Queen Dream

RSP 11288

Grower: Yabba Cannaba

General Information

Sample Name
LF2
Accession Date
October 9, 2019
Reported Plant Sex
Female

The strain rarity visualization shows how distant the strain is from the other cultivars in the Kannapedia database. The y-axis represents genetic distance, getting farther as you go up. The width of the visualization at any position along the y-axis shows how many strains there are in the database at that genetic distance. So, a common strain will have a more bottom-heavy shape, while uncommon and rare cultivars will have a visualization that is generally shifted towards the top.

Rarity: Uncommon
Most Distant Most Similar

Chemical Information

Cannabinoid and terpenoid information provided by the grower.

Cannabinoids

No information provided.

Terpenoids

No information provided.

Genetic Information

Plant Type
Type III

The bell curve in the heterozygosity visualization shows the distribution of heterozygosity levels for cannabis cultivars in the Kannapedia database. The green line shows where this particular strain fits within the distribution. Heterozygosity is associated with heterosis (aka hybrid vigor) but also leads to the production of more variable offspring. When plants have two genetically different parents, heterozygosity levels will be higher than if it has been inbred or backcrossed repeatedly.

Heterozygosity: 1.05%
Least Heterozygous Most Heterozygous

The ratio of reads mapped to Y-contigs to reads mapped to the whole Cannabis genome (Y-ratios) has been demonstrated to be strongly correlated with plant sex typing. This plot shows the distribution of Y-ratios for all samples in our database which were sequenced with the same method (panel or WGS) as this sample and where this sample falls in the distribution.

Y-Ratio Distribution: 0.0435
male female RSP11288

This chart represents the Illumina sequence coverage over the Bt/Bd allele. These are the three regions in the cannabis genome that impact THCA, CBDA, CBGA production. Coverage over the Active CBDAS gene is highly correlated with Type II and Type III plants as described by Etienne de Meijer. Coverage over the THCA gene is highly correlated with Type I and Type II plants but is anti-correlated with Type III plants. Type I plants require coverage over the inactive CBDA loci and no coverage over the Active CBDA gene. Lack of coverage over the Active CBDA and Active THCA allele are presumed to be Type IV plants (CBGA dominant). While deletions of entire THCAS and CBDAS genes are the most common Bt:Bd alleles observed, it is possible to have plants with these genes where functional expression of the enzyme is disrupted by deactivating point mutations (Kojoma et al. 2006).

Bt/Bd Allele Coverage

This chart represents the Illumina sequence coverage over the CBCA synthase gene.

CBCAS Coverage

Variants (THCAS, CBDAS, and CBCAS)

CBDAS c.221C>G p.Thr74Ser missense variant moderate contig1772 2082447

IGV: Start, Jump

C/G
NGS:
0.136
C90:
0.057
CBDAS c.1420A>C p.Lys474Gln missense variant moderate contig1772 2083646

IGV: Start, Jump

A/C
NGS:
0.132
C90:
0.813

Variants (Select Genes of Interest)

