Cherry Blossom

RSP 11324

Grower: Yabba Cannaba

General Information

Sample Name
CG4
Accession Date
October 17, 2019
Reported Plant Sex
Female

The strain rarity visualization shows how distant the strain is from the other cultivars in the Kannapedia database. The y-axis represents genetic distance, getting farther as you go up. The width of the visualization at any position along the y-axis shows how many strains there are in the database at that genetic distance. So, a common strain will have a more bottom-heavy shape, while uncommon and rare cultivars will have a visualization that is generally shifted towards the top.

Rarity: Rare
Most Distant Most Similar

Chemical Information

Cannabinoid and terpenoid information provided by the grower.

Cannabinoids

No information provided.

Terpenoids

No information provided.

Genetic Information

Plant Type
Type III

The bell curve in the heterozygosity visualization shows the distribution of heterozygosity levels for cannabis cultivars in the Kannapedia database. The green line shows where this particular strain fits within the distribution. Heterozygosity is associated with heterosis (aka hybrid vigor) but also leads to the production of more variable offspring. When plants have two genetically different parents, heterozygosity levels will be higher than if it has been inbred or backcrossed repeatedly.

Heterozygosity: 1.14%
Least Heterozygous Most Heterozygous

The ratio of reads mapped to Y-contigs to reads mapped to the whole Cannabis genome (Y-ratios) has been demonstrated to be strongly correlated with plant sex typing. This plot shows the distribution of Y-ratios for all samples in our database which were sequenced with the same method (panel or WGS) as this sample and where this sample falls in the distribution.

Y-Ratio Distribution: 0.0557
male female RSP11324

This chart represents the Illumina sequence coverage over the Bt/Bd allele. These are the three regions in the cannabis genome that impact THCA, CBDA, CBGA production. Coverage over the Active CBDAS gene is highly correlated with Type II and Type III plants as described by Etienne de Meijer. Coverage over the THCA gene is highly correlated with Type I and Type II plants but is anti-correlated with Type III plants. Type I plants require coverage over the inactive CBDA loci and no coverage over the Active CBDA gene. Lack of coverage over the Active CBDA and Active THCA allele are presumed to be Type IV plants (CBGA dominant). While deletions of entire THCAS and CBDAS genes are the most common Bt:Bd alleles observed, it is possible to have plants with these genes where functional expression of the enzyme is disrupted by deactivating point mutations (Kojoma et al. 2006).

Bt/Bd Allele Coverage

This chart represents the Illumina sequence coverage over the CBCA synthase gene.

CBCAS Coverage

Variants (THCAS, CBDAS, and CBCAS)

CBDAS c.221C>G p.Thr74Ser missense variant moderate contig1772 2082447

IGV: Start, Jump

C/G
NGS:
0.136
C90:
0.057
CBDAS c.1420A>C p.Lys474Gln missense variant moderate contig1772 2083646

IGV: Start, Jump

A/C
NGS:
0.132
C90:
0.813

Variants (Select Genes of Interest)

PKSG-4a

UniProt

c.493G>A p.Gly165Ser missense variant moderate contig700 1937904

IGV: Start, Jump

G/A
NGS:
0.103
C90:
0.000
PKSG-4a

UniProt

c.1191_1193delTTA p.Tyr398del disruptive inframe deletion moderate contig700 1938600

