
0.158
C90:
0.000
aPT4

UniProt

c.97T>C p.Tyr33His missense variant moderate contig121 2828753

IGV: Start, Jump

T/C
NGS:
0.439
C90:
0.000
aPT4

UniProt

c.153A>C p.Lys51Asn missense variant moderate contig121 2828809

IGV: Start, Jump

A/C
NGS:
0.375
C90:
0.000
aPT4

UniProt

c.235_236delGT p.Val79fs frameshift variant high contig121 2829030

IGV: Start, Jump

ATG/A
NGS:
0.417
C90:
0.000
aPT4

UniProt

c.238delT p.Ser80fs frameshift variant high contig121 2829034

IGV: Start, Jump

AT/A
NGS:
0.421
C90:
0.000
aPT4

UniProt

c.302A>G p.Asn101Ser missense variant moderate contig121 2829099

IGV: Start, Jump

A/G
NGS:
0.349
C90:
0.000
aPT4

UniProt

c.744+1_744+19delGTAATTTATTTTATTATAA splice donor variant & splice region variant & intron variant high contig121 2831022

IGV: Start, Jump

GGTAATTTATTTTATTATAA/G
NGS:
0.096
C90:
0.000
aPT4

UniProt

c.1168T>C p.Tyr390His missense variant moderate contig121 2833503

IGV: Start, Jump

T/C
NGS:
0.546
C90:
0.000
aPT1

UniProt

c.629C>T p.Thr210Ile missense variant moderate contig121 2840237

IGV: Start, Jump

C/T
NGS:
0.561
C90:
0.598
HDS-2

UniProt

c.82_93delGTAACCGGAACT p.Val28_Thr31del conservative inframe deletion moderate contig95 1989748

IGV: Start, Jump

CGTAACCGGAACT/C
NGS:
0.805
C90:
0.000
HDS-2

UniProt

c.127T>G p.Ser43Ala missense variant moderate contig95 1989794

IGV: Start, Jump

T/G
NGS:
0.721
C90:
0.000

Nearest genetic relatives (All Samples)

0 0.058 0.117 0.175 0.233
clone distance sibling distance more distant
  1. 0.158 Queen Dream (RSP11289)
  2. 0.163 Queen Dream (RSP11288)
  3. 0.165 Serious Happiness (RSP10763)
  4. 0.166 Blue Dream (RSP11010)
  5. 0.169 Domnesia (RSP11184)
  6. 0.182 Super Blue Dream (RSP11011)
  7. 0.186 Queen Dream CBG (RSP11286)
  8. 0.186 Blue Dream (RSP11004)
  9. 0.187 Queen Dream CBG (RSP11277)
  10. 0.188 TI (RSP11149)
  11. 0.189 Blue Dream (RSP11017)
  12. 0.190 Doug s Varin (RSP11243)
  13. 0.191 Rest (RSP11377)
  14. 0.191 Electra (RSP11366)
  15. 0.192 Trump x Trump (RSP11466)
  16. 0.194 Blue Dream (RSP11006)
  17. 0.200 Blue Dream (RSP11009)
  18. 0.201 Blue Dream (RSP11007)
  19. 0.203 Blue Dream (RSP11008)
  20. 0.204 Blueberry Cheesecake (RSP10684)

Nearest genetic relatives (Base Tree)

0 0.083 0.167 0.250 0.333
clone distance sibling distance more distant
  1. 0.228 Blueberry Cheesecake (RSP10684)
  2. 0.247 RKM-2018-028 (RSP11120)
  3. 0.249 Golden Goat 2 (RSP10991)
  4. 0.249 UP Sunrise (RSP10989)
  5. 0.249 Blue Dream (RSP11033)
  6. 0.249 Hermaphrodite Research Sample1 (RSP11049)
  7. 0.256 RKM-2018-009 (RSP11100)
  8. 0.258 Liberty Haze (RSP11000)
  9. 0.265 Gold Cracker (RSP11048)
  10. 0.274 Recon (RSP10755)
  11. 0.282 Queen Jesus (RSP10105)
  12. 0.282 Sour Raspberry (RSP10551)
  13. 0.284 RKM-2018-032 (RSP11124)
  14. 0.285 Durban Poison (RSP11014)
  15. 0.286 RKM-2018-006 (RSP11097)
  16. 0.290 RKM-2018-020 (RSP11112)
  17. 0.299 Kimbo Slice (RSP10997)
  18. 0.299 RKM-2018-018 (RSP11110)
  19. 0.302 Hermaphrodite ResearchSample2 (RSP11050)
  20. 0.302 Italian Kiss (RSP11034)