GPPs1

UniProt

c.845_848delAAAG p.Glu282fs frameshift variant high contig676 169629

IGV: Start, Jump

TGAAA/T
NGS:
0.118
C90:
0.000
PKSG-2a

UniProt

c.67T>A p.Phe23Ile missense variant moderate contig700 1945567

IGV: Start, Jump

A/T
NGS:
0.825
C90:
0.904
PKSG-2a

UniProt

c.31A>T p.Thr11Ser missense variant moderate contig700 1945603

IGV: Start, Jump

T/A
NGS:
0.763
C90:
0.876
PKSG-2b

UniProt

c.1152T>A p.Asn384Lys missense variant moderate contig700 1950486

IGV: Start, Jump

A/T
NGS:
0.715
C90:
0.895
PKSG-2b

UniProt

c.1132C>G p.Leu378Val missense variant moderate contig700 1950506

IGV: Start, Jump

G/C
NGS:
0.717
C90:
0.000
PKSG-2b

UniProt

c.1117A>G p.Ile373Val missense variant moderate contig700 1950521

IGV: Start, Jump

T/C
NGS:
0.807
C90:
0.981
PKSG-2b

UniProt

c.948T>G p.Asp316Glu missense variant moderate contig700 1950690

IGV: Start, Jump

A/C
NGS:
0.456
C90:
0.000
PKSG-2b

UniProt

c.945T>G p.Ser315Arg missense variant moderate contig700 1950693

IGV: Start, Jump

A/C
NGS:
0.454
C90:
0.000
PKSG-2b

UniProt

c.944G>A p.Ser315Asn missense variant moderate contig700 1950694

IGV: Start, Jump

C/T
NGS:
0.445
C90:
0.000
PKSG-2b

UniProt

c.934C>G p.His312Asp missense variant moderate contig700 1950704

IGV: Start, Jump

G/C
NGS:
0.410
C90:
0.000
PKSG-2b

UniProt

c.774G>A p.Met258Ile missense variant moderate contig700 1950864

IGV: Start, Jump

C/T
NGS:
0.366
C90:
0.947
PKSG-2b

UniProt

c.592A>G p.Asn198Asp missense variant moderate contig700 1951046

IGV: Start, Jump

T/C
NGS:
0.048
C90:
0.000
PKSG-2b

UniProt

c.588T>G p.Asp196Glu missense variant moderate contig700 1951050

IGV: Start, Jump

A/C
NGS:
0.024
C90:
0.000
PKSG-2b

UniProt

c.560C>T p.Thr187Met missense variant moderate contig700 1951078

IGV: Start, Jump

G/A
NGS:
0.050
C90:
0.000
PKSG-2b

UniProt

c.558G>A p.Met186Ile missense variant moderate contig700 1951080

IGV: Start, Jump

C/T
NGS:
0.050
C90:
0.000
PKSG-2b

UniProt

c.241G>A p.Val81Met missense variant moderate contig700 1951397

IGV: Start, Jump

C/T
NGS:
0.154
C90:
0.000
PKSG-2b

UniProt

c.240T>G p.Asp80Glu missense variant moderate contig700 1951398

IGV: Start, Jump

A/C
NGS:
0.156
C90:
0.000
PKSG-2b

UniProt

c.230T>C p.Val77Ala missense variant moderate contig700 1951408

IGV: Start, Jump

A/G
NGS:
0.134
C90:
0.646
PKSG-2b

UniProt

c.224A>G p.Lys75Arg missense variant moderate contig700 1951414

IGV: Start, Jump

T/C
NGS:
0.151
C90:
0.957
PKSG-2b

UniProt

c.188T>G p.Ile63Ser missense variant moderate contig700 1951450

IGV: Start, Jump

A/C
NGS:
0.118
C90:
0.000
PKSG-2b

UniProt

c.187A>T p.Ile63Phe missense variant moderate contig700 1951451

IGV: Start, Jump

T/A
NGS:
0.116
C90:
0.000
PKSG-2b

UniProt

c.167C>G p.Thr56Ser missense variant moderate contig700 1951471

IGV: Start, Jump

G/C
NGS:
0.103
C90:
0.947
PKSG-2b

UniProt

c.31A>T p.Thr11Ser missense variant moderate contig700 1951851

IGV: Start, Jump

T/A
NGS:
0.844
C90:
0.880
PKSG-2b

UniProt

c.-2_1dupATA start lost & conservative inframe insertion high contig700 1951880

IGV: Start, Jump

A/ATAT
NGS:
0.410
C90:
0.000
PKSG-4b

UniProt

c.496A>G p.Lys166Glu missense variant moderate contig700 2721177

IGV: Start, Jump

T/C
NGS:
0.651
C90:
0.684
PKSG-4b

UniProt

c.489delT p.Phe163fs frameshift variant high contig700 2721183

IGV: Start, Jump

CA/C
NGS:
0.792
C90:
0.761
PKSG-4b

UniProt

