Cherry Blossom

RSP 11327

Grower: Yabba Cannaba

General Information

Sample Name
CH3
Accession Date
October 17, 2019
Reported Plant Sex
Female

The strain rarity visualization shows how distant the strain is from the other cultivars in the Kannapedia database. The y-axis represents genetic distance, getting farther as you go up. The width of the visualization at any position along the y-axis shows how many strains there are in the database at that genetic distance. So, a common strain will have a more bottom-heavy shape, while uncommon and rare cultivars will have a visualization that is generally shifted towards the top.

Rarity: Uncommon
Most Distant Most Similar

Chemical Information

Cannabinoid and terpenoid information provided by the grower.

Cannabinoids

No information provided.

Terpenoids

No information provided.

Genetic Information

Plant Type
Type III

The bell curve in the heterozygosity visualization shows the distribution of heterozygosity levels for cannabis cultivars in the Kannapedia database. The green line shows where this particular strain fits within the distribution. Heterozygosity is associated with heterosis (aka hybrid vigor) but also leads to the production of more variable offspring. When plants have two genetically different parents, heterozygosity levels will be higher than if it has been inbred or backcrossed repeatedly.

Heterozygosity: 1.05%
Least Heterozygous Most Heterozygous

The ratio of reads mapped to Y-contigs to reads mapped to the whole Cannabis genome (Y-ratios) has been demonstrated to be strongly correlated with plant sex typing. This plot shows the distribution of Y-ratios for all samples in our database which were sequenced with the same method (panel or WGS) as this sample and where this sample falls in the distribution.

Y-Ratio Distribution: 0.0463
male female RSP11327

This chart represents the Illumina sequence coverage over the Bt/Bd allele. These are the three regions in the cannabis genome that impact THCA, CBDA, CBGA production. Coverage over the Active CBDAS gene is highly correlated with Type II and Type III plants as described by Etienne de Meijer. Coverage over the THCA gene is highly correlated with Type I and Type II plants but is anti-correlated with Type III plants. Type I plants require coverage over the inactive CBDA loci and no coverage over the Active CBDA gene. Lack of coverage over the Active CBDA and Active THCA allele are presumed to be Type IV plants (CBGA dominant). While deletions of entire THCAS and CBDAS genes are the most common Bt:Bd alleles observed, it is possible to have plants with these genes where functional expression of the enzyme is disrupted by deactivating point mutations (Kojoma et al. 2006).

Bt/Bd Allele Coverage

This chart represents the Illumina sequence coverage over the CBCA synthase gene.

CBCAS Coverage

Variants (THCAS, CBDAS, and CBCAS)

CBDAS c.221C>G p.Thr74Ser missense variant moderate contig1772 2082447

IGV: Start, Jump

C/G
NGS:
0.136
C90:
0.057
CBDAS c.1420A>C p.Lys474Gln missense variant moderate contig1772 2083646

IGV: Start, Jump

A/C
NGS:
0.132
C90:
0.813

Variants (Select Genes of Interest)

GPPs1

UniProt

c.845_848delAAAG p.Glu282fs frameshift variant high contig676 169629

IGV: Start, Jump

TGAAA/T
NGS:
0.118
C90:
0.000
PKSG-4a

UniProt

c.493G>A p.Gly165Ser missense variant moderate contig700 1937904

IGV: Start, Jump

G/A
NGS:
0.103
C90:
0.000
PKSG-4a

UniProt

c.1191_1193delTTA p.Tyr398del disruptive inframe deletion moderate contig700 1938600

IGV: Start, Jump

AATT/A
NGS:
0.167
C90:
0.000
PKSG-2a

UniProt

c.67T>A p.Phe23Ile missense variant moderate contig700 1945567

IGV: Start, Jump

A/T
NGS:
0.825
C90:
0.904
PKSG-2a

UniProt

c.31A>T p.Thr11Ser missense variant moderate contig700 1945603

IGV: Start, Jump

T/A
NGS:
0.763
C90:
0.876
PKSG-2b

UniProt

c.1117A>G p.Ile373Val missense variant moderate contig700 1950521

IGV: Start, Jump

T/C
NGS:
0.807
C90:
0.981
PKSG-2b

UniProt

c.774G>A p.Met258Ile missense variant moderate contig700 1950864

IGV: Start, Jump

C/T
NGS:
0.366
C90:
0.947
PKSG-2b

UniProt

c.31A>T p.Thr11Ser missense variant moderate contig700 1951851

IGV: Start, Jump

T/A
NGS:
0.844
C90:
0.880
PKSG-4b

UniProt

c.556A>G p.Arg186Gly missense variant & splice region variant moderate contig700 2721117

