Cherry Blossom

RSP 11325

Grower: Yabba Cannaba

General Information

Sample Name
CK5
Accession Date
October 17, 2019
Reported Plant Sex
Female

The strain rarity visualization shows how distant the strain is from the other cultivars in the Kannapedia database. The y-axis represents genetic distance, getting farther as you go up. The width of the visualization at any position along the y-axis shows how many strains there are in the database at that genetic distance. So, a common strain will have a more bottom-heavy shape, while uncommon and rare cultivars will have a visualization that is generally shifted towards the top.

Rarity: Rare
Most Distant Most Similar

Chemical Information

Cannabinoid and terpenoid information provided by the grower.

Cannabinoids

No information provided.

Terpenoids

No information provided.

Genetic Information

Plant Type
Type III

The bell curve in the heterozygosity visualization shows the distribution of heterozygosity levels for cannabis cultivars in the Kannapedia database. The green line shows where this particular strain fits within the distribution. Heterozygosity is associated with heterosis (aka hybrid vigor) but also leads to the production of more variable offspring. When plants have two genetically different parents, heterozygosity levels will be higher than if it has been inbred or backcrossed repeatedly.

Heterozygosity: 0.97%
Least Heterozygous Most Heterozygous

The ratio of reads mapped to Y-contigs to reads mapped to the whole Cannabis genome (Y-ratios) has been demonstrated to be strongly correlated with plant sex typing. This plot shows the distribution of Y-ratios for all samples in our database which were sequenced with the same method (panel or WGS) as this sample and where this sample falls in the distribution.

Y-Ratio Distribution: 0.0441
male female RSP11325

This chart represents the Illumina sequence coverage over the Bt/Bd allele. These are the three regions in the cannabis genome that impact THCA, CBDA, CBGA production. Coverage over the Active CBDAS gene is highly correlated with Type II and Type III plants as described by Etienne de Meijer. Coverage over the THCA gene is highly correlated with Type I and Type II plants but is anti-correlated with Type III plants. Type I plants require coverage over the inactive CBDA loci and no coverage over the Active CBDA gene. Lack of coverage over the Active CBDA and Active THCA allele are presumed to be Type IV plants (CBGA dominant). While deletions of entire THCAS and CBDAS genes are the most common Bt:Bd alleles observed, it is possible to have plants with these genes where functional expression of the enzyme is disrupted by deactivating point mutations (Kojoma et al. 2006).

Bt/Bd Allele Coverage

This chart represents the Illumina sequence coverage over the CBCA synthase gene.

CBCAS Coverage

Variants (THCAS, CBDAS, and CBCAS)

No variants to report

Variants (Select Genes of Interest)

GPPs1

UniProt

c.845_848delAAAG p.Glu282fs frameshift variant high contig676 169629

IGV: Start, Jump

TGAAA/T
NGS:
0.118
C90:
0.000
PKSG-4a

UniProt

c.493G>A p.Gly165Ser missense variant moderate contig700 1937904

IGV: Start, Jump

G/A
NGS:
0.103
C90:
0.000
PKSG-4a

UniProt

c.1191_1193delTTA p.Tyr398del disruptive inframe deletion moderate contig700 1938600