c.485A>T p.Lys162Met missense variant moderate contig700 2721188

IGV: Start, Jump

T/A
NGS:
0.007
C90:
0.000
PKSG-4b

UniProt

c.485A>G p.Lys162Arg missense variant moderate contig700 2721188

IGV: Start, Jump

T/C
NGS:
0.643
C90:
0.301
PKSG-4b

UniProt

c.431T>G p.Val144Gly missense variant moderate contig700 2721242

IGV: Start, Jump

A/C
NGS:
0.575
C90:
0.679
PKSG-4b

UniProt

c.419A>G p.Asp140Gly missense variant moderate contig700 2721254

IGV: Start, Jump

T/C
NGS:
0.430
C90:
0.440
PKSG-4b

UniProt

c.352_355delACAG p.Thr118fs frameshift variant high contig700 2721317

IGV: Start, Jump

CCTGT/C
NGS:
0.529
C90:
0.000
PKSG-4b

UniProt

c.323A>G p.Glu108Gly missense variant moderate contig700 2721350

IGV: Start, Jump

T/C
NGS:
0.469
C90:
0.000
DXR-2

UniProt

c.1319T>C p.Ile440Thr missense variant moderate contig380 285250

IGV: Start, Jump

A/G
NGS:
0.480
C90:
0.000
DXR-2

UniProt

c.431C>G p.Ala144Gly missense variant moderate contig380 287760

IGV: Start, Jump

G/C
NGS:
0.182
C90:
0.550
aPT4

UniProt

c.16G>A p.Val6Ile missense variant moderate contig121 2828672

IGV: Start, Jump

G/A
NGS:
0.158
C90:
0.000
aPT4

UniProt

c.97T>C p.Tyr33His missense variant moderate contig121 2828753

IGV: Start, Jump

T/C
NGS:
0.439
C90:
0.000
aPT4

UniProt

c.153A>C p.Lys51Asn missense variant moderate contig121 2828809

IGV: Start, Jump

A/C
NGS:
0.375
C90:
0.000
aPT4

UniProt

c.235_236delGT p.Val79fs frameshift variant high contig121 2829030

IGV: Start, Jump

ATG/A
NGS:
0.417
C90:
0.000
aPT4

UniProt

c.238delT p.Ser80fs frameshift variant high contig121 2829034

IGV: Start, Jump

AT/A
NGS:
0.421
C90:
0.000
aPT4

UniProt

c.302A>G p.Asn101Ser missense variant moderate contig121 2829099

IGV: Start, Jump

A/G
NGS:
0.349
C90:
0.000
aPT4

UniProt

c.744+1_744+19delGTAATTTATTTTATTATAA splice donor variant & splice region variant & intron variant high contig121 2831022

IGV: Start, Jump

GGTAATTTATTTTATTATAA/G
NGS:
0.096
C90:
0.000
aPT4

UniProt

c.1168T>C p.Tyr390His missense variant moderate contig121 2833503

IGV: Start, Jump

T/C
NGS:
0.546
C90:
0.000
aPT1

UniProt

c.629C>T p.Thr210Ile missense variant moderate contig121 2840237

IGV: Start, Jump

C/T
NGS:
0.561
C90:
0.598
HDS-2

UniProt

c.82_93delGTAACCGGAACT p.Val28_Thr31del conservative inframe deletion moderate contig95 1989748

IGV: Start, Jump

CGTAACCGGAACT/C
NGS:
0.805
C90:
0.000
HDS-2

UniProt

c.127T>G p.Ser43Ala missense variant moderate contig95 1989794

IGV: Start, Jump

T/G
NGS:
0.721
C90:
0.000

Nearest genetic relatives (All Samples)

0 0.058 0.117 0.175 0.233
clone distance sibling distance more distant
  1. 0.156 Queen Dream CBG (RSP11280)
  2. 0.164 Serious Happiness (RSP10763)
  3. 0.164 Queen Dream (RSP11289)
  4. 0.165 Doug s Varin (RSP11243)
  5. 0.182 Queen Dream CBG (RSP11277)
  6. 0.182 Blue Dream (RSP11010)
  7. 0.182 Super Blue Dream (RSP11011)
  8. 0.190 Blue Dream (RSP11017)
  9. 0.190 TI (RSP11149)
  10. 0.199 Blue Dream (RSP11004)
  11. 0.205 RINGO S ANGEL (RSP10085)
  12. 0.206 Queen Dream CBG (RSP11296)
  13. 0.209 Blue Dream (RSP11006)
  14. 0.213 Blue Dream (RSP11007)
  15. 0.215 Blueberry Cheesecake (RSP10684)
  16. 0.215 Hot Blonde (RSP11292)
  17. 0.217 Blue Dream (RSP11009)
  18. 0.219 Domnesia (RSP11184)
  19. 0.222 Whitey (RSP11363)
  20. 0.228 Miss X (RSP10999)

Nearest genetic relatives (Base Tree)