IGV: Start, Jump

T/C
NGS:
0.022
C90:
0.000
PKSG-4b

UniProt

c.496A>G p.Lys166Glu missense variant moderate contig700 2721177

IGV: Start, Jump

T/C
NGS:
0.651
C90:
0.684
PKSG-4b

UniProt

c.489delT p.Phe163fs frameshift variant high contig700 2721183

IGV: Start, Jump

CA/C
NGS:
0.792
C90:
0.761
PKSG-4b

UniProt

c.485A>G p.Lys162Arg missense variant moderate contig700 2721188

IGV: Start, Jump

T/C
NGS:
0.643
C90:
0.301
PKSG-4b

UniProt

c.431T>G p.Val144Gly missense variant moderate contig700 2721242

IGV: Start, Jump

A/C
NGS:
0.575
C90:
0.679
PKSG-4b

UniProt

c.419A>G p.Asp140Gly missense variant moderate contig700 2721254

IGV: Start, Jump

T/C
NGS:
0.430
C90:
0.440
PKSG-4b

UniProt

c.352_355delACAG p.Thr118fs frameshift variant high contig700 2721317

IGV: Start, Jump

CCTGT/C
NGS:
0.529
C90:
0.000
PKSG-4b

UniProt

c.324A>C p.Glu108Asp missense variant moderate contig700 2721349

IGV: Start, Jump

T/G
NGS:
0.094
C90:
0.000
PKSG-4b

UniProt

c.323A>G p.Glu108Gly missense variant moderate contig700 2721350

IGV: Start, Jump

T/C
NGS:
0.469
C90:
0.000
aPT4

UniProt

c.97T>C p.Tyr33His missense variant moderate contig121 2828753

IGV: Start, Jump

T/C
NGS:
0.439
C90:
0.000
aPT4

UniProt

c.153A>C p.Lys51Asn missense variant moderate contig121 2828809

IGV: Start, Jump

A/C
NGS:
0.375
C90:
0.000
aPT4

UniProt

c.235_236delGT p.Val79fs frameshift variant high contig121 2829030

IGV: Start, Jump

ATG/A
NGS:
0.417
C90:
0.000
aPT4

UniProt

c.238delT p.Ser80fs frameshift variant high contig121 2829034

IGV: Start, Jump

AT/A
NGS:
0.421
C90:
0.000
aPT4

UniProt

c.302A>G p.Asn101Ser missense variant moderate contig121 2829099

IGV: Start, Jump

A/G
NGS:
0.349
C90:
0.000
aPT4

UniProt

c.744+1_744+19delGTAATTTATTTTATTATAA splice donor variant & splice region variant & intron variant high contig121 2831022

IGV: Start, Jump

GGTAATTTATTTTATTATAA/G
NGS:
0.096
C90:
0.000
HDS-2

UniProt

c.82_93delGTAACCGGAACT p.Val28_Thr31del conservative inframe deletion moderate contig95 1989748

IGV: Start, Jump

CGTAACCGGAACT/C
NGS:
0.805
C90:
0.000
HDS-2

UniProt

c.127T>G p.Ser43Ala missense variant moderate contig95 1989794

IGV: Start, Jump

T/G
NGS:
0.721
C90:
0.000

Nearest genetic relatives (All Samples)

0 0.058 0.117 0.175 0.233
clone distance sibling distance more distant
  1. 0.163 Cherry Blossom (RSP11304)
  2. 0.164 Cherry Blossom (RSP11315)
  3. 0.172 Cherry Blossom (RSP11320)
  4. 0.176 Cherry Blossom (RSP11274)
  5. 0.177 Cherry Blossom (RSP11322)
  6. 0.183 Unknown- Cherry Wine - 005 (RSP11272)
  7. 0.203 Cherry Blossom (RSP11299)
  8. 0.204 Cherry Blossom (RSP11308)
  9. 0.207 Cherry Blossom (RSP11335)
  10. 0.213 Cherry Blossom (RSP11323)
  11. 0.215 Cherry Blossom (RSP11321)
  12. 0.217 Cherry Blossom (RSP11331)
  13. 0.219 Cherry Blossom (RSP11313)
  14. 0.227 Cherry Blossom (RSP11301)
  15. 0.227 Cherry Blossom (RSP11311)
  16. 0.228 Cherry Blossom (RSP11325)
  17. 0.229 Doug s Varin (RSP11243)
  18. 0.230 Cherry Blossom (RSP11319)
  19. 0.231 Cherry Blossom (RSP11332)
  20. 0.231 RINGO S ANGEL (RSP10085)

Nearest genetic relatives (Base Tree)

