Cherry Blossom

RSP 11316

Grower: Yabba Cannaba

General Information

Sample Name
CC4
Accession Date
October 16, 2019
Reported Plant Sex
Female

The strain rarity visualization shows how distant the strain is from the other cultivars in the Kannapedia database. The y-axis represents genetic distance, getting farther as you go up. The width of the visualization at any position along the y-axis shows how many strains there are in the database at that genetic distance. So, a common strain will have a more bottom-heavy shape, while uncommon and rare cultivars will have a visualization that is generally shifted towards the top.

Rarity: Uncommon
Most Distant Most Similar

Chemical Information

Cannabinoid and terpenoid information provided by the grower.

Cannabinoids

No information provided.

Terpenoids

No information provided.

Genetic Information

Plant Type
Type III

The bell curve in the heterozygosity visualization shows the distribution of heterozygosity levels for cannabis cultivars in the Kannapedia database. The green line shows where this particular strain fits within the distribution. Heterozygosity is associated with heterosis (aka hybrid vigor) but also leads to the production of more variable offspring. When plants have two genetically different parents, heterozygosity levels will be higher than if it has been inbred or backcrossed repeatedly.

Heterozygosity: 1.14%
Least Heterozygous Most Heterozygous

The ratio of reads mapped to Y-contigs to reads mapped to the whole Cannabis genome (Y-ratios) has been demonstrated to be strongly correlated with plant sex typing. This plot shows the distribution of Y-ratios for all samples in our database which were sequenced with the same method (panel or WGS) as this sample and where this sample falls in the distribution.

Y-Ratio Distribution: 0.0549
male female RSP11316

This chart represents the Illumina sequence coverage over the Bt/Bd allele. These are the three regions in the cannabis genome that impact THCA, CBDA, CBGA production. Coverage over the Active CBDAS gene is highly correlated with Type II and Type III plants as described by Etienne de Meijer. Coverage over the THCA gene is highly correlated with Type I and Type II plants but is anti-correlated with Type III plants. Type I plants require coverage over the inactive CBDA loci and no coverage over the Active CBDA gene. Lack of coverage over the Active CBDA and Active THCA allele are presumed to be Type IV plants (CBGA dominant). While deletions of entire THCAS and CBDAS genes are the most common Bt:Bd alleles observed, it is possible to have plants with these genes where functional expression of the enzyme is disrupted by deactivating point mutations (Kojoma et al. 2006).

Bt/Bd Allele Coverage

This chart represents the Illumina sequence coverage over the CBCA synthase gene.

CBCAS Coverage

Variants (THCAS, CBDAS, and CBCAS)

No variants to report

Variants (Select Genes of Interest)

PKSG-2a

UniProt

c.67T>A p.Phe23Ile missense variant moderate contig700 1945567

IGV: Start, Jump

A/T
NGS:
0.825
C90:
0.904
PKSG-2a

UniProt

c.31A>T p.Thr11Ser missense variant moderate contig700 1945603

IGV: Start, Jump

T/A
NGS:
0.763
C90:
0.876
PKSG-2b

UniProt

c.31A>T p.Thr11Ser missense variant moderate contig700 1951851

IGV: Start, Jump

T/A
NGS:
0.844
C90:
0.880
PKSG-4b

UniProt

c.496A>G p.Lys166Glu missense variant moderate contig700 2721177

IGV: Start, Jump

T/C
NGS:
0.651
C90:
0.684
PKSG-4b

UniProt

c.489delT p.Phe163fs frameshift variant high contig700 2721183

IGV: Start, Jump

CA/C
NGS:
0.792
C90:
0.761
PKSG-4b

UniProt

c.485A>G p.Lys162Arg missense variant moderate contig700 2721188

IGV: Start, Jump

T/C
NGS:
0.643
C90:
0.301
PKSG-4b

UniProt

c.431T>G p.Val144Gly missense variant moderate contig700 2721242

IGV: Start, Jump

A/C
NGS:
0.575
C90:
0.679
PKSG-4b

UniProt

c.419A>G p.Asp140Gly missense variant moderate contig700 2721254

IGV: Start, Jump

T/C
NGS:
0.430
C90:
0.440
aPT4

UniProt

c.97T>C p.Tyr33His missense variant moderate contig121 2828753

IGV: Start, Jump

T/C
NGS:
0.439
C90:
0.000
aPT4

UniProt

c.153A>C p.Lys51Asn missense variant moderate contig121 2828809

IGV: Start, Jump

A/C
NGS:
0.375
C90:
0.000
aPT4

UniProt

c.302A>G p.Asn101Ser missense variant moderate contig121 2829099

IGV: Start, Jump

A/G
NGS:
0.349
C90:
0.000
aPT4

UniProt

c.744+1_744+19delGTAATTTATTTTATTATAA splice donor variant & splice region variant & intron variant high contig121 2831022

IGV: Start, Jump

GGTAATTTATTTTATTATAA/G
NGS:
0.096
C90:
0.000
HDS-2

UniProt

c.82_93delGTAACCGGAACT p.Val28_Thr31del conservative inframe deletion moderate contig95 1989748

IGV: Start, Jump

CGTAACCGGAACT/C
NGS:
0.805
C90:
0.000
HDS-2

UniProt

c.127T>G p.Ser43Ala missense variant moderate contig95 1989794

IGV: Start, Jump

T/G
NGS:
0.721
C90:
0.000

Nearest genetic relatives (All Samples)

