Cherry Blossom

RSP 11333

Grower: Yabba Cannaba

General Information

Sample Name
CG2
Accession Date
October 17, 2019
Reported Plant Sex
Female

The strain rarity visualization shows how distant the strain is from the other cultivars in the Kannapedia database. The y-axis represents genetic distance, getting farther as you go up. The width of the visualization at any position along the y-axis shows how many strains there are in the database at that genetic distance. So, a common strain will have a more bottom-heavy shape, while uncommon and rare cultivars will have a visualization that is generally shifted towards the top.

Rarity: Rare
Most Distant Most Similar

Chemical Information

Cannabinoid and terpenoid information provided by the grower.

Cannabinoids

No information provided.

Terpenoids

No information provided.

Genetic Information

Plant Type
Type III

The bell curve in the heterozygosity visualization shows the distribution of heterozygosity levels for cannabis cultivars in the Kannapedia database. The green line shows where this particular strain fits within the distribution. Heterozygosity is associated with heterosis (aka hybrid vigor) but also leads to the production of more variable offspring. When plants have two genetically different parents, heterozygosity levels will be higher than if it has been inbred or backcrossed repeatedly.

Heterozygosity: 1.05%
Least Heterozygous Most Heterozygous

The ratio of reads mapped to Y-contigs to reads mapped to the whole Cannabis genome (Y-ratios) has been demonstrated to be strongly correlated with plant sex typing. This plot shows the distribution of Y-ratios for all samples in our database which were sequenced with the same method (panel or WGS) as this sample and where this sample falls in the distribution.

Y-Ratio Distribution: 0.0441
male female RSP11333

This chart represents the Illumina sequence coverage over the Bt/Bd allele. These are the three regions in the cannabis genome that impact THCA, CBDA, CBGA production. Coverage over the Active CBDAS gene is highly correlated with Type II and Type III plants as described by Etienne de Meijer. Coverage over the THCA gene is highly correlated with Type I and Type II plants but is anti-correlated with Type III plants. Type I plants require coverage over the inactive CBDA loci and no coverage over the Active CBDA gene. Lack of coverage over the Active CBDA and Active THCA allele are presumed to be Type IV plants (CBGA dominant). While deletions of entire THCAS and CBDAS genes are the most common Bt:Bd alleles observed, it is possible to have plants with these genes where functional expression of the enzyme is disrupted by deactivating point mutations (Kojoma et al. 2006).

Bt/Bd Allele Coverage

This chart represents the Illumina sequence coverage over the CBCA synthase gene.

CBCAS Coverage

Variants (THCAS, CBDAS, and CBCAS)

CBDAS c.8G>A p.Cys3Tyr missense variant moderate contig1772 2082234

IGV: Start, Jump

G/A
NGS:
0.057
C90:
0.000
CBDAS c.221C>G p.Thr74Ser missense variant moderate contig1772 2082447

IGV: Start, Jump

C/G
NGS:
0.136
C90:
0.057
CBDAS c.503A>G p.Asn168Ser missense variant moderate contig1772 2082729

IGV: Start, Jump

A/G
NGS:
0.024
C90:
0.062
CBDAS c.1420A>C p.Lys474Gln missense variant moderate contig1772 2083646

IGV: Start, Jump

A/C
NGS:
0.132
C90:
0.813

Variants (Select Genes of Interest)

GPPs1

UniProt

c.845_848delAAAG p.Glu282fs frameshift variant high contig676 169629

IGV: Start, Jump

TGAAA/T
NGS:
0.118
C90:
0.000
PKSG-4a

UniProt

c.493G>A p.Gly165Ser missense variant moderate contig700 1937904

IGV: Start, Jump

G/A
NGS:
0.103
C90:
0.000
PKSG-4a

UniProt

c.1191_1193delTTA p.Tyr398del disruptive inframe deletion moderate contig700 1938600