IGV: Start, Jump

AATT/A
NGS:
0.167
C90:
0.000
PKSG-2b

UniProt

c.1117A>G p.Ile373Val missense variant moderate contig700 1950521

IGV: Start, Jump

T/C
NGS:
0.807
C90:
0.981
PKSG-4b

UniProt

c.496A>G p.Lys166Glu missense variant moderate contig700 2721177

IGV: Start, Jump

T/C
NGS:
0.651
C90:
0.684
PKSG-4b

UniProt

c.489delT p.Phe163fs frameshift variant high contig700 2721183

IGV: Start, Jump

CA/C
NGS:
0.792
C90:
0.761
PKSG-4b

UniProt

c.485A>G p.Lys162Arg missense variant moderate contig700 2721188

IGV: Start, Jump

T/C
NGS:
0.643
C90:
0.301
PKSG-4b

UniProt

c.352_355delACAG p.Thr118fs frameshift variant high contig700 2721317

IGV: Start, Jump

CCTGT/C
NGS:
0.529
C90:
0.000
PKSG-4b

UniProt

c.324A>C p.Glu108Asp missense variant moderate contig700 2721349

IGV: Start, Jump

T/G
NGS:
0.094
C90:
0.000
PKSG-4b

UniProt

c.323A>G p.Glu108Gly missense variant moderate contig700 2721350

IGV: Start, Jump

T/C
NGS:
0.469
C90:
0.000
aPT4

UniProt

c.97T>C p.Tyr33His missense variant moderate contig121 2828753

IGV: Start, Jump

T/C
NGS:
0.439
C90:
0.000
aPT4

UniProt

c.235_236delGT p.Val79fs frameshift variant high contig121 2829030

IGV: Start, Jump

ATG/A
NGS:
0.417
C90:
0.000
aPT4

UniProt

c.238delT p.Ser80fs frameshift variant high contig121 2829034

IGV: Start, Jump

AT/A
NGS:
0.421
C90:
0.000
aPT4

UniProt

c.302A>G p.Asn101Ser missense variant moderate contig121 2829099

IGV: Start, Jump

A/G
NGS:
0.349
C90:
0.000
aPT4

UniProt

c.744+1_744+19delGTAATTTATTTTATTATAA splice donor variant & splice region variant & intron variant high contig121 2831022

IGV: Start, Jump

GGTAATTTATTTTATTATAA/G
NGS:
0.096
C90:
0.000
aPT4

UniProt

c.744G>A p.Met248Ile missense variant & splice region variant moderate contig121 2831022

IGV: Start, Jump

GGTAATTTATTTTATTATAA/AGTAATTTATTTTATTATAA
NGS:
0.002
C90:
0.000

Nearest genetic relatives (All Samples)

0 0.067 0.133 0.200 0.267
clone distance sibling distance more distant
  1. 0.102 Cherry Blossom (RSP11333)
  2. 0.172 Unknown- Cherry Wine - 005 (RSP11272)
  3. 0.183 Cherry Blossom (RSP11317)
  4. 0.188 Cherry Blossom (RSP11330)
  5. 0.191 Cherry Blossom (RSP11299)
  6. 0.194 Cherry Blossom (RSP11331)
  7. 0.199 Cherry Blossom (RSP11313)
  8. 0.211 Cherry Blossom (RSP11302)
  9. 0.221 Cherry Blossom (RSP11334)
  10. 0.224 Cherry Blossom (RSP11332)
  11. 0.229 Unknown- Cherry Wine - 004 (RSP11271)
  12. 0.239 Cherry Blossom (RSP11308)
  13. 0.240 Cherry Blossom (RSP11325)
  14. 0.240 Cherry Blossom (RSP11335)
  15. 0.242 Cherry Blossom (RSP11322)
  16. 0.244 Cherry Blossom (RSP11320)
  17. 0.246 Cherry Blossom CBG (RSP11303)
  18. 0.247 Queen Dream CBG (RSP11275)
  19. 0.250 Cherry Blossom (RSP11329)
  20. 0.258 Cherry Blossom (RSP11310)

Nearest genetic relatives (Base Tree)

0 0.100 0.200 0.300 0.400
clone distance sibling distance more distant
  1. 0.311 Cherry (RSP11142)
  2. 0.313 Recon (RSP10755)
  3. 0.314 Blueberry Cheesecake (RSP10684)
  4. 0.335 Durban Poison (RSP11014)
  5. 0.335 Liberty Haze (RSP11000)
  6. 0.344 Cbot-2019-005 (RSP11133)
  7. 0.349 UP Sunrise (RSP10989)
  8. 0.363 Gold Cracker (RSP11048)
  9. 0.363 Kimbo Slice (RSP10997)
  10. 0.368 Kush Hemp E1 (RSP11128)
  11. 0.369 The Gift (RSP10988)
  12. 0.372 Cbot-2019-001 (RSP11129)
  13. 0.374 Tygra (RSP10667)
  14. 0.375 Hermaphrodite ResearchSample2 (RSP11050)
  15. 0.375 RKM-2018-006 (RSP11097)
  16. 0.380 RKM-2018-027 (RSP11119)
  17. 0.383 Tisza (RSP10659)
  18. 0.385 RKM-2018-031 (RSP11123)
  19. 0.386 Lovrin (RSP10658)
  20. 0.386 Pie Hoe (RSP11073)