IGV: Start, Jump

AATT/A
NGS:
0.167
C90:
0.000
PKSG-2a

UniProt

c.67T>A p.Phe23Ile missense variant moderate contig700 1945567

IGV: Start, Jump

A/T
NGS:
0.825
C90:
0.904
PKSG-2a

UniProt

c.31A>T p.Thr11Ser missense variant moderate contig700 1945603

IGV: Start, Jump

T/A
NGS:
0.763
C90:
0.876
PKSG-2b

UniProt

c.1117A>G p.Ile373Val missense variant moderate contig700 1950521

IGV: Start, Jump

T/C
NGS:
0.807
C90:
0.981
PKSG-2b

UniProt

c.774G>A p.Met258Ile missense variant moderate contig700 1950864

IGV: Start, Jump

C/T
NGS:
0.366
C90:
0.947
PKSG-2b

UniProt

c.31A>T p.Thr11Ser missense variant moderate contig700 1951851

IGV: Start, Jump

T/A
NGS:
0.844
C90:
0.880
PKSG-4b

UniProt

c.496A>G p.Lys166Glu missense variant moderate contig700 2721177

IGV: Start, Jump

T/C
NGS:
0.651
C90:
0.684
PKSG-4b

UniProt

c.489delT p.Phe163fs frameshift variant high contig700 2721183

IGV: Start, Jump

CA/C
NGS:
0.792
C90:
0.761
PKSG-4b

UniProt

c.485A>G p.Lys162Arg missense variant moderate contig700 2721188

IGV: Start, Jump

T/C
NGS:
0.643
C90:
0.301
PKSG-4b

UniProt

c.431T>G p.Val144Gly missense variant moderate contig700 2721242

IGV: Start, Jump

A/C
NGS:
0.575
C90:
0.679
PKSG-4b

UniProt

c.419A>G p.Asp140Gly missense variant moderate contig700 2721254

IGV: Start, Jump

T/C
NGS:
0.430
C90:
0.440
PKSG-4b

UniProt

c.352_355delACAG p.Thr118fs frameshift variant high contig700 2721317

IGV: Start, Jump

CCTGT/C
NGS:
0.529
C90:
0.000
PKSG-4b

UniProt

c.324A>C p.Glu108Asp missense variant moderate contig700 2721349

IGV: Start, Jump

T/G
NGS:
0.094
C90:
0.000
PKSG-4b

UniProt

c.323A>G p.Glu108Gly missense variant moderate contig700 2721350

IGV: Start, Jump

T/C
NGS:
0.469
C90:
0.000
aPT4

UniProt

c.97T>C p.Tyr33His missense variant moderate contig121 2828753

IGV: Start, Jump

T/C
NGS:
0.439
C90:
0.000
aPT4

UniProt

c.153A>C p.Lys51Asn missense variant moderate contig121 2828809

IGV: Start, Jump

A/C
NGS:
0.375
C90:
0.000
aPT4

UniProt

c.235_236delGT p.Val79fs frameshift variant high contig121 2829030

IGV: Start, Jump

ATG/A
NGS:
0.417
C90:
0.000
aPT4

UniProt

c.238delT p.Ser80fs frameshift variant high contig121 2829034

IGV: Start, Jump

AT/A
NGS:
0.421
C90:
0.000
aPT4

UniProt

c.302A>G p.Asn101Ser missense variant moderate contig121 2829099

IGV: Start, Jump

A/G
NGS:
0.349
C90:
0.000
aPT4

UniProt

c.744+1_744+19delGTAATTTATTTTATTATAA splice donor variant & splice region variant & intron variant high contig121 2831022

IGV: Start, Jump

GGTAATTTATTTTATTATAA/G
NGS:
0.096
C90:
0.000

Nearest genetic relatives (All Samples)

0 0.067 0.133 0.200 0.267
clone distance sibling distance more distant
  1. 0.078 Cherry Blossom (RSP11315)
  2. 0.103 Cherry Blossom (RSP11306)
  3. 0.154 Unknown- Cherry Wine - 005 (RSP11272)
  4. 0.185 Cherry Blossom (RSP11332)
  5. 0.205 Cherry Blossom CBG (RSP11303)
  6. 0.207 Unknown- Cherry Wine - 004 (RSP11271)
  7. 0.212 Cherry Blossom (RSP11329)
  8. 0.214 Cherry Blossom (RSP11322)
  9. 0.223 Cherry Blossom (RSP11320)
  10. 0.224 Wife (RSP11148)
  11. 0.228 Cherry Blossom (RSP11327)
  12. 0.229 Cherry Blossom (RSP11299)
  13. 0.239 Queen Dream CBG (RSP11275)
  14. 0.240 Cherry Blossom (RSP11324)
  15. 0.247 Cherry Blossom (RSP11316)
  16. 0.251 FL30 (RSP11361)
  17. 0.255 Queen Dream CBG (RSP11285)
  18. 0.260 Cherry Blossom (RSP11301)
  19. 0.260 Blue Dream (RSP11010)
  20. 0.263 Midnight (RSP10941)

Nearest genetic relatives (Base Tree)

