Cherry Blossom

RSP 11323

Grower: Yabba Cannaba

General Information

Sample Name
CI5
Accession Date
October 17, 2019
Reported Plant Sex
Female

The strain rarity visualization shows how distant the strain is from the other cultivars in the Kannapedia database. The y-axis represents genetic distance, getting farther as you go up. The width of the visualization at any position along the y-axis shows how many strains there are in the database at that genetic distance. So, a common strain will have a more bottom-heavy shape, while uncommon and rare cultivars will have a visualization that is generally shifted towards the top.

Rarity: Rare
Most Distant Most Similar

Chemical Information

Cannabinoid and terpenoid information provided by the grower.

Cannabinoids

No information provided.

Terpenoids

No information provided.

Genetic Information

Plant Type
Type III

The bell curve in the heterozygosity visualization shows the distribution of heterozygosity levels for cannabis cultivars in the Kannapedia database. The green line shows where this particular strain fits within the distribution. Heterozygosity is associated with heterosis (aka hybrid vigor) but also leads to the production of more variable offspring. When plants have two genetically different parents, heterozygosity levels will be higher than if it has been inbred or backcrossed repeatedly.

Heterozygosity: 0.89%
Least Heterozygous Most Heterozygous

The ratio of reads mapped to Y-contigs to reads mapped to the whole Cannabis genome (Y-ratios) has been demonstrated to be strongly correlated with plant sex typing. This plot shows the distribution of Y-ratios for all samples in our database which were sequenced with the same method (panel or WGS) as this sample and where this sample falls in the distribution.

Y-Ratio Distribution: 0.0425
male female RSP11323

This chart represents the Illumina sequence coverage over the Bt/Bd allele. These are the three regions in the cannabis genome that impact THCA, CBDA, CBGA production. Coverage over the Active CBDAS gene is highly correlated with Type II and Type III plants as described by Etienne de Meijer. Coverage over the THCA gene is highly correlated with Type I and Type II plants but is anti-correlated with Type III plants. Type I plants require coverage over the inactive CBDA loci and no coverage over the Active CBDA gene. Lack of coverage over the Active CBDA and Active THCA allele are presumed to be Type IV plants (CBGA dominant). While deletions of entire THCAS and CBDAS genes are the most common Bt:Bd alleles observed, it is possible to have plants with these genes where functional expression of the enzyme is disrupted by deactivating point mutations (Kojoma et al. 2006).

Bt/Bd Allele Coverage

This chart represents the Illumina sequence coverage over the CBCA synthase gene.

CBCAS Coverage

Variants (THCAS, CBDAS, and CBCAS)

No variants to report

Variants (Select Genes of Interest)

PKSG-4a

UniProt

c.493G>A p.Gly165Ser missense variant moderate contig700 1937904

IGV: Start, Jump

G/A
NGS:
0.103
C90:
0.000
PKSG-4a

UniProt

c.1191_1193delTTA p.Tyr398del disruptive inframe deletion moderate contig700 1938600