Most genetically distant strains (All Samples)

0 0.125 0.250 0.375 0.500
clone distance sibling distance more distant
  1. 0.489 RKM-2018-002 (RSP11093)
  2. 0.483 RKM-2018-024 (RSP11116)
  3. 0.483 JL 4th Gen 5 (RSP11199)
  4. 0.482 JL yellow (RSP11075)
  5. 0.481 Chem 91 (RSP11185)
  6. 0.477 JL 3rd Gen Mother (RSP11214)
  7. 0.475 RKM-2018-018 (RSP11110)
  8. 0.468 Sour Raspberry (RSP10551)
  9. 0.466 JL 3rd Gen Mother (RSP11197)
  10. 0.460 Skunk 18 (RSP11030)
  11. 0.459 JL 4th Gen 2 (RSP11194)
  12. 0.459 Skunk 18 (RSP11038)
  13. 0.458 RKM-2018-033 (RSP11125)
  14. 0.453 Black Beauty (RSP11035)
  15. 0.451 Herijuana (RSP11181)
  16. 0.450 Danny Noonan (RSP11070)
  17. 0.449 JL 4th Gen 3 (RSP11195)
  18. 0.447 RKM-2018-028 (RSP11120)
  19. 0.447 Black Beauty (RSP11036)
  20. 0.447 AVIDEKEL USA (RSP11169)

Most genetically distant strains (Base Tree)

0 0.125 0.250 0.375 0.500
clone distance sibling distance more distant
  1. 0.498 RKM-2018-002 (RSP11093)
  2. 0.485 JL yellow (RSP11075)
  3. 0.483 RKM-2018-018 (RSP11110)
  4. 0.467 Sour Raspberry (RSP10551)
  5. 0.464 Black Beauty (RSP11035)
  6. 0.462 RKM-2018-033 (RSP11125)
  7. 0.456 Italian Kiss (RSP11034)
  8. 0.456 Skunk 18 (RSP11038)
  9. 0.452 Hermaphrodite Research Sample1 (RSP11049)
  10. 0.449 RKM-2018-028 (RSP11120)
  11. 0.448 RKM-2018-005 (RSP11096)
  12. 0.442 RKM-2018-023 (RSP11115)
  13. 0.442 Feral (RSP10890)
  14. 0.438 Blueberry Cheesecake (RSP10672)
  15. 0.433 RKM-2018-009 (RSP11100)
  16. 0.428 Cbot-2019-006 (RSP11134)
  17. 0.425 Blueberry Cheesecake (RSP10680)
  18. 0.423 RKM-2018-022 (RSP11114)
  19. 0.419 RKM-2018-029 (RSP11121)
  20. 0.419 Skywalker OG (RSP10837)

Nearest genetic relative in Phylos dataset

Phylos Strain SRR8347299
Overlapping SNPs:
66
Concordance:
39

Nearest genetic relative in Lynch dataset

Lynch Strain SRR3495216
Overlapping SNPs:
4
Concordance:
4

Blockchain Registration Information

Transaction ID
d22c7e4454ed9c70585bd5834c6ab54f16c186b098d12910bfe59d9151598615
Stamping Certificate
Download PDF (847.2 KB)
SHASUM Hash
a64d14f01327d4e61828eff1d707887d81ea6d2c32a6686edbcddd5d54a830a0
QR code for RSP11324

Kannapedia uses cookies

By clicking Allow All, you agree to the storing of cookies on your device to enhance site navigation, analyze site usage, and assist in our marketing efforts.

Customize Settings