0 0.100 0.200 0.300 0.400
clone distance sibling distance more distant
  1. 0.266 UP Sunrise (RSP10989)
  2. 0.282 Cbot-2019-001 (RSP11129)
  3. 0.307 Cbot-2019-004 (RSP11132)
  4. 0.328 Liberty Haze (RSP11000)
  5. 0.341 RKM-2018-006 (RSP11097)
  6. 0.342 Durban Poison (RSP11014)
  7. 0.360 Blueberry Cheesecake (RSP10684)
  8. 0.368 Tygra (RSP10667)
  9. 0.369 Cherry (RSP11143)
  10. 0.373 Italian Kiss (RSP11034)
  11. 0.374 Kimbo Slice (RSP10997)
  12. 0.375 Blue Dream (RSP11033)
  13. 0.378 RKM-2018-027 (RSP11119)
  14. 0.379 RKM-2018-003 (RSP11094)
  15. 0.380 RKM-2018-009 (RSP11100)
  16. 0.381 Recon (RSP10755)
  17. 0.381 RKM-2018-020 (RSP11112)
  18. 0.382 The Gift (RSP10988)
  19. 0.383 QUEEN JESUS (RSP10105)
  20. 0.383 CST (RSP11002)

Most genetically distant strains (All Samples)

0 0.133 0.267 0.400 0.533
clone distance sibling distance more distant
  1. 0.505 Star Dawg (RSP11352)
  2. 0.489 Garlic (RSP11341)
  3. 0.484 Red Eye OG (RSP11190)
  4. 0.480 RKM-2018-002 (RSP11093)
  5. 0.478 Abacus (RSP11266)
  6. 0.474 RKM-2018-022 (RSP11114)
  7. 0.471 JL 3rd Gen Father (RSP11196)
  8. 0.467 JL 4th Gen 2 (RSP11194)
  9. 0.466 MENDO BREATH (RSP11242)
  10. 0.462 Eran Almog (RSP10937)
  11. 0.462 Rugburn OG (RSP11353)
  12. 0.461 Dominion Skunk (RSP11354)
  13. 0.460 Feral (RSP11205)
  14. 0.460 New York City Deisel (RSP11225)
  15. 0.458 Gorilla Cookies (RSP11231)
  16. 0.457 RKM-2018-019 (RSP11111)
  17. 0.457 JABBA S STASH (RSP11348)
  18. 0.454 Skunk 18 (RSP11030)
  19. 0.453 Sour D (RSP11343)
  20. 0.452 Square Wave (RSP11344)

Most genetically distant strains (Base Tree)

0 0.125 0.250 0.375 0.500
clone distance sibling distance more distant
  1. 0.484 RKM-2018-002 (RSP11093)
  2. 0.478 RKM-2018-022 (RSP11114)
  3. 0.465 RKM-2018-019 (RSP11111)
  4. 0.460 Skywalker OG (RSP10837)
  5. 0.458 RKM-2018-034 (RSP11126)
  6. 0.458 Skunk 18 (RSP11038)
  7. 0.453 RKM-2018-026 (RSP11118)
  8. 0.450 Pie Hoe (RSP11073)
  9. 0.444 Feral (RSP10890)
  10. 0.440 Cbot-2019-006 (RSP11134)
  11. 0.440 Black Beauty (RSP11035)
  12. 0.431 RKM-2018-023 (RSP11115)
  13. 0.428 Jiangji (RSP10653)
  14. 0.427 RKM-2018-033 (RSP11125)
  15. 0.427 Tisza (RSP11044)
  16. 0.423 JL yellow (RSP11075)
  17. 0.423 Monoica (RSP10241)
  18. 0.423 RKM-2018-005 (RSP11096)
  19. 0.422 Golden Goat 2 (RSP10991)
  20. 0.420 Kush Hemp E1 (RSP11128)

Nearest genetic relative in Phylos dataset

Phylos Strain SRR8346914
Overlapping SNPs:
64
Concordance:
39

Nearest genetic relative in Lynch dataset

Lynch Strain SRR3495157
Overlapping SNPs:
3
Concordance:
3

Blockchain Registration Information

Transaction ID
0b23efe3d0bf9e14e9da31d44d7ad093def4d3e7575cf23305c14814d0f82d2f
Stamping Certificate
Download PDF (839.6 KB)
SHASUM Hash
039129b5dc2a665260d69af1cb21e6dbe94745fa290782c7a0650a8bcd88a2e1
QR code for RSP11325

Kannapedia uses cookies

By clicking Allow All, you agree to the storing of cookies on your device to enhance site navigation, analyze site usage, and assist in our marketing efforts.

Customize Settings