0 0.100 0.200 0.300 0.400
clone distance sibling distance more distant
  1. 0.280 UP Sunrise (RSP10989)
  2. 0.298 Cbot-2019-001 (RSP11129)
  3. 0.313 Blueberry Cheesecake (RSP10684)
  4. 0.316 QUEEN JESUS (RSP10105)
  5. 0.320 Liberty Haze (RSP11000)
  6. 0.328 Cherry (RSP11143)
  7. 0.349 Kimbo Slice (RSP10997)
  8. 0.351 Durban Poison (RSP11014)
  9. 0.361 Tygra (RSP10667)
  10. 0.367 Cbot-2019-004 (RSP11132)
  11. 0.368 RKM-2018-005 (RSP11096)
  12. 0.375 RKM-2018-028 (RSP11120)
  13. 0.378 Sour Raspberry (RSP10551)
  14. 0.379 RKM-2018-029 (RSP11121)
  15. 0.379 Recon (RSP10755)
  16. 0.380 Ivory (RSP10668)
  17. 0.382 KYRG-11 (RSP11051)
  18. 0.383 Blue Dream (RSP11033)
  19. 0.383 Italian Kiss (RSP11034)
  20. 0.386 Kyrgyz Gold (RSP11054)

Most genetically distant strains (All Samples)

0 0.125 0.250 0.375 0.500
clone distance sibling distance more distant
  1. 0.491 White Label 1 (RSP11336)
  2. 0.481 80E (RSP11211)
  3. 0.479 80E (RSP11213)
  4. 0.463 80E (RSP11212)
  5. 0.462 RKM-2018-026 (RSP11118)
  6. 0.461 Abacus (RSP11266)
  7. 0.456 Star Dawg (RSP11352)
  8. 0.456 RKM-2018-002 (RSP11093)
  9. 0.455 Chem 91 (RSP11185)
  10. 0.455 Kush Hemp E1 (RSP11128)
  11. 0.441 Rugburn OG (RSP11353)
  12. 0.440 RKM-2018-012 (RSP11103)
  13. 0.438 Garlic (RSP11341)
  14. 0.437 RKM-2018-022 (RSP11114)
  15. 0.432 501st OG (RSP11241)
  16. 0.432 JL 4th Gen 6 (RSP11200)
  17. 0.430 USO31 (RSP10233)
  18. 0.430 UP Wendigo (RSP11261)
  19. 0.429 JL yellow (RSP11075)
  20. 0.429 RKM-2018-030 (RSP11122)

Most genetically distant strains (Base Tree)

0 0.125 0.250 0.375 0.500
clone distance sibling distance more distant
  1. 0.476 Kush Hemp E1 (RSP11128)
  2. 0.463 RKM-2018-026 (RSP11118)
  3. 0.457 RKM-2018-002 (RSP11093)
  4. 0.456 RKM-2018-022 (RSP11114)
  5. 0.438 JL yellow (RSP11075)
  6. 0.435 Skywalker OG (RSP10837)
  7. 0.433 RKM-2018-023 (RSP11115)
  8. 0.429 Skunk 18 (RSP11038)
  9. 0.428 RKM-2018-034 (RSP11126)
  10. 0.421 Cbot-2019-005 (RSP11133)
  11. 0.420 Monoica (RSP10241)
  12. 0.419 RKM-2018-027 (RSP11119)
  13. 0.416 RKM-2018-032 (RSP11124)
  14. 0.414 Gold Cracker (RSP11048)
  15. 0.413 Pie Hoe (RSP11073)
  16. 0.411 Santhica27 (RSP11047)
  17. 0.411 Cherry (RSP11142)
  18. 0.410 RKM-2018-033 (RSP11125)
  19. 0.407 Black Beauty (RSP11035)
  20. 0.406 Cbot-2019-006 (RSP11134)

Nearest genetic relative in Phylos dataset

Phylos Strain SRR8347139
Overlapping SNPs:
62
Concordance:
35

Nearest genetic relative in Lynch dataset

Lynch Strain SRR3495307
Overlapping SNPs:
7
Concordance:
7

Blockchain Registration Information

Transaction ID
47cf22410bfe350dcfe9d39ca8f19bc63371c5627b0d81e7bcf1afa830cadee9
Stamping Certificate
Download PDF (850.3 KB)
SHASUM Hash
0c9d3157b2012378c517ff52ff8238d95c8b60db54da38668bd703dcaf2db9be
QR code for RSP11327

Kannapedia uses cookies

By clicking Allow All, you agree to the storing of cookies on your device to enhance site navigation, analyze site usage, and assist in our marketing efforts.

Customize Settings