0 0.067 0.133 0.200 0.267
clone distance sibling distance more distant
  1. 0.121 Cherry Blossom (RSP11320)
  2. 0.155 Cherry Blossom (RSP11319)
  3. 0.168 Cherry Blossom (RSP11274)
  4. 0.178 Cherry Blossom (RSP11315)
  5. 0.179 Cherry Blossom (RSP11299)
  6. 0.184 Cherry Blossom (RSP11312)
  7. 0.199 Unknown- Cherry Wine - 002 (RSP11269)
  8. 0.205 Cherry Blossom (RSP11308)
  9. 0.205 Queen Dream CBG (RSP11286)
  10. 0.205 Cherry Blossom (RSP11335)
  11. 0.213 Blueberry Cheesecake (RSP10684)
  12. 0.216 Unknown- Cherry Wine - 003 (RSP11270)
  13. 0.219 Cherry Blossom (RSP11302)
  14. 0.221 Unknown- Cherry Wine - 005 (RSP11272)
  15. 0.224 Cherry Blossom (RSP11321)
  16. 0.228 Cherry Blossom (RSP11298)
  17. 0.231 Cherry Blossom (RSP11329)
  18. 0.236 Cherry Blossom (RSP11331)
  19. 0.236 Queen Dream CBG (RSP11280)
  20. 0.236 Cherry Wine (RSP11307)

Nearest genetic relatives (Base Tree)

0 0.092 0.183 0.275 0.367
clone distance sibling distance more distant
  1. 0.222 Blueberry Cheesecake (RSP10684)
  2. 0.278 Cbot-2019-004 (RSP11132)
  3. 0.291 Liberty Haze (RSP11000)
  4. 0.291 Durban Poison (RSP11014)
  5. 0.300 Blueberry Cheesecake (RSP10672)
  6. 0.310 UP Sunrise (RSP10989)
  7. 0.318 Cherry (RSP11142)
  8. 0.324 QUEEN JESUS (RSP10105)
  9. 0.340 Golden Goat 2 (RSP10991)
  10. 0.342 Cherry (RSP11143)
  11. 0.344 RKM-2018-005 (RSP11096)
  12. 0.346 Cbot-2019-005 (RSP11133)
  13. 0.357 Cbot-2019-001 (RSP11129)
  14. 0.357 RKM-2018-003 (RSP11094)
  15. 0.357 Gold Cracker (RSP11048)
  16. 0.359 Recon (RSP10755)
  17. 0.360 RKM-2018-019 (RSP11111)
  18. 0.365 RKM-2018-020 (RSP11112)
  19. 0.365 CST (RSP11002)
  20. 0.366 RKM-2018-027 (RSP11119)

Most genetically distant strains (All Samples)

0 0.125 0.250 0.375 0.500
clone distance sibling distance more distant
  1. 0.492 80E (RSP11213)
  2. 0.470 Abacus (RSP11266)
  3. 0.464 80E (RSP11211)
  4. 0.459 White Label 1 (RSP11336)
  5. 0.457 JL yellow (RSP11075)
  6. 0.455 Chem 91 (RSP11185)
  7. 0.445 Red Eye OG (RSP11190)
  8. 0.443 80E (RSP11212)
  9. 0.443 JL 3rd Gen Father (RSP11196)
  10. 0.442 RKM-2018-026 (RSP11118)
  11. 0.440 Feral (RSP10892)
  12. 0.436 Skywalker OG (RSP10837)
  13. 0.435 Star Dawg (RSP11352)
  14. 0.435 RKM-2018-002 (RSP11093)
  15. 0.435 Ivory (RSP10668)
  16. 0.433 501st OG (RSP11241)
  17. 0.433 JL 4th Gen 2 (RSP11194)
  18. 0.432 Garlic (RSP11341)
  19. 0.431 JL 4th Gen 5 (RSP11199)
  20. 0.431 JL 3rd Gen Mother (RSP11214)

Most genetically distant strains (Base Tree)

0 0.117 0.233 0.350 0.467
clone distance sibling distance more distant
  1. 0.455 JL yellow (RSP11075)
  2. 0.449 RKM-2018-026 (RSP11118)
  3. 0.442 Skywalker OG (RSP10837)
  4. 0.436 Ivory (RSP10668)
  5. 0.430 RKM-2018-002 (RSP11093)
  6. 0.428 Feral (RSP10890)
  7. 0.428 Monoica (RSP10241)
  8. 0.423 Carmagnola (RSP11037)
  9. 0.419 Santhica27 (RSP11047)
  10. 0.418 RKM-2018-009 (RSP11100)
  11. 0.417 Lovrin (RSP10658)
  12. 0.417 Carmagnola (RSP10979)
  13. 0.413 Sour Raspberry (RSP10551)
  14. 0.410 USO 31 (RSP10981)
  15. 0.408 Tisza (RSP11044)
  16. 0.407 Fedora 17 (RSP10661)
  17. 0.407 Futura 75 (RSP10664)
  18. 0.405 Hermaphrodite Research Sample1 (RSP11049)
  19. 0.405 Kyrgyz Gold (RSP11054)
  20. 0.404 RKM-2018-022 (RSP11114)

Nearest genetic relative in Phylos dataset

Phylos Strain SRR8347055
Overlapping SNPs:
64
Concordance:
37

Nearest genetic relative in Lynch dataset

Lynch Strain SRR3495160
Overlapping SNPs:
3
Concordance:
3

Blockchain Registration Information

Transaction ID
c80cb08a1997c56a485352fef5e42a21249d5423fbd4f469c9dfa305409ca936
Stamping Certificate
Download PDF (859.1 KB)
SHASUM Hash
95b569618456ec1bd3d132c76c3513bd04c570f30b698827dac9232bb3ca0e1c
QR code for RSP11316

Kannapedia uses cookies

By clicking Allow All, you agree to the storing of cookies on your device to enhance site navigation, analyze site usage, and assist in our marketing efforts.

Customize Settings