Cherry Blossom

RSP 11314

Grower: Yabba Cannaba

General Information

Sample Name
CH5
Accession Date
October 16, 2019
Reported Plant Sex
Female

The strain rarity visualization shows how distant the strain is from the other cultivars in the Kannapedia database. The y-axis represents genetic distance, getting farther as you go up. The width of the visualization at any position along the y-axis shows how many strains there are in the database at that genetic distance. So, a common strain will have a more bottom-heavy shape, while uncommon and rare cultivars will have a visualization that is generally shifted towards the top.

Rarity: Rare
Most Distant Most Similar

Chemical Information

Cannabinoid and terpenoid information provided by the grower.

Cannabinoids

No information provided.

Terpenoids

No information provided.

Genetic Information

Plant Type
Type III

The bell curve in the heterozygosity visualization shows the distribution of heterozygosity levels for cannabis cultivars in the Kannapedia database. The green line shows where this particular strain fits within the distribution. Heterozygosity is associated with heterosis (aka hybrid vigor) but also leads to the production of more variable offspring. When plants have two genetically different parents, heterozygosity levels will be higher than if it has been inbred or backcrossed repeatedly.

Heterozygosity: 1.14%
Least Heterozygous Most Heterozygous

The ratio of reads mapped to Y-contigs to reads mapped to the whole Cannabis genome (Y-ratios) has been demonstrated to be strongly correlated with plant sex typing. This plot shows the distribution of Y-ratios for all samples in our database which were sequenced with the same method (panel or WGS) as this sample and where this sample falls in the distribution.

Y-Ratio Distribution: 0.0644
male female RSP11314

This chart represents the Illumina sequence coverage over the Bt/Bd allele. These are the three regions in the cannabis genome that impact THCA, CBDA, CBGA production. Coverage over the Active CBDAS gene is highly correlated with Type II and Type III plants as described by Etienne de Meijer. Coverage over the THCA gene is highly correlated with Type I and Type II plants but is anti-correlated with Type III plants. Type I plants require coverage over the inactive CBDA loci and no coverage over the Active CBDA gene. Lack of coverage over the Active CBDA and Active THCA allele are presumed to be Type IV plants (CBGA dominant). While deletions of entire THCAS and CBDAS genes are the most common Bt:Bd alleles observed, it is possible to have plants with these genes where functional expression of the enzyme is disrupted by deactivating point mutations (Kojoma et al. 2006).

Bt/Bd Allele Coverage

This chart represents the Illumina sequence coverage over the CBCA synthase gene.

CBCAS Coverage

Variants (THCAS, CBDAS, and CBCAS)

CBDAS c.221C>G p.Thr74Ser missense variant moderate contig1772 2082447

IGV: Start, Jump

C/G
NGS:
0.136
C90:
0.057
CBDAS c.1420A>C p.Lys474Gln missense variant moderate contig1772 2083646

IGV: Start, Jump

A/C
NGS:
0.132
C90:
0.813

Variants (Select Genes of Interest)

PKSG-2a

UniProt

c.67T>A p.Phe23Ile missense variant moderate contig700 1945567

IGV: Start, Jump

A/T
NGS:
0.825
C90:
0.904
PKSG-2a

UniProt

c.31A>T p.Thr11Ser missense variant moderate contig700 1945603

IGV: Start, Jump

T/A
NGS:
0.763
C90:
0.876
PKSG-2b

UniProt

c.1117A>G p.Ile373Val missense variant moderate contig700 1950521

IGV: Start, Jump

T/C
NGS:
0.807
C90:
0.981
PKSG-2b

UniProt

c.31A>T p.Thr11Ser missense variant moderate contig700 1951851

IGV: Start, Jump

T/A
NGS:
0.844
C90:
0.880
PKSG-4b

UniProt

c.556A>G p.Arg186Gly missense variant & splice region variant moderate contig700 2721117

