Cherry Blossom

RSP 11331

Grower: Yabba Cannaba

General Information

Sample Name
CJ6
Accession Date
October 17, 2019
Reported Plant Sex
Female

The strain rarity visualization shows how distant the strain is from the other cultivars in the Kannapedia database. The y-axis represents genetic distance, getting farther as you go up. The width of the visualization at any position along the y-axis shows how many strains there are in the database at that genetic distance. So, a common strain will have a more bottom-heavy shape, while uncommon and rare cultivars will have a visualization that is generally shifted towards the top.

Rarity: Uncommon
Most Distant Most Similar

Chemical Information

Cannabinoid and terpenoid information provided by the grower.

Cannabinoids

No information provided.

Terpenoids

No information provided.

Genetic Information

Plant Type
Type III

The bell curve in the heterozygosity visualization shows the distribution of heterozygosity levels for cannabis cultivars in the Kannapedia database. The green line shows where this particular strain fits within the distribution. Heterozygosity is associated with heterosis (aka hybrid vigor) but also leads to the production of more variable offspring. When plants have two genetically different parents, heterozygosity levels will be higher than if it has been inbred or backcrossed repeatedly.

Heterozygosity: 1.09%
Least Heterozygous Most Heterozygous

The ratio of reads mapped to Y-contigs to reads mapped to the whole Cannabis genome (Y-ratios) has been demonstrated to be strongly correlated with plant sex typing. This plot shows the distribution of Y-ratios for all samples in our database which were sequenced with the same method (panel or WGS) as this sample and where this sample falls in the distribution.

Y-Ratio Distribution: 0.0559
male female RSP11331

This chart represents the Illumina sequence coverage over the Bt/Bd allele. These are the three regions in the cannabis genome that impact THCA, CBDA, CBGA production. Coverage over the Active CBDAS gene is highly correlated with Type II and Type III plants as described by Etienne de Meijer. Coverage over the THCA gene is highly correlated with Type I and Type II plants but is anti-correlated with Type III plants. Type I plants require coverage over the inactive CBDA loci and no coverage over the Active CBDA gene. Lack of coverage over the Active CBDA and Active THCA allele are presumed to be Type IV plants (CBGA dominant). While deletions of entire THCAS and CBDAS genes are the most common Bt:Bd alleles observed, it is possible to have plants with these genes where functional expression of the enzyme is disrupted by deactivating point mutations (Kojoma et al. 2006).

Bt/Bd Allele Coverage

This chart represents the Illumina sequence coverage over the CBCA synthase gene.

CBCAS Coverage

Variants (THCAS, CBDAS, and CBCAS)

No variants to report

Variants (Select Genes of Interest)

PKSG-4a

UniProt

c.493G>A p.Gly165Ser missense variant moderate contig700 1937904

IGV: Start, Jump

G/A
NGS:
0.103
C90:
0.000
PKSG-4a

UniProt

c.1191_1193delTTA p.Tyr398del disruptive inframe deletion moderate contig700 1938600