IGV: Start, Jump

AATT/A
NGS:
0.167
C90:
0.000
PKSG-2b

UniProt

c.1117A>G p.Ile373Val missense variant moderate contig700 1950521

IGV: Start, Jump

T/C
NGS:
0.807
C90:
0.981
PKSG-4b

UniProt

c.496A>G p.Lys166Glu missense variant moderate contig700 2721177

IGV: Start, Jump

T/C
NGS:
0.651
C90:
0.684
PKSG-4b

UniProt

c.489delT p.Phe163fs frameshift variant high contig700 2721183

IGV: Start, Jump

CA/C
NGS:
0.792
C90:
0.761
PKSG-4b

UniProt

c.485A>G p.Lys162Arg missense variant moderate contig700 2721188

IGV: Start, Jump

T/C
NGS:
0.643
C90:
0.301
PKSG-4b

UniProt

c.352_355delACAG p.Thr118fs frameshift variant high contig700 2721317

IGV: Start, Jump

CCTGT/C
NGS:
0.529
C90:
0.000
PKSG-4b

UniProt

c.324A>C p.Glu108Asp missense variant moderate contig700 2721349

IGV: Start, Jump

T/G
NGS:
0.094
C90:
0.000
PKSG-4b

UniProt

c.323A>G p.Glu108Gly missense variant moderate contig700 2721350

IGV: Start, Jump

T/C
NGS:
0.469
C90:
0.000
aPT4

UniProt

c.97T>C p.Tyr33His missense variant moderate contig121 2828753

IGV: Start, Jump

T/C
NGS:
0.439
C90:
0.000
aPT4

UniProt

c.153A>C p.Lys51Asn missense variant moderate contig121 2828809

IGV: Start, Jump

A/C
NGS:
0.375
C90:
0.000
aPT4

UniProt

c.235_236delGT p.Val79fs frameshift variant high contig121 2829030

IGV: Start, Jump

ATG/A
NGS:
0.417
C90:
0.000
aPT4

UniProt

c.238delT p.Ser80fs frameshift variant high contig121 2829034

IGV: Start, Jump

AT/A
NGS:
0.421
C90:
0.000
aPT4

UniProt

c.302A>G p.Asn101Ser missense variant moderate contig121 2829099

IGV: Start, Jump

A/G
NGS:
0.349
C90:
0.000
aPT4

UniProt

c.744+1_744+19delGTAATTTATTTTATTATAA splice donor variant & splice region variant & intron variant high contig121 2831022

IGV: Start, Jump

GGTAATTTATTTTATTATAA/G
NGS:
0.096
C90:
0.000
HDS-2

UniProt

c.82_93delGTAACCGGAACT p.Val28_Thr31del conservative inframe deletion moderate contig95 1989748

IGV: Start, Jump

CGTAACCGGAACT/C
NGS:
0.805
C90:
0.000
HDS-2

UniProt

c.127T>G p.Ser43Ala missense variant moderate contig95 1989794

IGV: Start, Jump

T/G
NGS:
0.721
C90:
0.000

Nearest genetic relatives (All Samples)

0 0.083 0.167 0.250 0.333
clone distance sibling distance more distant
  1. 0.213 Cherry Blossom (RSP11327)
  2. 0.217 Cherry Blossom (RSP11274)
  3. 0.227 Cherry Blossom (RSP11321)
  4. 0.242 Cherry Blossom (RSP11331)
  5. 0.244 Cherry Blossom (RSP11299)
  6. 0.250 Unknown- Cherry Wine - 001 (RSP11268)
  7. 0.255 Cherry Blossom (RSP11334)
  8. 0.263 Cherry Blossom (RSP11318)
  9. 0.267 Cherry Blossom (RSP11301)
  10. 0.271 Queen Dream CBG (RSP11277)
  11. 0.273 Cherry Blossom CBG (RSP11303)
  12. 0.275 Queen Dream (RSP11289)
  13. 0.279 Cherry Blossom (RSP11302)
  14. 0.294 Cherry Blossom (RSP11315)
  15. 0.308 Cherry Blossom (RSP11322)
  16. 0.308 Unknown- Cherry Wine - 002 (RSP11269)
  17. 0.310 Cherry Blossom (RSP11316)
  18. 0.313 Avidekel (RSP10938)
  19. 0.315 Cherry Blossom (RSP11298)
  20. 0.318 Queen Dream (RSP11288)

Nearest genetic relatives (Base Tree)