IGV: Start, Jump

T/C
NGS:
0.022
C90:
0.000
PKSG-4b

UniProt

c.496A>G p.Lys166Glu missense variant moderate contig700 2721177

IGV: Start, Jump

T/C
NGS:
0.651
C90:
0.684
PKSG-4b

UniProt

c.489delT p.Phe163fs frameshift variant high contig700 2721183

IGV: Start, Jump

CA/C
NGS:
0.792
C90:
0.761
PKSG-4b

UniProt

c.485A>G p.Lys162Arg missense variant moderate contig700 2721188

IGV: Start, Jump

T/C
NGS:
0.643
C90:
0.301
PKSG-4b

UniProt

c.431T>G p.Val144Gly missense variant moderate contig700 2721242

IGV: Start, Jump

A/C
NGS:
0.575
C90:
0.679
PKSG-4b

UniProt

c.419A>G p.Asp140Gly missense variant moderate contig700 2721254

IGV: Start, Jump

T/C
NGS:
0.430
C90:
0.440
aPT4

UniProt

c.97T>C p.Tyr33His missense variant moderate contig121 2828753

IGV: Start, Jump

T/C
NGS:
0.439
C90:
0.000
aPT4

UniProt

c.744+1_744+19delGTAATTTATTTTATTATAA splice donor variant & splice region variant & intron variant high contig121 2831022

IGV: Start, Jump

GGTAATTTATTTTATTATAA/G
NGS:
0.096
C90:
0.000
HDS-2

UniProt

c.82_93delGTAACCGGAACT p.Val28_Thr31del conservative inframe deletion moderate contig95 1989748

IGV: Start, Jump

CGTAACCGGAACT/C
NGS:
0.805
C90:
0.000
HDS-2

UniProt

c.127T>G p.Ser43Ala missense variant moderate contig95 1989794

IGV: Start, Jump

T/G
NGS:
0.721
C90:
0.000

Nearest genetic relatives (All Samples)

0 0.075 0.150 0.225 0.300
clone distance sibling distance more distant
  1. 0.160 Cherry Blossom (RSP11320)
  2. 0.178 Cherry Blossom (RSP11333)
  3. 0.186 Cherry Blossom (RSP11313)
  4. 0.195 Cherry Blossom (RSP11311)
  5. 0.205 Cherry Blossom (RSP11274)
  6. 0.206 Unknown- Cherry Wine - 005 (RSP11272)
  7. 0.220 Cherry Blossom (RSP11317)
  8. 0.236 Cherry Blossom (RSP11327)
  9. 0.256 Cherry Blossom (RSP11309)
  10. 0.256 Cherry Blossom (RSP11319)
  11. 0.262 Cherry Blossom (RSP11324)
  12. 0.269 Cherry Blossom (RSP11316)
  13. 0.272 Cherry Blossom (RSP11322)
  14. 0.278 Cherry Blossom (RSP11332)
  15. 0.278 Cherry Blossom (RSP11304)
  16. 0.283 Cherry Blossom (RSP11335)
  17. 0.283 Cherry Blossom (RSP11308)
  18. 0.289 Cherry (RSP11142)
  19. 0.290 Cherry Wine (RSP11267)
  20. 0.292 Cbot-2019-005 (RSP11133)

Nearest genetic relatives (Base Tree)

0 0.100 0.200 0.300 0.400
clone distance sibling distance more distant
  1. 0.304 Cherry (RSP11142)
  2. 0.306 Cbot-2019-005 (RSP11133)
  3. 0.334 Recon (RSP10755)
  4. 0.344 Liberty Haze (RSP11000)
  5. 0.360 KYRG-11 (RSP11051)
  6. 0.362 Tisza (RSP10659)
  7. 0.365 Kimbo Slice (RSP10997)
  8. 0.367 QUEEN JESUS (RSP10105)
  9. 0.369 Blueberry Cheesecake (RSP10684)
  10. 0.375 Kyrgyz Gold (RSP11054)
  11. 0.381 UP Sunrise (RSP10989)
  12. 0.383 Tygra (RSP10667)
  13. 0.383 Jiangji (RSP10653)
  14. 0.388 RKM-2018-019 (RSP11111)
  15. 0.389 Carmagnola (RSP11037)
  16. 0.390 RKM-2018-031 (RSP11123)
  17. 0.391 Carmagnola (RSP10979)
  18. 0.391 Santhica27 (RSP11047)
  19. 0.396 The Gift (RSP10988)
  20. 0.396 Hermaphrodite ResearchSample2 (RSP11050)