IGV: Start, Jump

AATT/A
NGS:
0.167
C90:
0.000
PKSG-2b

UniProt

c.1117A>G p.Ile373Val missense variant moderate contig700 1950521

IGV: Start, Jump

T/C
NGS:
0.807
C90:
0.981
PKSG-4b

UniProt

c.496A>G p.Lys166Glu missense variant moderate contig700 2721177

IGV: Start, Jump

T/C
NGS:
0.651
C90:
0.684
PKSG-4b

UniProt

c.489delT p.Phe163fs frameshift variant high contig700 2721183

IGV: Start, Jump

CA/C
NGS:
0.792
C90:
0.761
PKSG-4b

UniProt

c.485A>G p.Lys162Arg missense variant moderate contig700 2721188

IGV: Start, Jump

T/C
NGS:
0.643
C90:
0.301
PKSG-4b

UniProt

c.352_355delACAG p.Thr118fs frameshift variant high contig700 2721317

IGV: Start, Jump

CCTGT/C
NGS:
0.529
C90:
0.000
PKSG-4b

UniProt

c.324A>C p.Glu108Asp missense variant moderate contig700 2721349

IGV: Start, Jump

T/G
NGS:
0.094
C90:
0.000
PKSG-4b

UniProt

c.323A>G p.Glu108Gly missense variant moderate contig700 2721350

IGV: Start, Jump

T/C
NGS:
0.469
C90:
0.000
DXR-2

UniProt

c.1319T>C p.Ile440Thr missense variant moderate contig380 285250

IGV: Start, Jump

A/G
NGS:
0.480
C90:
0.000
aPT4

UniProt

c.97T>C p.Tyr33His missense variant moderate contig121 2828753

IGV: Start, Jump

T/C
NGS:
0.439
C90:
0.000
aPT4

UniProt

c.153A>C p.Lys51Asn missense variant moderate contig121 2828809

IGV: Start, Jump

A/C
NGS:
0.375
C90:
0.000
aPT4

UniProt

c.235_236delGT p.Val79fs frameshift variant high contig121 2829030

IGV: Start, Jump

ATG/A
NGS:
0.417
C90:
0.000
aPT4

UniProt

c.238delT p.Ser80fs frameshift variant high contig121 2829034

IGV: Start, Jump

AT/A
NGS:
0.421
C90:
0.000
aPT4

UniProt

c.302A>G p.Asn101Ser missense variant moderate contig121 2829099

IGV: Start, Jump

A/G
NGS:
0.349
C90:
0.000
aPT4

UniProt

c.744+1_744+19delGTAATTTATTTTATTATAA splice donor variant & splice region variant & intron variant high contig121 2831022

IGV: Start, Jump

GGTAATTTATTTTATTATAA/G
NGS:
0.096
C90:
0.000
HDS-2

UniProt

c.82_93delGTAACCGGAACT p.Val28_Thr31del conservative inframe deletion moderate contig95 1989748

IGV: Start, Jump

CGTAACCGGAACT/C
NGS:
0.805
C90:
0.000
HDS-2

UniProt

c.127T>G p.Ser43Ala missense variant moderate contig95 1989794

IGV: Start, Jump

T/G
NGS:
0.721
C90:
0.000

Nearest genetic relatives (All Samples)

0 0.058 0.117 0.175 0.233
clone distance sibling distance more distant
  1. 0.087 Cherry Blossom (RSP11299)
  2. 0.161 Cherry Blossom (RSP11302)
  3. 0.175 Cherry Wine (RSP11305)
  4. 0.176 Cherry Wine (RSP11307)
  5. 0.194 Cherry Blossom (RSP11324)
  6. 0.201 Cherry Blossom (RSP11321)
  7. 0.201 Unknown- Cherry Wine - 005 (RSP11272)
  8. 0.207 Cherry Blossom (RSP11310)
  9. 0.210 RINGO S ANGEL (RSP10085)
  10. 0.211 Cherry Blossom (RSP11334)
  11. 0.212 Cherry Blossom (RSP11329)
  12. 0.213 Cherry Blossom (RSP11333)
  13. 0.214 FL30 (RSP11361)
  14. 0.215 Cherry Blossom (RSP11320)
  15. 0.217 Cherry Blossom (RSP11327)
  16. 0.225 Cherry Blossom (RSP11315)
  17. 0.226 Cherry Blossom (RSP11330)
  18. 0.227 Midnight (RSP10941)
  19. 0.227 Domnesia (RSP11184)
  20. 0.231 Cherry Blossom (RSP11313)

Nearest genetic relatives (Base Tree)