IGV: Start, Jump

AATT/A
NGS:
0.167
C90:
0.000
PKSG-2b

UniProt

c.1117A>G p.Ile373Val missense variant moderate contig700 1950521

IGV: Start, Jump

T/C
NGS:
0.807
C90:
0.981
PKSG-4b

UniProt

c.496A>G p.Lys166Glu missense variant moderate contig700 2721177

IGV: Start, Jump

T/C
NGS:
0.651
C90:
0.684
PKSG-4b

UniProt

c.489delT p.Phe163fs frameshift variant high contig700 2721183

IGV: Start, Jump

CA/C
NGS:
0.792
C90:
0.761
PKSG-4b

UniProt

c.485A>G p.Lys162Arg missense variant moderate contig700 2721188

IGV: Start, Jump

T/C
NGS:
0.643
C90:
0.301
PKSG-4b

UniProt

c.352_355delACAG p.Thr118fs frameshift variant high contig700 2721317

IGV: Start, Jump

CCTGT/C
NGS:
0.529
C90:
0.000
PKSG-4b

UniProt

c.324A>C p.Glu108Asp missense variant moderate contig700 2721349

IGV: Start, Jump

T/G
NGS:
0.094
C90:
0.000
PKSG-4b

UniProt

c.323A>G p.Glu108Gly missense variant moderate contig700 2721350

IGV: Start, Jump

T/C
NGS:
0.469
C90:
0.000
DXR-2

UniProt

c.1319T>C p.Ile440Thr missense variant moderate contig380 285250

IGV: Start, Jump

A/G
NGS:
0.480
C90:
0.000
FAD2-2

UniProt

c.172G>T p.Asp58Tyr missense variant moderate contig83 1803197

IGV: Start, Jump

C/A
NGS:
0.070
C90:
0.000
FAD2-2

UniProt

c.161T>A p.Leu54His missense variant moderate contig83 1803208

IGV: Start, Jump

A/T
NGS:
0.156
C90:
0.000
aPT4

UniProt

c.97T>C p.Tyr33His missense variant moderate contig121 2828753

IGV: Start, Jump

T/C
NGS:
0.439
C90:
0.000
aPT4

UniProt

c.153A>C p.Lys51Asn missense variant moderate contig121 2828809

IGV: Start, Jump

A/C
NGS:
0.375
C90:
0.000
aPT4

UniProt

c.235_236delGT p.Val79fs frameshift variant high contig121 2829030

IGV: Start, Jump

ATG/A
NGS:
0.417
C90:
0.000
aPT4

UniProt

c.238delT p.Ser80fs frameshift variant high contig121 2829034

IGV: Start, Jump

AT/A
NGS:
0.421
C90:
0.000
aPT4

UniProt

c.302A>G p.Asn101Ser missense variant moderate contig121 2829099

IGV: Start, Jump

A/G
NGS:
0.349
C90:
0.000
aPT4

UniProt

c.744+1_744+19delGTAATTTATTTTATTATAA splice donor variant & splice region variant & intron variant high contig121 2831022

IGV: Start, Jump

GGTAATTTATTTTATTATAA/G
NGS:
0.096
C90:
0.000
HDS-2

UniProt

c.82_93delGTAACCGGAACT p.Val28_Thr31del conservative inframe deletion moderate contig95 1989748

IGV: Start, Jump

CGTAACCGGAACT/C
NGS:
0.805
C90:
0.000
HDS-2

UniProt

c.127T>G p.Ser43Ala missense variant moderate contig95 1989794

IGV: Start, Jump

T/G
NGS:
0.721
C90:
0.000

Nearest genetic relatives (All Samples)

0 0.075 0.150 0.225 0.300
clone distance sibling distance more distant
  1. 0.102 Cherry Blossom (RSP11324)
  2. 0.116 Cherry Blossom (RSP11313)
  3. 0.178 Cherry Blossom (RSP11314)
  4. 0.182 Cherry Blossom (RSP11302)
  5. 0.190 Unknown- Cherry Wine - 005 (RSP11272)
  6. 0.204 Cherry Blossom (RSP11317)
  7. 0.213 Cherry Blossom (RSP11331)
  8. 0.218 Cherry Blossom (RSP11330)
  9. 0.220 Cherry Blossom (RSP11322)
  10. 0.226 Cherry Blossom (RSP11299)
  11. 0.233 Cherry Blossom (RSP11310)
  12. 0.252 Cherry Blossom (RSP11332)
  13. 0.253 Cherry Blossom (RSP11334)
  14. 0.257 Cherry Wine (RSP11267)
  15. 0.265 Cherry Blossom (RSP11304)
  16. 0.265 Cherry Blossom (RSP11320)
  17. 0.265 Cherry Blossom (RSP11335)
  18. 0.268 Cherry Blossom (RSP11308)
  19. 0.275 Cherry (RSP11142)
  20. 0.278 Cherry Blossom (RSP11328)

Nearest genetic relatives (Base Tree)

