Cherry Blossom

RSP 11334

Grower: Yabba Cannaba

General Information

Sample Name
CI8
Accession Date
October 17, 2019
Reported Plant Sex
Female

The strain rarity visualization shows how distant the strain is from the other cultivars in the Kannapedia database. The y-axis represents genetic distance, getting farther as you go up. The width of the visualization at any position along the y-axis shows how many strains there are in the database at that genetic distance. So, a common strain will have a more bottom-heavy shape, while uncommon and rare cultivars will have a visualization that is generally shifted towards the top.

Rarity: Rare
Most Distant Most Similar

Chemical Information

Cannabinoid and terpenoid information provided by the grower.

Cannabinoids

No information provided.

Terpenoids

No information provided.

Genetic Information

Plant Type
Type III

The bell curve in the heterozygosity visualization shows the distribution of heterozygosity levels for cannabis cultivars in the Kannapedia database. The green line shows where this particular strain fits within the distribution. Heterozygosity is associated with heterosis (aka hybrid vigor) but also leads to the production of more variable offspring. When plants have two genetically different parents, heterozygosity levels will be higher than if it has been inbred or backcrossed repeatedly.

Heterozygosity: 1.13%
Least Heterozygous Most Heterozygous

The ratio of reads mapped to Y-contigs to reads mapped to the whole Cannabis genome (Y-ratios) has been demonstrated to be strongly correlated with plant sex typing. This plot shows the distribution of Y-ratios for all samples in our database which were sequenced with the same method (panel or WGS) as this sample and where this sample falls in the distribution.

Y-Ratio Distribution: 0.0585
male female RSP11334

This chart represents the Illumina sequence coverage over the Bt/Bd allele. These are the three regions in the cannabis genome that impact THCA, CBDA, CBGA production. Coverage over the Active CBDAS gene is highly correlated with Type II and Type III plants as described by Etienne de Meijer. Coverage over the THCA gene is highly correlated with Type I and Type II plants but is anti-correlated with Type III plants. Type I plants require coverage over the inactive CBDA loci and no coverage over the Active CBDA gene. Lack of coverage over the Active CBDA and Active THCA allele are presumed to be Type IV plants (CBGA dominant). While deletions of entire THCAS and CBDAS genes are the most common Bt:Bd alleles observed, it is possible to have plants with these genes where functional expression of the enzyme is disrupted by deactivating point mutations (Kojoma et al. 2006).

Bt/Bd Allele Coverage

This chart represents the Illumina sequence coverage over the CBCA synthase gene.

CBCAS Coverage

Variants (THCAS, CBDAS, and CBCAS)

CBDAS c.221C>G p.Thr74Ser missense variant moderate contig1772 2082447

IGV: Start, Jump

C/G
NGS:
0.136
C90:
0.057
CBDAS c.1420A>C p.Lys474Gln missense variant moderate contig1772 2083646

IGV: Start, Jump

A/C
NGS:
0.132
C90:
0.813

Variants (Select Genes of Interest)