0 0.100 0.200 0.300 0.400
clone distance sibling distance more distant
  1. 0.251 Blueberry Cheesecake (RSP10684)
  2. 0.302 Durban Poison (RSP11014)
  3. 0.314 Cherry (RSP11143)
  4. 0.320 Cbot-2019-005 (RSP11133)
  5. 0.323 Liberty Haze (RSP11000)
  6. 0.329 QUEEN JESUS (RSP10105)
  7. 0.331 Cbot-2019-001 (RSP11129)
  8. 0.336 Gold Cracker (RSP11048)
  9. 0.338 Cbot-2019-004 (RSP11132)
  10. 0.339 Golden Goat 2 (RSP10991)
  11. 0.342 UP Sunrise (RSP10989)
  12. 0.348 Recon (RSP10755)
  13. 0.362 Cherry (RSP11142)
  14. 0.364 RKM-2018-027 (RSP11119)
  15. 0.367 RKM-2018-006 (RSP11097)
  16. 0.368 RKM-2018-031 (RSP11123)
  17. 0.372 Kimbo Slice (RSP10997)
  18. 0.378 RKM-2018-019 (RSP11111)
  19. 0.378 RKM-2018-003 (RSP11094)
  20. 0.379 Blueberry Cheesecake (RSP10672)

Most genetically distant strains (All Samples)

0 0.125 0.250 0.375 0.500
clone distance sibling distance more distant
  1. 0.484 Chem 91 (RSP11185)
  2. 0.476 80E (RSP11213)
  3. 0.471 JL yellow (RSP11075)
  4. 0.466 80E (RSP11211)
  5. 0.463 RKM-2018-026 (RSP11118)
  6. 0.462 White Label 1 (RSP11336)
  7. 0.462 JL 3rd Gen Mother (RSP11214)
  8. 0.459 RKM-2018-024 (RSP11116)
  9. 0.459 Garlic (RSP11341)
  10. 0.454 Feral (RSP11205)
  11. 0.451 USO31 (RSP10233)
  12. 0.450 Red Eye OG (RSP11190)
  13. 0.447 Skywalker OG (RSP10837)
  14. 0.445 USO 31 (RSP10983)
  15. 0.445 Feral (RSP10890)
  16. 0.444 Rugburn OG (RSP11353)
  17. 0.442 80E (RSP11212)
  18. 0.441 JL 3rd Gen Mother (RSP11197)
  19. 0.441 501st OG (RSP11241)
  20. 0.440 Star Dawg (RSP11352)

Most genetically distant strains (Base Tree)

0 0.125 0.250 0.375 0.500
clone distance sibling distance more distant
  1. 0.472 JL yellow (RSP11075)
  2. 0.470 RKM-2018-026 (RSP11118)
  3. 0.457 Skywalker OG (RSP10837)
  4. 0.455 Feral (RSP10890)
  5. 0.450 USO 31 (RSP10981)
  6. 0.448 Monoica (RSP10241)
  7. 0.446 Carmagnola (RSP11037)
  8. 0.443 RKM-2018-002 (RSP11093)
  9. 0.438 Santhica27 (RSP11047)
  10. 0.435 Tisza (RSP11044)
  11. 0.434 Sour Raspberry (RSP10551)
  12. 0.434 Ivory (RSP10668)
  13. 0.433 RKM-2018-018 (RSP11110)
  14. 0.433 KYRG-11 (RSP11051)
  15. 0.432 Italian Kiss (RSP11034)
  16. 0.431 Lovrin (RSP10658)
  17. 0.428 Fedora 17 (RSP10661)
  18. 0.425 RKM-2018-034 (RSP11126)
  19. 0.423 Kyrgyz Gold (RSP11054)
  20. 0.423 RKM-2018-022 (RSP11114)

Nearest genetic relative in Phylos dataset

Phylos Strain SRR8346935
Overlapping SNPs:
65
Concordance:
43

Nearest genetic relative in Lynch dataset

Lynch Strain SRR3495216
Overlapping SNPs:
4
Concordance:
4

Blockchain Registration Information

Transaction ID
e6bc8a256839da5e462d59ca4474d328065da84cd822dcd6282fba0a812f9e42
Stamping Certificate
Download PDF (868.3 KB)
SHASUM Hash
185ced7cb45b73892b199fe20f35ebbecba9807e304319833cfa679ce56dbb0e
QR code for RSP11331

Kannapedia uses cookies

By clicking Allow All, you agree to the storing of cookies on your device to enhance site navigation, analyze site usage, and assist in our marketing efforts.

Customize Settings