Cherry Blossom

RSP 11302

Grower: Yabba Cannaba

General Information

Sample Name
CA2
Accession Date
October 16, 2019
Reported Plant Sex
Female

The strain rarity visualization shows how distant the strain is from the other cultivars in the Kannapedia database. The y-axis represents genetic distance, getting farther as you go up. The width of the visualization at any position along the y-axis shows how many strains there are in the database at that genetic distance. So, a common strain will have a more bottom-heavy shape, while uncommon and rare cultivars will have a visualization that is generally shifted towards the top.

Rarity: Uncommon
Most Distant Most Similar

Chemical Information

Cannabinoid and terpenoid information provided by the grower.

Cannabinoids

No information provided.

Terpenoids

No information provided.

Genetic Information

Plant Type
Type III

The bell curve in the heterozygosity visualization shows the distribution of heterozygosity levels for cannabis cultivars in the Kannapedia database. The green line shows where this particular strain fits within the distribution. Heterozygosity is associated with heterosis (aka hybrid vigor) but also leads to the production of more variable offspring. When plants have two genetically different parents, heterozygosity levels will be higher than if it has been inbred or backcrossed repeatedly.

Heterozygosity: 1.08%
Least Heterozygous Most Heterozygous

The ratio of reads mapped to Y-contigs to reads mapped to the whole Cannabis genome (Y-ratios) has been demonstrated to be strongly correlated with plant sex typing. This plot shows the distribution of Y-ratios for all samples in our database which were sequenced with the same method (panel or WGS) as this sample and where this sample falls in the distribution.

Y-Ratio Distribution: 0.0439
male female RSP11302

This chart represents the Illumina sequence coverage over the Bt/Bd allele. These are the three regions in the cannabis genome that impact THCA, CBDA, CBGA production. Coverage over the Active CBDAS gene is highly correlated with Type II and Type III plants as described by Etienne de Meijer. Coverage over the THCA gene is highly correlated with Type I and Type II plants but is anti-correlated with Type III plants. Type I plants require coverage over the inactive CBDA loci and no coverage over the Active CBDA gene. Lack of coverage over the Active CBDA and Active THCA allele are presumed to be Type IV plants (CBGA dominant). While deletions of entire THCAS and CBDAS genes are the most common Bt:Bd alleles observed, it is possible to have plants with these genes where functional expression of the enzyme is disrupted by deactivating point mutations (Kojoma et al. 2006).

Bt/Bd Allele Coverage

This chart represents the Illumina sequence coverage over the CBCA synthase gene.

CBCAS Coverage

Variants (THCAS, CBDAS, and CBCAS)

CBDAS c.8G>A p.Cys3Tyr missense variant moderate contig1772 2082234

IGV: Start, Jump

G/A
NGS:
0.057
C90:
0.000
CBDAS c.221C>G p.Thr74Ser missense variant moderate contig1772 2082447

IGV: Start, Jump

C/G
NGS:
0.136
C90:
0.057
CBDAS c.1420A>C p.Lys474Gln missense variant moderate contig1772 2083646

IGV: Start, Jump

A/C
NGS:
0.132
C90:
0.813

Variants (Select Genes of Interest)

GPPs1

UniProt

c.845_848delAAAG p.Glu282fs frameshift variant high contig676 169629

IGV: Start, Jump

TGAAA/T
NGS:
0.118
C90:
0.000
PKSG-4a

UniProt

c.493G>A p.Gly165Ser missense variant moderate contig700 1937904

IGV: Start, Jump

G/A
NGS:
0.103
C90:
0.000
PKSG-4a

UniProt

c.1191_1193delTTA p.Tyr398del disruptive inframe deletion moderate contig700 1938600