PKSG-2a

UniProt

c.67T>A p.Phe23Ile missense variant moderate contig700 1945567

IGV: Start, Jump

A/T
NGS:
0.825
C90:
0.904
PKSG-2a

UniProt

c.31A>T p.Thr11Ser missense variant moderate contig700 1945603

IGV: Start, Jump

T/A
NGS:
0.763
C90:
0.876
PKSG-2b

UniProt

c.1117A>G p.Ile373Val missense variant moderate contig700 1950521

IGV: Start, Jump

T/C
NGS:
0.807
C90:
0.981
PKSG-2b

UniProt

c.31A>T p.Thr11Ser missense variant moderate contig700 1951851

IGV: Start, Jump

T/A
NGS:
0.844
C90:
0.880
PKSG-4b

UniProt

c.496A>G p.Lys166Glu missense variant moderate contig700 2721177

IGV: Start, Jump

T/C
NGS:
0.651
C90:
0.684
PKSG-4b

UniProt

c.489delT p.Phe163fs frameshift variant high contig700 2721183

IGV: Start, Jump

CA/C
NGS:
0.792
C90:
0.761
PKSG-4b

UniProt

c.485A>G p.Lys162Arg missense variant moderate contig700 2721188

IGV: Start, Jump

T/C
NGS:
0.643
C90:
0.301
PKSG-4b

UniProt

c.431T>G p.Val144Gly missense variant moderate contig700 2721242

IGV: Start, Jump

A/C
NGS:
0.575
C90:
0.679
PKSG-4b

UniProt

c.419A>G p.Asp140Gly missense variant moderate contig700 2721254

IGV: Start, Jump

T/C
NGS:
0.430
C90:
0.440
PKSG-4b

UniProt

c.352_355delACAG p.Thr118fs frameshift variant high contig700 2721317

IGV: Start, Jump

CCTGT/C
NGS:
0.529
C90:
0.000
aPT4

UniProt

c.744+1_744+19delGTAATTTATTTTATTATAA splice donor variant & splice region variant & intron variant high contig121 2831022

IGV: Start, Jump

GGTAATTTATTTTATTATAA/G
NGS:
0.096
C90:
0.000
HDS-2

UniProt

c.82_93delGTAACCGGAACT p.Val28_Thr31del conservative inframe deletion moderate contig95 1989748

IGV: Start, Jump

CGTAACCGGAACT/C
NGS:
0.805
C90:
0.000
HDS-2

UniProt

c.127T>G p.Ser43Ala missense variant moderate contig95 1989794

IGV: Start, Jump

T/G
NGS:
0.721
C90:
0.000

Nearest genetic relatives (All Samples)

0 0.075 0.150 0.225 0.300
clone distance sibling distance more distant
  1. 0.150 Unknown- Cherry Wine - 004 (RSP11271)
  2. 0.180 Cherry Blossom (RSP11321)
  3. 0.182 Cherry Blossom (RSP11308)
  4. 0.184 Cherry Blossom (RSP11335)
  5. 0.201 Cherry Blossom (RSP11310)
  6. 0.208 Cherry Blossom (RSP11299)
  7. 0.211 Cherry Blossom (RSP11331)
  8. 0.221 Cherry Blossom (RSP11311)
  9. 0.221 Cherry Blossom (RSP11324)
  10. 0.239 Cherry Blossom (RSP11328)
  11. 0.243 Unknown- Cherry Wine - 001 (RSP11268)
  12. 0.247 Cherry Blossom (RSP11327)
  13. 0.252 Unknown- Cherry Wine - 002 (RSP11269)
  14. 0.253 Cherry Blossom (RSP11333)
  15. 0.255 Cherry Blossom (RSP11323)
  16. 0.259 Cherry Blossom (RSP11320)
  17. 0.261 Cherry Blossom (RSP11302)
  18. 0.267 Cherry Blossom (RSP11301)
  19. 0.268 Unknown- Cherry Wine - 005 (RSP11272)
  20. 0.268 Cherry Blossom (RSP11330)

Nearest genetic relatives (Base Tree)

0 0.108 0.217 0.325 0.433
clone distance sibling distance more distant
  1. 0.345 Recon (RSP10755)
  2. 0.345 Cherry (RSP11143)
  3. 0.349 Blueberry Cheesecake (RSP10684)
  4. 0.352 Durban Poison (RSP11014)
  5. 0.356 Cbot-2019-005 (RSP11133)
  6. 0.365 UP Sunrise (RSP10989)
  7. 0.368 Tygra (RSP10667)
  8. 0.373 Liberty Haze (RSP11000)
  9. 0.383 The Gift (RSP10988)
  10. 0.388 QUEEN JESUS (RSP10105)
  11. 0.388 Kimbo Slice (RSP10997)
  12. 0.401 RKM-2018-005 (RSP11096)
  13. 0.401 Hermaphrodite ResearchSample2 (RSP11050)
  14. 0.403 RKM-2018-019 (RSP11111)
  15. 0.407 Tisza (RSP10659)
  16. 0.408 Cbot-2019-004 (RSP11132)
  17. 0.412 Kyrgyz Gold (RSP11054)
  18. 0.413 KYRG-11 (RSP11051)
  19. 0.414 CST (RSP11002)
  20. 0.415 Golden Goat 2 (RSP10991)

