Cherry Blossom

RSP 11306

Grower: Yabba Cannaba

General Information

Sample Name
CH7
Accession Date
October 16, 2019
Reported Plant Sex
Female

The strain rarity visualization shows how distant the strain is from the other cultivars in the Kannapedia database. The y-axis represents genetic distance, getting farther as you go up. The width of the visualization at any position along the y-axis shows how many strains there are in the database at that genetic distance. So, a common strain will have a more bottom-heavy shape, while uncommon and rare cultivars will have a visualization that is generally shifted towards the top.

Rarity: Rare
Most Distant Most Similar

Chemical Information

Cannabinoid and terpenoid information provided by the grower.

Cannabinoids

No information provided.

Terpenoids

No information provided.

Genetic Information

Plant Type
Type III

The bell curve in the heterozygosity visualization shows the distribution of heterozygosity levels for cannabis cultivars in the Kannapedia database. The green line shows where this particular strain fits within the distribution. Heterozygosity is associated with heterosis (aka hybrid vigor) but also leads to the production of more variable offspring. When plants have two genetically different parents, heterozygosity levels will be higher than if it has been inbred or backcrossed repeatedly.

Heterozygosity: 1.01%
Least Heterozygous Most Heterozygous

The ratio of reads mapped to Y-contigs to reads mapped to the whole Cannabis genome (Y-ratios) has been demonstrated to be strongly correlated with plant sex typing. This plot shows the distribution of Y-ratios for all samples in our database which were sequenced with the same method (panel or WGS) as this sample and where this sample falls in the distribution.

Y-Ratio Distribution: 0.0554
male female RSP11306

This chart represents the Illumina sequence coverage over the Bt/Bd allele. These are the three regions in the cannabis genome that impact THCA, CBDA, CBGA production. Coverage over the Active CBDAS gene is highly correlated with Type II and Type III plants as described by Etienne de Meijer. Coverage over the THCA gene is highly correlated with Type I and Type II plants but is anti-correlated with Type III plants. Type I plants require coverage over the inactive CBDA loci and no coverage over the Active CBDA gene. Lack of coverage over the Active CBDA and Active THCA allele are presumed to be Type IV plants (CBGA dominant). While deletions of entire THCAS and CBDAS genes are the most common Bt:Bd alleles observed, it is possible to have plants with these genes where functional expression of the enzyme is disrupted by deactivating point mutations (Kojoma et al. 2006).

Bt/Bd Allele Coverage

This chart represents the Illumina sequence coverage over the CBCA synthase gene.

CBCAS Coverage

Variants (THCAS, CBDAS, and CBCAS)

No variants to report

Variants (Select Genes of Interest)

PKSG-2a

UniProt

c.67T>A p.Phe23Ile missense variant moderate contig700 1945567

IGV: Start, Jump

A/T
NGS:
0.825
C90:
0.904
PKSG-2a

UniProt

c.31A>T p.Thr11Ser missense variant moderate contig700 1945603

IGV: Start, Jump

T/A
NGS:
0.763
C90:
0.876
PKSG-2b

UniProt

c.31A>T p.Thr11Ser missense variant moderate contig700 1951851

IGV: Start, Jump

T/A
NGS:
0.844
C90:
0.880
PKSG-4b

UniProt

c.496A>G p.Lys166Glu missense variant moderate contig700 2721177

IGV: Start, Jump

T/C
NGS:
0.651
C90:
0.684
PKSG-4b

UniProt

c.489delT p.Phe163fs frameshift variant high contig700 2721183

IGV: Start, Jump

CA/C
NGS:
0.792
C90:
0.761
PKSG-4b

UniProt

c.485A>G p.Lys162Arg missense variant moderate contig700 2721188

IGV: Start, Jump

T/C
NGS:
0.643
C90:
0.301
PKSG-4b

UniProt

c.431T>G p.Val144Gly missense variant moderate contig700 2721242

IGV: Start, Jump

A/C
NGS:
0.575
C90:
0.679
PKSG-4b

UniProt

c.419A>G p.Asp140Gly missense variant moderate contig700 2721254

IGV: Start, Jump

T/C
NGS:
0.430
C90:
0.440
PKSG-4b

UniProt

c.352_355delACAG p.Thr118fs frameshift variant high contig700 2721317

IGV: Start, Jump

CCTGT/C
NGS:
0.529
C90:
0.000
aPT4

UniProt

c.302A>G p.Asn101Ser missense variant moderate contig121 2829099

IGV: Start, Jump

A/G
NGS:
0.349
C90:
0.000
aPT4

UniProt

c.744+1_744+19delGTAATTTATTTTATTATAA splice donor variant & splice region variant & intron variant high contig121 2831022

IGV: Start, Jump

GGTAATTTATTTTATTATAA/G
NGS:
0.096
C90:
0.000

Nearest genetic relatives (All Samples)