0 0.108 0.217 0.325 0.433
clone distance sibling distance more distant
  1. 0.284 Cherry (RSP11142)
  2. 0.335 Recon (RSP10755)
  3. 0.336 Blueberry Cheesecake (RSP10684)
  4. 0.350 Liberty Haze (RSP11000)
  5. 0.365 Cbot-2019-005 (RSP11133)
  6. 0.366 UP Sunrise (RSP10989)
  7. 0.378 Tygra (RSP10667)
  8. 0.381 RKM-2018-019 (RSP11111)
  9. 0.383 RKM-2018-031 (RSP11123)
  10. 0.387 Hermaphrodite ResearchSample2 (RSP11050)
  11. 0.388 Kimbo Slice (RSP10997)
  12. 0.388 Gold Cracker (RSP11048)
  13. 0.391 Kyrgyz Gold (RSP11054)
  14. 0.392 Durban Poison (RSP11014)
  15. 0.393 RKM-2018-006 (RSP11097)
  16. 0.394 KYRG-11 (RSP11051)
  17. 0.396 Tisza (RSP10659)
  18. 0.400 Carmagnola (RSP10979)
  19. 0.403 QUEEN JESUS (RSP10105)
  20. 0.403 The Gift (RSP10988)

Most genetically distant strains (All Samples)

0 0.133 0.267 0.400 0.533
clone distance sibling distance more distant
  1. 0.502 JL yellow (RSP11075)
  2. 0.501 JL 3rd Gen Mother (RSP11214)
  3. 0.499 RKM-2018-002 (RSP11093)
  4. 0.491 JL 3rd Gen Mother (RSP11197)
  5. 0.485 Chem 91 (RSP11185)
  6. 0.480 RKM-2018-018 (RSP11110)
  7. 0.479 Sour Raspberry (RSP10551)
  8. 0.473 JL 4th Gen 5 (RSP11199)
  9. 0.472 RKM-2018-024 (RSP11116)
  10. 0.470 Skunk 18 (RSP11030)
  11. 0.467 Danny Noonan (RSP11070)
  12. 0.466 Skunk 18 (RSP11038)
  13. 0.459 JL 4th Gen 2 (RSP11194)
  14. 0.458 Sour D (RSP11343)
  15. 0.458 RKM-2018-023 (RSP11115)
  16. 0.456 JL 4th Gen 6 (RSP11200)
  17. 0.455 Cbot-2019-004 (RSP11132)
  18. 0.454 501st OG (RSP11241)
  19. 0.454 Blueberry Cheesecake (RSP10680)
  20. 0.454 JL 4th Gen 1 (RSP11193)

Most genetically distant strains (Base Tree)

0 0.133 0.267 0.400 0.533
clone distance sibling distance more distant
  1. 0.503 RKM-2018-002 (RSP11093)
  2. 0.499 JL yellow (RSP11075)
  3. 0.489 RKM-2018-018 (RSP11110)
  4. 0.478 Sour Raspberry (RSP10551)
  5. 0.468 Skunk 18 (RSP11038)
  6. 0.464 Blueberry Cheesecake (RSP10680)
  7. 0.461 Italian Kiss (RSP11034)
  8. 0.461 Hermaphrodite Research Sample1 (RSP11049)
  9. 0.458 RKM-2018-023 (RSP11115)
  10. 0.452 Cbot-2019-004 (RSP11132)
  11. 0.451 RKM-2018-033 (RSP11125)
  12. 0.449 Blueberry Cheesecake (RSP10672)
  13. 0.447 Black Beauty (RSP11035)
  14. 0.446 RKM-2018-005 (RSP11096)
  15. 0.445 RKM-2018-003 (RSP11094)
  16. 0.444 CST (RSP11002)
  17. 0.440 RKM-2018-028 (RSP11120)
  18. 0.438 Feral (RSP10890)
  19. 0.435 RKM-2018-009 (RSP11100)
  20. 0.434 RKM-2018-026 (RSP11118)

Nearest genetic relative in Phylos dataset

Phylos Strain SRR8346786
Overlapping SNPs:
66
Concordance:
42

Nearest genetic relative in Lynch dataset

Lynch Strain SRR3495216
Overlapping SNPs:
4
Concordance:
4

Blockchain Registration Information

Transaction ID
0cbb19383d330fe074847c96b4baf29fa99e26b29c1fc859d36657596f37c882
Stamping Certificate
Download PDF (863.0 KB)
SHASUM Hash
02259df9b6c3f62ebfbd2c2e5ab6388fd6d5565a4d94228c13b446fb63d7fea4
QR code for RSP11333

Kannapedia uses cookies

By clicking Allow All, you agree to the storing of cookies on your device to enhance site navigation, analyze site usage, and assist in our marketing efforts.

Customize Settings