0 0.075 0.150 0.225 0.300
clone distance sibling distance more distant
  1. 0.219 Blueberry Cheesecake (RSP10684)
  2. 0.243 Durban Poison (RSP11014)
  3. 0.244 UP Sunrise (RSP10989)
  4. 0.262 Hermaphrodite Research Sample1 (RSP11049)
  5. 0.271 RKM-2018-028 (RSP11120)
  6. 0.271 RKM-2018-003 (RSP11094)
  7. 0.274 Liberty Haze (RSP11000)
  8. 0.277 Recon (RSP10755)
  9. 0.277 Sour Raspberry (RSP10551)
  10. 0.282 QUEEN JESUS (RSP10105)
  11. 0.285 RKM-2018-020 (RSP11112)
  12. 0.286 Golden Goat 2 (RSP10991)
  13. 0.287 RKM-2018-005 (RSP11096)
  14. 0.287 Blue Dream (RSP11033)
  15. 0.289 RKM-2018-029 (RSP11121)
  16. 0.291 Cherry (RSP11143)
  17. 0.291 RKM-2018-033 (RSP11125)
  18. 0.295 RKM-2018-009 (RSP11100)
  19. 0.297 The Gift (RSP10988)
  20. 0.297 Blueberry Cheesecake (RSP10680)

Most genetically distant strains (All Samples)

0 0.117 0.233 0.350 0.467
clone distance sibling distance more distant
  1. 0.440 80E (RSP11211)
  2. 0.434 80E (RSP11213)
  3. 0.404 Cherry Blossom (RSP11333)
  4. 0.400 CS (RSP11208)
  5. 0.395 80E (RSP11212)
  6. 0.394 JL 3rd Gen Father (RSP11196)
  7. 0.394 White Label 1 (RSP11336)
  8. 0.393 JL yellow (RSP11075)
  9. 0.387 Cherry Blossom (RSP11324)
  10. 0.386 JL 4th Gen 2 (RSP11194)
  11. 0.385 JL 4th Gen 5 (RSP11199)
  12. 0.385 Cherry Blossom (RSP11328)
  13. 0.384 Cherry Blossom (RSP11300)
  14. 0.384 Cherry Blossom (RSP11329)
  15. 0.383 USO31 (RSP10233)
  16. 0.382 Feral (RSP10892)
  17. 0.382 Feral (RSP11206)
  18. 0.381 Carmagnola (RSP11202)
  19. 0.381 Feral (RSP10890)
  20. 0.380 Feral (RSP11205)

Most genetically distant strains (Base Tree)

0 0.100 0.200 0.300 0.400
clone distance sibling distance more distant
  1. 0.398 JL yellow (RSP11075)
  2. 0.385 Kush Hemp E1 (RSP11128)
  3. 0.384 Cbot-2019-005 (RSP11133)
  4. 0.383 Feral (RSP10890)
  5. 0.376 Carmagnola (RSP11037)
  6. 0.372 Monoica (RSP10241)
  7. 0.369 Ivory (RSP10668)
  8. 0.369 Santhica27 (RSP11047)
  9. 0.364 Cherry (RSP11142)
  10. 0.359 RKM-2018-026 (RSP11118)
  11. 0.359 USO 31 (RSP10981)
  12. 0.357 Kyrgyz Gold (RSP11054)
  13. 0.357 Jiangji (RSP10653)
  14. 0.353 Futura 75 (RSP10664)
  15. 0.353 Black Beauty (RSP11035)
  16. 0.350 Carmagnola (RSP10979)
  17. 0.346 Tisza (RSP11044)
  18. 0.346 Skywalker OG (RSP10837)
  19. 0.345 Lovrin (RSP10658)
  20. 0.344 Fedora 17 (RSP10661)

Nearest genetic relative in Phylos dataset

Phylos Strain SRR8346413
Overlapping SNPs:
70
Concordance:
45

Nearest genetic relative in Lynch dataset

Lynch Strain SRR3495226
Overlapping SNPs:
4
Concordance:
4

Blockchain Registration Information

Transaction ID
a3eb02707a2010a6768b7a7eaf99e7b354f433b35c5339b7a927ace4a37e8e7b
Stamping Certificate
Download PDF (852.0 KB)
SHASUM Hash
6744972bdebbdfd9bec7409687a9d37b59e0f238f5e8fde87fb6da0b600b0e87
QR code for RSP11288

Kannapedia uses cookies

By clicking Allow All, you agree to the storing of cookies on your device to enhance site navigation, analyze site usage, and assist in our marketing efforts.

Customize Settings