Cherry Blossom

RSP 11326

Grower: Yabba Cannaba

General Information

Sample Name
CG8
Accession Date
October 17, 2019
Reported Plant Sex
Female

The strain rarity visualization shows how distant the strain is from the other cultivars in the Kannapedia database. The y-axis represents genetic distance, getting farther as you go up. The width of the visualization at any position along the y-axis shows how many strains there are in the database at that genetic distance. So, a common strain will have a more bottom-heavy shape, while uncommon and rare cultivars will have a visualization that is generally shifted towards the top.

Rarity: Uncommon
Most Distant Most Similar

Chemical Information

Cannabinoid and terpenoid information provided by the grower.

Cannabinoids

No information provided.

Terpenoids

No information provided.

Genetic Information

Plant Type
Type III

The bell curve in the heterozygosity visualization shows the distribution of heterozygosity levels for cannabis cultivars in the Kannapedia database. The green line shows where this particular strain fits within the distribution. Heterozygosity is associated with heterosis (aka hybrid vigor) but also leads to the production of more variable offspring. When plants have two genetically different parents, heterozygosity levels will be higher than if it has been inbred or backcrossed repeatedly.

Heterozygosity: 1.15%
Least Heterozygous Most Heterozygous

The ratio of reads mapped to Y-contigs to reads mapped to the whole Cannabis genome (Y-ratios) has been demonstrated to be strongly correlated with plant sex typing. This plot shows the distribution of Y-ratios for all samples in our database which were sequenced with the same method (panel or WGS) as this sample and where this sample falls in the distribution.

Y-Ratio Distribution: 0.0557
male female RSP11326

This chart represents the Illumina sequence coverage over the Bt/Bd allele. These are the three regions in the cannabis genome that impact THCA, CBDA, CBGA production. Coverage over the Active CBDAS gene is highly correlated with Type II and Type III plants as described by Etienne de Meijer. Coverage over the THCA gene is highly correlated with Type I and Type II plants but is anti-correlated with Type III plants. Type I plants require coverage over the inactive CBDA loci and no coverage over the Active CBDA gene. Lack of coverage over the Active CBDA and Active THCA allele are presumed to be Type IV plants (CBGA dominant). While deletions of entire THCAS and CBDAS genes are the most common Bt:Bd alleles observed, it is possible to have plants with these genes where functional expression of the enzyme is disrupted by deactivating point mutations (Kojoma et al. 2006).

Bt/Bd Allele Coverage

This chart represents the Illumina sequence coverage over the CBCA synthase gene.

CBCAS Coverage

Variants (THCAS, CBDAS, and CBCAS)

CBDAS c.221C>G p.Thr74Ser missense variant moderate contig1772 2082447

IGV: Start, Jump

C/G
NGS:
0.136
C90:
0.057
CBDAS c.1420A>C p.Lys474Gln missense variant moderate contig1772 2083646

IGV: Start, Jump

A/C
NGS:
0.132
C90:
0.813

Variants (Select Genes of Interest)

PKSG-4a

UniProt

c.493G>A p.Gly165Ser missense variant moderate contig700 1937904

IGV: Start, Jump

G/A
NGS:
0.103
C90:
0.000
PKSG-4a

UniProt

c.1191_1193delTTA p.Tyr398del disruptive inframe deletion moderate contig700 1938600

IGV: Start, Jump

AATT/A
NGS:
0.167
C90:
0.000
PKSG-2b

UniProt

c.1117A>G p.Ile373Val missense variant moderate contig700 1950521

IGV: Start, Jump

T/C
NGS:
0.807
C90:
0.981
PKSG-4b

UniProt

c.556A>G p.Arg186Gly missense variant & splice region variant moderate contig700 2721117