0 0.067 0.133 0.200 0.267
clone distance sibling distance more distant
  1. 0.105 Cherry Blossom (RSP11325)
  2. 0.116 Cherry Blossom (RSP11315)
  3. 0.131 Cherry Blossom (RSP11322)
  4. 0.151 Cherry Blossom (RSP11329)
  5. 0.185 Cherry Blossom CBG (RSP11303)
  6. 0.192 Unknown--Cherry Wine---005- (RSP11272)
  7. 0.194 Cherry Blossom (RSP11304)
  8. 0.223 QLF4 (RSP11441)
  9. 0.226 Cherry Blossom (RSP11320)
  10. 0.228 Cherry Blossom (RSP11327)
  11. 0.230 Cherry Blossom (RSP11330)
  12. 0.243 Cherry Blossom (RSP11326)
  13. 0.243 Cherry Blossom (RSP11299)
  14. 0.246 Cherry Blossom (RSP11317)
  15. 0.249 Cherry Blossom (RSP11316)
  16. 0.251 Lifter (RSP11365)
  17. 0.251 Electra (RSP11366)
  18. 0.251 Cherry Blossom (RSP11332)
  19. 0.253 Queen Dream CBG (RSP11285)
  20. 0.254 Cherry Blossom (RSP11313)

Nearest genetic relatives (Base Tree)

0 0.100 0.200 0.300 0.400
clone distance sibling distance more distant
  1. 0.284 UP Sunrise (RSP10989)
  2. 0.306 Cbot-2019-001 (RSP11129)
  3. 0.320 Tygra (RSP10667)
  4. 0.333 Liberty Haze (RSP11000)
  5. 0.337 Italian Kiss (RSP11034)
  6. 0.342 Cbot-2019-004 (RSP11132)
  7. 0.346 CST (RSP11002)
  8. 0.349 Tisza (RSP10659)
  9. 0.354 RKM-2018-031 (RSP11123)
  10. 0.357 Blue Dream (RSP11033)
  11. 0.359 Ivory (RSP10668)
  12. 0.360 Blueberry Cheesecake (RSP10684)
  13. 0.362 Sour Raspberry (RSP10551)
  14. 0.365 RKM-2018-009 (RSP11100)
  15. 0.365 RKM-2018-006 (RSP11097)
  16. 0.368 Recon (RSP10755)
  17. 0.375 Hermaphrodite Research Sample1 (RSP11049)
  18. 0.376 Kimbo Slice (RSP10997)
  19. 0.377 Tisza (RSP11044)
  20. 0.377 Cherry (RSP11143)

Most genetically distant strains (All Samples)

0 0.125 0.250 0.375 0.500
clone distance sibling distance more distant
  1. 0.489 Star Dawg (RSP11352)
  2. 0.482 Right Mark (RSP11628)
  3. 0.479 Northern Lights (RSP11501)
  4. 0.478 BagSeed (RSP12501)
  5. 0.477 JL 3rd Gen Father (RSP11196)
  6. 0.476 Cherry Lime Runtz (RSP12486)
  7. 0.473 Fatso (RSP11741)
  8. 0.470 Ruderalis Indica (SRR14708267)
  9. 0.470 Skunk#18 (RSP11030)
  10. 0.469 BagSeed (RSP12627)
  11. 0.465 Juicy Gummy x Royal Kush (RSP12484)
  12. 0.465 CHEM4 (RSP12090)
  13. 0.465 Big Bud (SRR14708270)
  14. 0.462 Skunk#18 (RSP11038)
  15. 0.461 JL 4th Gen 2 (RSP11194)
  16. 0.460 JABBA S STASH (RSP11348)
  17. 0.460 Black Triangle (RSP11638)
  18. 0.457 Square Wave (RSP11344)
  19. 0.457 New BSR (RSP12104)
  20. 0.455 Red Eye OG (RSP11190)

Most genetically distant strains (Base Tree)

0 0.125 0.250 0.375 0.500
clone distance sibling distance more distant
  1. 0.474 RKM-2018-002 (RSP11093)
  2. 0.471 Skunk#18 (RSP11038)
  3. 0.454 Cbot-2019-005 (RSP11133)
  4. 0.452 RKM-2018-026 (RSP11118)
  5. 0.450 Skywalker OG (RSP10837)
  6. 0.445 Pie Hoe (RSP11073)
  7. 0.440 RKM-2018-019 (RSP11111)
  8. 0.438 RKM-2018-034 (RSP11126)
  9. 0.433 RKM-2018-022 (RSP11114)
  10. 0.430 RKM-2018-023 (RSP11115)
  11. 0.426 Cbot-2019-006 (RSP11134)
  12. 0.425 RKM-2018-020 (RSP11112)
  13. 0.420 RKM-2018-004 (RSP11096)
  14. 0.419 RKM-2018-033 (RSP11125)
  15. 0.418 RKM-2018-003 (RSP11094)
  16. 0.414 Jiangji (RSP10653)
  17. 0.412 Black Beauty (RSP11035)
  18. 0.412 Kush Hemp E1 (RSP11128)
  19. 0.411 Golden Goat 2 (RSP10991)
  20. 0.409 JL yellow (RSP11075)

Nearest genetic relative in Phylos dataset

Phylos Strain SRR8346627
Overlapping SNPs:
62
Concordance:
37

Nearest genetic relative in Lynch dataset

Lynch Strain SRR3495187
Overlapping SNPs:
6
Concordance:
6

Blockchain Registration Information

Transaction ID
8f6cca14a10a6a4dcd4ca71a59eed500fd7ca2b4086ba6e3bed055b600855d1c
Stamping Certificate
Download PDF (858.0 KB)
SHASUM Hash
52f2d110ba21ed7fe8d14b54ffa82b8853b00bf14631025a24cc85025ca7ca88
QR code for RSP11306

Kannapedia uses cookies

By clicking Allow All, you agree to the storing of cookies on your device to enhance site navigation, analyze site usage, and assist in our marketing efforts.

Customize Settings