IGV: Start, Jump

AATT/A
NGS:
0.167
C90:
0.000
PKSG-2a

UniProt

c.1117A>G p.Ile373Val missense variant moderate contig700 1944273

IGV: Start, Jump

T/C
NGS:
0.101
C90:
0.967
PKSG-2b

UniProt

c.1117A>G p.Ile373Val missense variant moderate contig700 1950521

IGV: Start, Jump

T/C
NGS:
0.807
C90:
0.981
PKSG-4b

UniProt

c.496A>G p.Lys166Glu missense variant moderate contig700 2721177

IGV: Start, Jump

T/C
NGS:
0.651
C90:
0.684
PKSG-4b

UniProt

c.489delT p.Phe163fs frameshift variant high contig700 2721183

IGV: Start, Jump

CA/C
NGS:
0.792
C90:
0.761
PKSG-4b

UniProt

c.485A>G p.Lys162Arg missense variant moderate contig700 2721188

IGV: Start, Jump

T/C
NGS:
0.643
C90:
0.301
PKSG-4b

UniProt

c.352_355delACAG p.Thr118fs frameshift variant high contig700 2721317

IGV: Start, Jump

CCTGT/C
NGS:
0.529
C90:
0.000
PKSG-4b

UniProt

c.324A>C p.Glu108Asp missense variant moderate contig700 2721349

IGV: Start, Jump

T/G
NGS:
0.094
C90:
0.000
PKSG-4b

UniProt

c.323A>G p.Glu108Gly missense variant moderate contig700 2721350

IGV: Start, Jump

T/C
NGS:
0.469
C90:
0.000
DXR-2

UniProt

c.1319T>C p.Ile440Thr missense variant moderate contig380 285250

IGV: Start, Jump

A/G
NGS:
0.480
C90:
0.000
aPT4

UniProt

c.97T>C p.Tyr33His missense variant moderate contig121 2828753

IGV: Start, Jump

T/C
NGS:
0.439
C90:
0.000
aPT4

UniProt

c.153A>C p.Lys51Asn missense variant moderate contig121 2828809

IGV: Start, Jump

A/C
NGS:
0.375
C90:
0.000
aPT4

UniProt

c.235_236delGT p.Val79fs frameshift variant high contig121 2829030

IGV: Start, Jump

ATG/A
NGS:
0.417
C90:
0.000
aPT4

UniProt

c.238delT p.Ser80fs frameshift variant high contig121 2829034

IGV: Start, Jump

AT/A
NGS:
0.421
C90:
0.000
aPT4

UniProt

c.302A>G p.Asn101Ser missense variant moderate contig121 2829099

IGV: Start, Jump

A/G
NGS:
0.349
C90:
0.000
aPT4

UniProt

c.744+1_744+19delGTAATTTATTTTATTATAA splice donor variant & splice region variant & intron variant high contig121 2831022

IGV: Start, Jump

GGTAATTTATTTTATTATAA/G
NGS:
0.096
C90:
0.000
HDS-2

UniProt

c.82_93delGTAACCGGAACT p.Val28_Thr31del conservative inframe deletion moderate contig95 1989748

IGV: Start, Jump

CGTAACCGGAACT/C
NGS:
0.805
C90:
0.000
HDS-2

UniProt

c.127T>G p.Ser43Ala missense variant moderate contig95 1989794

IGV: Start, Jump

T/G
NGS:
0.721
C90:
0.000
HDS-1

UniProt

c.-108+1_-108+2insG splice donor variant & intron variant high contig1891 889975

IGV: Start, Jump

A/AC
NGS:
0.217
C90:
0.000

Nearest genetic relatives (All Samples)

0 0.067 0.133 0.200 0.267
clone distance sibling distance more distant
  1. 0.143 Cherry Blossom (RSP11326)
  2. 0.159 Cherry Blossom (RSP11310)
  3. 0.161 Cherry Blossom (RSP11331)
  4. 0.166 Cherry Blossom (RSP11299)
  5. 0.170 Cherry Blossom (RSP11313)
  6. 0.182 Cherry Blossom (RSP11333)
  7. 0.191 Cherry Blossom (RSP11321)
  8. 0.202 Cherry Blossom (RSP11308)
  9. 0.202 Cherry Blossom (RSP11318)
  10. 0.203 Cherry Blossom (RSP11335)
  11. 0.211 Cherry Blossom (RSP11324)
  12. 0.219 Cherry Blossom (RSP11316)
  13. 0.221 Unknown- Cherry Wine - 005 (RSP11272)
  14. 0.227 Cherry Blossom (RSP11320)
  15. 0.232 Queen Dream CBG (RSP11282)
  16. 0.236 Cherry Blossom (RSP11330)
  17. 0.237 Domnesia (RSP11184)
  18. 0.237 Cherry Blossom (RSP11274)
  19. 0.238 Cherry Blossom (RSP11319)
  20. 0.238 Doug s Varin (RSP11243)

Nearest genetic relatives (Base Tree)

