Cherry Blossom

RSP 11329

Grower: Yabba Cannaba

General Information

Sample Name
CG7
Accession Date
October 17, 2019
Reported Plant Sex
Female

The strain rarity visualization shows how distant the strain is from the other cultivars in the Kannapedia database. The y-axis represents genetic distance, getting farther as you go up. The width of the visualization at any position along the y-axis shows how many strains there are in the database at that genetic distance. So, a common strain will have a more bottom-heavy shape, while uncommon and rare cultivars will have a visualization that is generally shifted towards the top.

Rarity: Rare
Most Distant Most Similar

Chemical Information

Cannabinoid and terpenoid information provided by the grower.

Cannabinoids

No information provided.

Terpenoids

No information provided.

Genetic Information

Plant Type
Type III

The bell curve in the heterozygosity visualization shows the distribution of heterozygosity levels for cannabis cultivars in the Kannapedia database. The green line shows where this particular strain fits within the distribution. Heterozygosity is associated with heterosis (aka hybrid vigor) but also leads to the production of more variable offspring. When plants have two genetically different parents, heterozygosity levels will be higher than if it has been inbred or backcrossed repeatedly.

Heterozygosity: 1.12%
Least Heterozygous Most Heterozygous

The ratio of reads mapped to Y-contigs to reads mapped to the whole Cannabis genome (Y-ratios) has been demonstrated to be strongly correlated with plant sex typing. This plot shows the distribution of Y-ratios for all samples in our database which were sequenced with the same method (panel or WGS) as this sample and where this sample falls in the distribution.

Y-Ratio Distribution: 0.0473
male female RSP11329

This chart represents the Illumina sequence coverage over the Bt/Bd allele. These are the three regions in the cannabis genome that impact THCA, CBDA, CBGA production. Coverage over the Active CBDAS gene is highly correlated with Type II and Type III plants as described by Etienne de Meijer. Coverage over the THCA gene is highly correlated with Type I and Type II plants but is anti-correlated with Type III plants. Type I plants require coverage over the inactive CBDA loci and no coverage over the Active CBDA gene. Lack of coverage over the Active CBDA and Active THCA allele are presumed to be Type IV plants (CBGA dominant). While deletions of entire THCAS and CBDAS genes are the most common Bt:Bd alleles observed, it is possible to have plants with these genes where functional expression of the enzyme is disrupted by deactivating point mutations (Kojoma et al. 2006).

Bt/Bd Allele Coverage

This chart represents the Illumina sequence coverage over the CBCA synthase gene.

CBCAS Coverage

Variants (THCAS, CBDAS, and CBCAS)

No variants to report

Variants (Select Genes of Interest)

GPPs1

UniProt

c.845_848delAAAG p.Glu282fs frameshift variant high contig676 169629

IGV: Start, Jump

TGAAA/T
NGS:
0.118
C90:
0.000
PKSG-4a

UniProt

c.493G>A p.Gly165Ser missense variant moderate contig700 1937904

IGV: Start, Jump

G/A
NGS:
0.103
C90:
0.000
PKSG-4a

UniProt

c.1191_1193delTTA p.Tyr398del disruptive inframe deletion moderate contig700 1938600