IGV: Start, Jump

T/C
NGS:
0.022
C90:
0.000
PKSG-4b

UniProt

c.496A>G p.Lys166Glu missense variant moderate contig700 2721177

IGV: Start, Jump

T/C
NGS:
0.651
C90:
0.684
PKSG-4b

UniProt

c.489delT p.Phe163fs frameshift variant high contig700 2721183

IGV: Start, Jump

CA/C
NGS:
0.792
C90:
0.761
PKSG-4b

UniProt

c.485A>G p.Lys162Arg missense variant moderate contig700 2721188

IGV: Start, Jump

T/C
NGS:
0.643
C90:
0.301
PKSG-4b

UniProt

c.352_355delACAG p.Thr118fs frameshift variant high contig700 2721317

IGV: Start, Jump

CCTGT/C
NGS:
0.529
C90:
0.000
PKSG-4b

UniProt

c.324A>C p.Glu108Asp missense variant moderate contig700 2721349

IGV: Start, Jump

T/G
NGS:
0.094
C90:
0.000
PKSG-4b

UniProt

c.323A>G p.Glu108Gly missense variant moderate contig700 2721350

IGV: Start, Jump

T/C
NGS:
0.469
C90:
0.000
FAD2-2

UniProt

c.161T>A p.Leu54His missense variant moderate contig83 1803208

IGV: Start, Jump

A/T
NGS:
0.156
C90:
0.000
FAD2-2

UniProt

c.110C>T p.Ala37Val missense variant moderate contig83 1803259

IGV: Start, Jump

G/A
NGS:
0.013
C90:
0.000
FAD2-2

UniProt

c.47_57delTGAATCATACT p.Leu16fs frameshift variant high contig83 1803311

IGV: Start, Jump

GAGTATGATTCA/G
NGS:
0.018
C90:
0.000
aPT4

UniProt

c.97T>C p.Tyr33His missense variant moderate contig121 2828753

IGV: Start, Jump

T/C
NGS:
0.439
C90:
0.000
aPT4

UniProt

c.153A>C p.Lys51Asn missense variant moderate contig121 2828809

IGV: Start, Jump

A/C
NGS:
0.375
C90:
0.000
aPT4

UniProt

c.235_236delGT p.Val79fs frameshift variant high contig121 2829030

IGV: Start, Jump

ATG/A
NGS:
0.417
C90:
0.000
aPT4

UniProt

c.238delT p.Ser80fs frameshift variant high contig121 2829034

IGV: Start, Jump

AT/A
NGS:
0.421
C90:
0.000
aPT4

UniProt

c.302A>G p.Asn101Ser missense variant moderate contig121 2829099

IGV: Start, Jump

A/G
NGS:
0.349
C90:
0.000
aPT4

UniProt

c.744+1_744+19delGTAATTTATTTTATTATAA splice donor variant & splice region variant & intron variant high contig121 2831022

IGV: Start, Jump

GGTAATTTATTTTATTATAA/G
NGS:
0.096
C90:
0.000

Nearest genetic relatives (All Samples)

0 0.067 0.133 0.200 0.267
clone distance sibling distance more distant
  1. 0.141 Cherry Blossom (RSP11302)
  2. 0.152 Cherry Blossom (RSP11329)
  3. 0.180 Cherry Blossom (RSP11304)
  4. 0.187 Cherry Blossom (RSP11313)
  5. 0.195 Cherry Blossom (RSP11320)
  6. 0.205 Lift (RSP11378)
  7. 0.208 QLF3 (RSP11453)
  8. 0.214 Cherry Blossom (RSP11316)
  9. 0.214 Cherry Blossom (RSP11299)
  10. 0.214 Cherry Blossom (RSP11322)
  11. 0.215 Electra (RSP11366)
  12. 0.215 Cherry Blossom (RSP11321)
  13. 0.219 Cherry Blossom (RSP11317)
  14. 0.220 Cherry Blossom (RSP11315)
  15. 0.221 Queen Dream CBG (RSP11286)
  16. 0.237 Unknown--Cherry Wine---005- (RSP11272)
  17. 0.239 Blueberry Cheesecake (RSP10684)
  18. 0.240 Cherry Blossom (RSP11308)
  19. 0.242 Cherry Blossom (RSP11324)
  20. 0.242 Cherry Blossom (RSP11319)

Nearest genetic relatives (Base Tree)