0 0.100 0.200 0.300 0.400
clone distance sibling distance more distant
  1. 0.257 Blueberry Cheesecake (RSP10684)
  2. 0.291 Cherry (RSP11142)
  3. 0.300 Liberty Haze (RSP11000)
  4. 0.306 Durban Poison (RSP11014)
  5. 0.320 UP Sunrise (RSP10989)
  6. 0.323 Golden Goat 2 (RSP10991)
  7. 0.328 Cherry (RSP11143)
  8. 0.338 RKM-2018-019 (RSP11111)
  9. 0.340 Gold Cracker (RSP11048)
  10. 0.349 Blueberry Cheesecake (RSP10672)
  11. 0.352 QUEEN JESUS (RSP10105)
  12. 0.359 Tygra (RSP10667)
  13. 0.365 RKM-2018-006 (RSP11097)
  14. 0.368 Recon (RSP10755)
  15. 0.371 RKM-2018-027 (RSP11119)
  16. 0.375 Tisza (RSP10659)
  17. 0.378 RKM-2018-003 (RSP11094)
  18. 0.378 Cbot-2019-006 (RSP11134)
  19. 0.378 RKM-2018-032 (RSP11124)
  20. 0.384 RKM-2018-028 (RSP11120)

Most genetically distant strains (All Samples)

0 0.125 0.250 0.375 0.500
clone distance sibling distance more distant
  1. 0.484 80E (RSP11213)
  2. 0.483 JL yellow (RSP11075)
  3. 0.478 JL 3rd Gen Mother (RSP11214)
  4. 0.462 80E (RSP11211)
  5. 0.461 RKM-2018-026 (RSP11118)
  6. 0.460 Chem 91 (RSP11185)
  7. 0.456 RKM-2018-002 (RSP11093)
  8. 0.452 White Label 1 (RSP11336)
  9. 0.449 JL 3rd Gen Mother (RSP11197)
  10. 0.447 Garlic (RSP11341)
  11. 0.446 JL 4th Gen 6 (RSP11200)
  12. 0.446 80E (RSP11212)
  13. 0.446 Kush Hemp E1 (RSP11128)
  14. 0.443 JL 4th Gen 2 (RSP11194)
  15. 0.443 Rugburn OG (RSP11353)
  16. 0.442 501st OG (RSP11241)
  17. 0.441 JL 3rd Gen Father (RSP11196)
  18. 0.439 Feral (RSP11205)
  19. 0.439 Skywalker OG (RSP10837)
  20. 0.436 RKM-2018-012 (RSP11103)

Most genetically distant strains (Base Tree)

0 0.125 0.250 0.375 0.500
clone distance sibling distance more distant
  1. 0.485 JL yellow (RSP11075)
  2. 0.465 RKM-2018-026 (RSP11118)
  3. 0.465 RKM-2018-002 (RSP11093)
  4. 0.443 Feral (RSP10890)
  5. 0.442 Kush Hemp E1 (RSP11128)
  6. 0.440 Skywalker OG (RSP10837)
  7. 0.434 Italian Kiss (RSP11034)
  8. 0.432 Sour Raspberry (RSP10551)
  9. 0.430 Cbot-2019-005 (RSP11133)
  10. 0.429 Jiangji (RSP10653)
  11. 0.424 Carmagnola (RSP11037)
  12. 0.422 Ivory (RSP10668)
  13. 0.421 RKM-2018-033 (RSP11125)
  14. 0.418 Santhica27 (RSP11047)
  15. 0.418 Monoica (RSP10241)
  16. 0.413 RKM-2018-022 (RSP11114)
  17. 0.412 Fedora 17 (RSP10661)
  18. 0.411 The Gift (RSP10988)
  19. 0.410 Carmagnola (RSP10979)
  20. 0.410 Tisza (RSP11044)

Nearest genetic relative in Phylos dataset

Phylos Strain SRR4450157
Overlapping SNPs:
66
Concordance:
41

Nearest genetic relative in Lynch dataset

Lynch Strain SRR3495164
Overlapping SNPs:
3
Concordance:
3

Blockchain Registration Information

Transaction ID
bdba5c45143a5dfedfa847f973467d7ba3fb5b1ce61aa47a22176385426d29a6
Stamping Certificate
Download PDF (848.8 KB)
SHASUM Hash
c5fc554f3d2de32d89abbfe03aad8a16f347d43641bf0a0ba4c0fe76071b0702
QR code for RSP11302

Kannapedia uses cookies

By clicking Allow All, you agree to the storing of cookies on your device to enhance site navigation, analyze site usage, and assist in our marketing efforts.

Customize Settings