Most genetically distant strains (All Samples)

0 0.117 0.233 0.350 0.467
clone distance sibling distance more distant
  1. 0.462 Cherry Blossom (RSP11328)
  2. 0.420 80E (RSP11211)
  3. 0.418 VIR 483 (SRR14708239)
  4. 0.417 Feral (RSP11206)
  5. 0.414 80E (RSP11213)
  6. 0.413 JL yellow (RSP11075)
  7. 0.410 Cherry Blossom (RSP11311)
  8. 0.408 R1in136 (SRR14708226)
  9. 0.408 White Label 1 (RSP11336)
  10. 0.408 Delta-llosa (SRR14708272)
  11. 0.406 JL 3rd Gen Mother (RSP11214)
  12. 0.405 Swiss Dream (RSP11408)
  13. 0.405 Northern Lights (RSP11501)
  14. 0.405 R1in136 (SRR14708237)
  15. 0.404 R3in134 (SRR14708220)
  16. 0.403 R1in136 (SRR14708225)
  17. 0.403 IUP3 (SRR14708256)
  18. 0.402 Beniko (SRR14708275)
  19. 0.401 Bialobrzeskie (SRR14708244)
  20. 0.401 Tiger Tail -30- (RSP11484)

Most genetically distant strains (Base Tree)

0 0.108 0.217 0.325 0.433
clone distance sibling distance more distant
  1. 0.406 JL yellow (RSP11075)
  2. 0.401 Feral (RSP10890)
  3. 0.383 Futura 75 (RSP10664)
  4. 0.381 Lovrin (RSP10658)
  5. 0.380 Carmagnola (RSP11037)
  6. 0.378 Monoica (RSP10241)
  7. 0.377 Ivory (RSP10668)
  8. 0.376 RKM-2018-026 (RSP11118)
  9. 0.372 Santhica27 (RSP11047)
  10. 0.370 Fedora 17 (RSP10661)
  11. 0.366 USO 31 (RSP10981)
  12. 0.362 Kyrgyz Gold (RSP11054)
  13. 0.361 KYRG-11 (RSP11051)
  14. 0.360 RKM-2018-002 (RSP11093)
  15. 0.360 Jiangji (RSP10653)
  16. 0.357 Carmagnola (RSP10979)
  17. 0.355 Tisza (RSP11044)
  18. 0.354 Blueberry Cheesecake (RSP10672)
  19. 0.351 Tisza (RSP10659)
  20. 0.340 RKM-2018-004 (RSP11096)

Nearest genetic relative in Phylos dataset

Phylos Strain SRR4450138
Overlapping SNPs:
7
Concordance:
5

Nearest genetic relative in Lynch dataset

Lynch Strain SRR3495212
Overlapping SNPs:
11
Concordance:
9

Blockchain Registration Information

Transaction ID
39e4cc5ffa971bbdec2ca716e16bcdc7d0fa8c709445c21c2757a4a06a0f2edc
Stamping Certificate
Download PDF (840.4 KB)
SHASUM Hash
22cc146cd5fa6d4935432e6e74ab93b25e0b06b1e1ea8627b15f00767e07a10d
QR code for RSP11280

Kannapedia uses cookies

By clicking Allow All, you agree to the storing of cookies on your device to enhance site navigation, analyze site usage, and assist in our marketing efforts.

Customize Settings