0 0.100 0.200 0.300 0.400
clone distance sibling distance more distant
  1. 0.263 Blueberry Cheesecake (RSP10684)
  2. 0.304 Cherry (RSP11142)
  3. 0.307 Liberty Haze (RSP11000)
  4. 0.309 Durban Poison (RSP11014)
  5. 0.324 Tygra (RSP10667)
  6. 0.334 Tisza (RSP10659)
  7. 0.336 Gold Cracker (RSP11048)
  8. 0.337 UP Sunrise (RSP10989)
  9. 0.340 Golden Goat 2 (RSP10991)
  10. 0.348 Recon (RSP10755)
  11. 0.353 Cherry (RSP11143)
  12. 0.361 RKM-2018-019 (RSP11111)
  13. 0.365 Blue Dream (RSP11033)
  14. 0.366 RKM-2018-034 (RSP11126)
  15. 0.368 Hermaphrodite ResearchSample2 (RSP11050)
  16. 0.369 RKM-2018-031 (RSP11123)
  17. 0.370 Kimbo Slice (RSP10997)
  18. 0.370 Blueberry Cheesecake (RSP10680)
  19. 0.370 Blueberry Cheesecake (RSP10672)
  20. 0.371 RKM-2018-032 (RSP11124)

Most genetically distant strains (All Samples)

0 0.125 0.250 0.375 0.500
clone distance sibling distance more distant
  1. 0.490 Northern Lights (RSP11501)
  2. 0.470 JL 3rd Gen Mother (RSP11214)
  3. 0.469 Cbot-2019-005 (RSP11133)
  4. 0.468 Chem 91 (RSP11185)
  5. 0.462 JL 3rd Gen Father (RSP11196)
  6. 0.461 JL yellow (RSP11075)
  7. 0.451 Fatso (RSP11741)
  8. 0.451 JL 4th Gen 1 (RSP11193)
  9. 0.448 JL 4th Gen 2 (RSP11194)
  10. 0.445 Big Bud (SRR14708270)
  11. 0.441 Chematonic -Cannatonic x Chemdawg- (RSP11394)
  12. 0.440 JL 4th Gen 3 (RSP11195)
  13. 0.439 AVIDEKEL 2 0 (RSP11174)
  14. 0.439 RKM-2018-002 (RSP11093)
  15. 0.435 BagSeed (RSP12501)
  16. 0.434 Skunk#18 (RSP11038)
  17. 0.433 Juicy Gummy x Royal Kush (RSP12484)
  18. 0.429 Danny Noonan (RSP11070)
  19. 0.429 JL 4th Gen 5 (RSP11199)
  20. 0.428 AVIDEKEL USA (RSP11169)

Most genetically distant strains (Base Tree)

0 0.125 0.250 0.375 0.500
clone distance sibling distance more distant
  1. 0.492 Cbot-2019-005 (RSP11133)
  2. 0.458 JL yellow (RSP11075)
  3. 0.449 Skunk#18 (RSP11038)
  4. 0.443 RKM-2018-002 (RSP11093)
  5. 0.438 RKM-2018-026 (RSP11118)
  6. 0.437 Kush Hemp E1 (RSP11128)
  7. 0.430 RKM-2018-028 (RSP11120)
  8. 0.428 RKM-2018-033 (RSP11125)
  9. 0.419 RKM-2018-004 (RSP11096)
  10. 0.412 Skywalker OG (RSP10837)
  11. 0.411 RKM-2018-023 (RSP11115)
  12. 0.411 RKM-2018-020 (RSP11112)
  13. 0.409 RKM-2018-018 (RSP11110)
  14. 0.407 Cbot-2019-001 (RSP11129)
  15. 0.407 RKM-2018-003 (RSP11094)
  16. 0.405 Cbot-2019-006 (RSP11134)
  17. 0.404 Black Beauty (RSP11035)
  18. 0.402 RKM-2018-022 (RSP11114)
  19. 0.400 RKM-2018-009 (RSP11100)
  20. 0.399 Feral (RSP10890)

Nearest genetic relative in Phylos dataset

Phylos Strain SRR8346727
Overlapping SNPs:
66
Concordance:
36

Nearest genetic relative in Lynch dataset

Lynch Strain SRR3495164
Overlapping SNPs:
3
Concordance:
3

Blockchain Registration Information

Transaction ID
dc0c167a8f4f064ffeef48d368c83ffd58063e4dbe6ec051df6f7a63f343c353
Stamping Certificate
Download PDF (850.7 KB)
SHASUM Hash
fcabcc09325055ce3d2eec80e55419315165a3fe01773deefd540e55ab65f086
QR code for RSP11326

Kannapedia uses cookies

By clicking Allow All, you agree to the storing of cookies on your device to enhance site navigation, analyze site usage, and assist in our marketing efforts.

Customize Settings