0 0.117 0.233 0.350 0.467
clone distance sibling distance more distant
  1. 0.351 Cherry (RSP11143)
  2. 0.358 UP Sunrise (RSP10989)
  3. 0.381 Blueberry Cheesecake (RSP10684)
  4. 0.400 Cbot-2019-001 (RSP11129)
  5. 0.401 Tygra (RSP10667)
  6. 0.401 Cbot-2019-004 (RSP11132)
  7. 0.403 RKM-2018-005 (RSP11096)
  8. 0.414 QUEEN JESUS (RSP10105)
  9. 0.414 RKM-2018-018 (RSP11110)
  10. 0.417 Sour Raspberry (RSP10551)
  11. 0.421 Liberty Haze (RSP11000)
  12. 0.426 Durban Poison (RSP11014)
  13. 0.427 Ivory (RSP10668)
  14. 0.428 RKM-2018-028 (RSP11120)
  15. 0.434 Hermaphrodite Research Sample1 (RSP11049)
  16. 0.438 Blue Dream (RSP11033)
  17. 0.438 Blueberry Cheesecake (RSP10672)
  18. 0.446 Hermaphrodite ResearchSample2 (RSP11050)
  19. 0.448 Carmagnola (RSP10979)
  20. 0.448 Tisza (RSP10659)

Most genetically distant strains (All Samples)

0 0.142 0.283 0.425 0.567
clone distance sibling distance more distant
  1. 0.545 White Label 1 (RSP11336)
  2. 0.539 Cherry (RSP11142)
  3. 0.530 80E (RSP11211)
  4. 0.530 80E (RSP11213)
  5. 0.520 RKM-2018-022 (RSP11114)
  6. 0.515 RKM-2018-026 (RSP11118)
  7. 0.513 80E (RSP11212)
  8. 0.502 Rugburn OG (RSP11353)
  9. 0.502 Abacus (RSP11266)
  10. 0.500 Cherry Blossom (RSP11300)
  11. 0.498 Garlic (RSP11341)
  12. 0.494 Red Eye OG (RSP11190)
  13. 0.491 Skywalker OG (RSP10837)
  14. 0.489 White Label 2 (RSP11337)
  15. 0.489 Kush Hemp E1 (RSP11128)
  16. 0.487 Dominion Skunk (RSP11354)
  17. 0.486 RKM-2018-013 (RSP11104)
  18. 0.486 Big Bud (RSP11221)
  19. 0.485 SFVxTK (RSP11072)
  20. 0.484 Strawberry Cough (RSP11356)

Most genetically distant strains (Base Tree)

0 0.142 0.283 0.425 0.567
clone distance sibling distance more distant
  1. 0.540 Cherry (RSP11142)
  2. 0.527 RKM-2018-022 (RSP11114)
  3. 0.520 RKM-2018-026 (RSP11118)
  4. 0.501 Kush Hemp E1 (RSP11128)
  5. 0.497 Skywalker OG (RSP10837)
  6. 0.486 Gold Cracker (RSP11048)
  7. 0.484 RKM-2018-031 (RSP11123)
  8. 0.484 RKM-2018-027 (RSP11119)
  9. 0.482 Recon (RSP10755)
  10. 0.481 RKM-2018-020 (RSP11112)
  11. 0.481 RKM-2018-002 (RSP11093)
  12. 0.473 Pie Hoe (RSP11073)
  13. 0.472 Black Beauty (RSP11035)
  14. 0.467 RKM-2018-019 (RSP11111)
  15. 0.465 Monoica (RSP10241)
  16. 0.464 Carmagnola (RSP11037)
  17. 0.464 Cbot-2019-006 (RSP11134)
  18. 0.463 Skunk 18 (RSP11038)
  19. 0.463 Santhica27 (RSP11047)
  20. 0.463 Tisza (RSP11044)

Nearest genetic relative in Phylos dataset

Phylos Strain SRR4448209
Overlapping SNPs:
63
Concordance:
40

Nearest genetic relative in Lynch dataset

Lynch Strain SRR3495321
Overlapping SNPs:
7
Concordance:
7

Blockchain Registration Information

Transaction ID
ad0115ce868ba14211b8c02d24228d429cd96e51862839b604016ecc235877c5
Stamping Certificate
Download PDF (855.4 KB)
SHASUM Hash
ebfa12c8bdc7a9d402eb7493c5f59e57412409544e86fb800120a17ef6e9d71a
QR code for RSP11323

Kannapedia uses cookies

By clicking Allow All, you agree to the storing of cookies on your device to enhance site navigation, analyze site usage, and assist in our marketing efforts.

Customize Settings