Most genetically distant strains (All Samples)

0 0.125 0.250 0.375 0.500
clone distance sibling distance more distant
  1. 0.499 Jacks Cleaner (RSP11347)
  2. 0.496 JL yellow (RSP11075)
  3. 0.487 Tangerine Haze (RSP10995)
  4. 0.485 RKM-2018-024 (RSP11116)
  5. 0.480 RKM-2018-006 (RSP11097)
  6. 0.480 Chem 91 (RSP11185)
  7. 0.480 JL 3rd Gen Mother (RSP11214)
  8. 0.478 RKM-2018-018 (RSP11110)
  9. 0.476 Italian Kiss (RSP11034)
  10. 0.475 JL 4th Gen 6 (RSP11200)
  11. 0.474 Hermaphrodite Research Sample1 (RSP11049)
  12. 0.471 Hermaphrodite Research Sample1 (RSP11042)
  13. 0.468 Italian Kiss (RSP10990)
  14. 0.468 Brunswick High (RSP11164)
  15. 0.468 JL 4th Gen 5 (RSP11199)
  16. 0.464 RKM-2018-011 (RSP11102)
  17. 0.462 RKM-2018-030 (RSP11122)
  18. 0.458 Sour D (RSP11343)
  19. 0.458 501st OG (RSP11241)
  20. 0.456 RKM-2018-002 (RSP11093)

Most genetically distant strains (Base Tree)

0 0.125 0.250 0.375 0.500
clone distance sibling distance more distant
  1. 0.494 JL yellow (RSP11075)
  2. 0.485 RKM-2018-006 (RSP11097)
  3. 0.483 Italian Kiss (RSP11034)
  4. 0.482 RKM-2018-018 (RSP11110)
  5. 0.474 Hermaphrodite Research Sample1 (RSP11049)
  6. 0.463 RKM-2018-002 (RSP11093)
  7. 0.456 Skunk 18 (RSP11038)
  8. 0.453 Skywalker OG (RSP10837)
  9. 0.452 RKM-2018-009 (RSP11100)
  10. 0.451 Kush Hemp E1 (RSP11128)
  11. 0.450 Sour Raspberry (RSP10551)
  12. 0.448 Black Beauty (RSP11035)
  13. 0.448 RKM-2018-026 (RSP11118)
  14. 0.445 RKM-2018-028 (RSP11120)
  15. 0.442 Gold Cracker (RSP11048)
  16. 0.442 RKM-2018-031 (RSP11123)
  17. 0.441 RKM-2018-029 (RSP11121)
  18. 0.438 RKM-2018-023 (RSP11115)
  19. 0.436 Pie Hoe (RSP11073)
  20. 0.436 Blue Dream (RSP11033)

Nearest genetic relative in Phylos dataset

Phylos Strain SRR8346522
Overlapping SNPs:
65
Concordance:
40

Nearest genetic relative in Lynch dataset

Lynch Strain SRR3495324
Overlapping SNPs:
4
Concordance:
4

Blockchain Registration Information

Transaction ID
084e5bc0e5ef682bce4458fd7f4ae26cd4d5a39bec3919e59d83d3fe0085b244
Stamping Certificate
Download PDF (851.3 KB)
SHASUM Hash
a1c70bbfae1c04eafa6daf7945698976cdf49722f9f115eb1779153ba06f57d7
QR code for RSP11334

Kannapedia uses cookies

By clicking Allow All, you agree to the storing of cookies on your device to enhance site navigation, analyze site usage, and assist in our marketing efforts.

Customize Settings