IGV: Start, Jump

AATT/A
NGS:
0.167
C90:
0.000
PKSG-2a

UniProt

c.1117A>G p.Ile373Val missense variant moderate contig700 1944273

IGV: Start, Jump

T/C
NGS:
0.101
C90:
0.967
PKSG-2b

UniProt

c.1117A>G p.Ile373Val missense variant moderate contig700 1950521

IGV: Start, Jump

T/C
NGS:
0.807
C90:
0.981
PKSG-4b

UniProt

c.496A>G p.Lys166Glu missense variant moderate contig700 2721177

IGV: Start, Jump

T/C
NGS:
0.651
C90:
0.684
PKSG-4b

UniProt

c.489delT p.Phe163fs frameshift variant high contig700 2721183

IGV: Start, Jump

CA/C
NGS:
0.792
C90:
0.761
PKSG-4b

UniProt

c.485A>G p.Lys162Arg missense variant moderate contig700 2721188

IGV: Start, Jump

T/C
NGS:
0.643
C90:
0.301
PKSG-4b

UniProt

c.352_355delACAG p.Thr118fs frameshift variant high contig700 2721317

IGV: Start, Jump

CCTGT/C
NGS:
0.529
C90:
0.000
PKSG-4b

UniProt

c.324A>C p.Glu108Asp missense variant moderate contig700 2721349

IGV: Start, Jump

T/G
NGS:
0.094
C90:
0.000
PKSG-4b

UniProt

c.323A>G p.Glu108Gly missense variant moderate contig700 2721350

IGV: Start, Jump

T/C
NGS:
0.469
C90:
0.000
DXR-2

UniProt

c.1319T>C p.Ile440Thr missense variant moderate contig380 285250

IGV: Start, Jump

A/G
NGS:
0.480
C90:
0.000
aPT4

UniProt

c.97T>C p.Tyr33His missense variant moderate contig121 2828753

IGV: Start, Jump

T/C
NGS:
0.439
C90:
0.000
aPT4

UniProt

c.153A>C p.Lys51Asn missense variant moderate contig121 2828809

IGV: Start, Jump

A/C
NGS:
0.375
C90:
0.000
aPT4

UniProt

c.235_236delGT p.Val79fs frameshift variant high contig121 2829030

IGV: Start, Jump

ATG/A
NGS:
0.417
C90:
0.000
aPT4

UniProt

c.238delT p.Ser80fs frameshift variant high contig121 2829034

IGV: Start, Jump

AT/A
NGS:
0.421
C90:
0.000
aPT4

UniProt

c.302A>G p.Asn101Ser missense variant moderate contig121 2829099

IGV: Start, Jump

A/G
NGS:
0.349
C90:
0.000
aPT4

UniProt

c.744+1_744+19delGTAATTTATTTTATTATAA splice donor variant & splice region variant & intron variant high contig121 2831022

IGV: Start, Jump

GGTAATTTATTTTATTATAA/G
NGS:
0.096
C90:
0.000

Nearest genetic relatives (All Samples)

0 0.067 0.133 0.200 0.267
clone distance sibling distance more distant
  1. 0.151 Cherry Blossom (RSP11306)
  2. 0.152 Cherry Blossom (RSP11326)
  3. 0.166 Cherry Blossom (RSP11304)
  4. 0.166 Cherry Blossom (RSP11315)
  5. 0.179 Cherry Blossom (RSP11313)
  6. 0.181 Cherry Blossom (RSP11322)
  7. 0.202 Cherry Blossom (RSP11299)
  8. 0.206 Cherry Blossom (RSP11331)
  9. 0.215 Cherry Blossom CBG (RSP11303)
  10. 0.217 Lift (RSP11378)
  11. 0.220 Cherry Blossom (RSP11325)
  12. 0.221 Cherry Blossom (RSP11320)
  13. 0.222 Cherry Blossom (RSP11324)
  14. 0.229 Cherry Wine (RSP11307)
  15. 0.230 Cherry Wine (RSP11305)
  16. 0.231 Cherry Blossom (RSP11316)
  17. 0.234 Electra (RSP11366)
  18. 0.239 Domnesia (RSP11184)
  19. 0.241 Cherry Blossom (RSP11302)
  20. 0.241 Lifter (RSP11365)

Nearest genetic relatives (Base Tree)