Most genetically distant strains (All Samples)

0 0.133 0.267 0.400 0.533
clone distance sibling distance more distant
  1. 0.510 Chem 91 (RSP11185)
  2. 0.490 RKM-2018-018 (RSP11110)
  3. 0.487 Queen Dream CBG (RSP11284)
  4. 0.486 RKM-2018-002 (RSP11093)
  5. 0.480 Sour D (RSP11343)
  6. 0.480 JL yellow (RSP11075)
  7. 0.476 New York City Deisel (RSP11225)
  8. 0.474 Hermaphrodite Research Sample1 (RSP11049)
  9. 0.469 East Coast Sour Diesel (RSP10243)
  10. 0.468 RKM-2018-030 (RSP11122)
  11. 0.468 Hermaphrodite Research Sample1 (RSP11042)
  12. 0.467 Star Dawg (RSP11352)
  13. 0.466 JL 3rd Gen Mother (RSP11214)
  14. 0.466 Bordello (RSP11228)
  15. 0.463 UP Sunset (RSP11256)
  16. 0.462 White Label 1 (RSP11336)
  17. 0.461 RKM-2018-009 (RSP11100)
  18. 0.461 Cherry (RSP11143)
  19. 0.460 JL 3rd Gen Mother (RSP11197)
  20. 0.459 Skunk 18 (RSP11038)

Most genetically distant strains (Base Tree)

0 0.125 0.250 0.375 0.500
clone distance sibling distance more distant
  1. 0.491 RKM-2018-018 (RSP11110)
  2. 0.485 RKM-2018-002 (RSP11093)
  3. 0.477 Hermaphrodite Research Sample1 (RSP11049)
  4. 0.471 JL yellow (RSP11075)
  5. 0.468 Cherry (RSP11143)
  6. 0.466 RKM-2018-009 (RSP11100)
  7. 0.456 Skunk 18 (RSP11038)
  8. 0.454 Sour Raspberry (RSP10551)
  9. 0.451 RKM-2018-023 (RSP11115)
  10. 0.451 RKM-2018-003 (RSP11094)
  11. 0.450 RKM-2018-028 (RSP11120)
  12. 0.445 Gold Cracker (RSP11048)
  13. 0.442 Italian Kiss (RSP11034)
  14. 0.439 Blue Dream (RSP11033)
  15. 0.438 CST (RSP11002)
  16. 0.437 Golden Goat 2 (RSP10991)
  17. 0.436 Blueberry Cheesecake (RSP10680)
  18. 0.436 RKM-2018-032 (RSP11124)
  19. 0.429 Black Beauty (RSP11035)
  20. 0.429 RKM-2018-006 (RSP11097)

Nearest genetic relative in Phylos dataset

Phylos Strain SRR4448814
Overlapping SNPs:
66
Concordance:
39

Nearest genetic relative in Lynch dataset

Lynch Strain SRR3495216
Overlapping SNPs:
4
Concordance:
4

Blockchain Registration Information

Transaction ID
fff629338ea88a8b60fe5c0065b7a137ef0f820dff189942264e689e88cc6c16
Stamping Certificate
Download PDF (867.3 KB)
SHASUM Hash
c57b06cc2dc953e2ddae0233ca5607431859491243290fe88a760d8290072579
QR code for RSP11314

Kannapedia uses cookies

By clicking Allow All, you agree to the storing of cookies on your device to enhance site navigation, analyze site usage, and assist in our marketing efforts.

Customize Settings