0 0.100 0.200 0.300 0.400
clone distance sibling distance more distant
  1. 0.275 Blueberry Cheesecake (RSP10684)
  2. 0.315 Cbot-2019-004 (RSP11132)
  3. 0.326 Durban Poison (RSP11014)
  4. 0.327 Gold Cracker (RSP11048)
  5. 0.329 Liberty Haze (RSP11000)
  6. 0.339 Golden Goat 2 (RSP10991)
  7. 0.339 Cherry (RSP11142)
  8. 0.343 Kimbo Slice (RSP10997)
  9. 0.347 CST (RSP11002)
  10. 0.349 UP Sunrise (RSP10989)
  11. 0.354 Cherry (RSP11143)
  12. 0.363 Recon (RSP10755)
  13. 0.363 Queen Jesus (RSP10105)
  14. 0.366 Hermaphrodite ResearchSample2 (RSP11050)
  15. 0.366 Tygra (RSP10667)
  16. 0.370 Tisza (RSP10659)
  17. 0.373 Kush Hemp E1 (RSP11128)
  18. 0.375 RKM-2018-031 (RSP11123)
  19. 0.376 RKM-2018-032 (RSP11124)
  20. 0.376 Blue Dream (RSP11033)

Most genetically distant strains (All Samples)

0 0.125 0.250 0.375 0.500
clone distance sibling distance more distant
  1. 0.484 Northern Lights (RSP11501)
  2. 0.474 Fatso (RSP11741)
  3. 0.474 Chem 91 (RSP11185)
  4. 0.462 JL 3rd Gen Mother (RSP11214)
  5. 0.459 JL yellow (RSP11075)
  6. 0.455 BagSeed (RSP12501)
  7. 0.450 Big Bud (SRR14708270)
  8. 0.450 Cherry Blossom (RSP11328)
  9. 0.448 JL 4th Gen 1 (RSP11193)
  10. 0.447 Right Mark (RSP11628)
  11. 0.446 UP The Straits (RSP11260)
  12. 0.442 JL 3rd Gen Father (RSP11196)
  13. 0.441 RKM-2018-012 (RSP11103)
  14. 0.439 Cherry Blossom (RSP11318)
  15. 0.438 Star Dawg (RSP11352)
  16. 0.437 White Label 1 (RSP11336)
  17. 0.437 Cherry Lime Runtz (RSP12486)
  18. 0.437 Delta-llosa (SRR14708272)
  19. 0.436 Ruderalis Indica (SRR14708267)
  20. 0.434 Juicy Gummy x Royal Kush (RSP12484)

Most genetically distant strains (Base Tree)

0 0.117 0.233 0.350 0.467
clone distance sibling distance more distant
  1. 0.445 JL yellow (RSP11075)
  2. 0.437 RKM-2018-002 (RSP11093)
  3. 0.435 RKM-2018-026 (RSP11118)
  4. 0.433 Skywalker OG (RSP10837)
  5. 0.429 Skunk#18 (RSP11038)
  6. 0.421 RKM-2018-023 (RSP11115)
  7. 0.421 RKM-2018-028 (RSP11120)
  8. 0.420 USO 31 (RSP10981)
  9. 0.419 RKM-2018-033 (RSP11125)
  10. 0.417 RKM-2018-004 (RSP11096)
  11. 0.413 Blueberry Cheesecake (RSP10672)
  12. 0.413 Santhica27 (RSP11047)
  13. 0.410 RKM-2018-018 (RSP11110)
  14. 0.408 Lovrin (RSP10658)
  15. 0.406 Monoica (RSP10241)
  16. 0.404 Sour Raspberry (RSP10551)
  17. 0.402 Feral (RSP10890)
  18. 0.401 Jiangji (RSP10653)
  19. 0.400 RKM-2018-034 (RSP11126)
  20. 0.399 RKM-2018-003 (RSP11094)

Nearest genetic relative in Phylos dataset

Phylos Strain SRR8349191
Overlapping SNPs:
63
Concordance:
38

Nearest genetic relative in Lynch dataset

Lynch Strain SRR3495165
Overlapping SNPs:
4
Concordance:
4

Blockchain Registration Information

Transaction ID
eca972e82e35e99b310333a38df27053ecbf99a92af84d022ab2271e9780cc63
Stamping Certificate
Download PDF (870.0 KB)
SHASUM Hash
a14c16f0eb39923833a6b2b4bfa75ac4d30de367ca959bdf8a26c233f96fdf75
QR code for RSP11329

Kannapedia uses cookies

By clicking Allow All, you agree to the storing of cookies on your device to enhance site navigation, analyze site usage, and assist in our marketing efforts.

Customize Settings