Cherry Blossom

RSP 11335

Grower: Yabba Cannaba

General Information

Sample Name
CK3
Accession Date
October 17, 2019
Reported Plant Sex
Female

The strain rarity visualization shows how distant the strain is from the other cultivars in the Kannapedia database. The y-axis represents genetic distance, getting farther as you go up. The width of the visualization at any position along the y-axis shows how many strains there are in the database at that genetic distance. So, a common strain will have a more bottom-heavy shape, while uncommon and rare cultivars will have a visualization that is generally shifted towards the top.

Rarity: Uncommon
Most Distant Most Similar

Chemical Information

Cannabinoid and terpenoid information provided by the grower.

Cannabinoids

No information provided.

Terpenoids

No information provided.

Genetic Information

Plant Type
Type III

The bell curve in the heterozygosity visualization shows the distribution of heterozygosity levels for cannabis cultivars in the Kannapedia database. The green line shows where this particular strain fits within the distribution. Heterozygosity is associated with heterosis (aka hybrid vigor) but also leads to the production of more variable offspring. When plants have two genetically different parents, heterozygosity levels will be higher than if it has been inbred or backcrossed repeatedly.

Heterozygosity: 1.14%
Least Heterozygous Most Heterozygous

The ratio of reads mapped to Y-contigs to reads mapped to the whole Cannabis genome (Y-ratios) has been demonstrated to be strongly correlated with plant sex typing. This plot shows the distribution of Y-ratios for all samples in our database which were sequenced with the same method (panel or WGS) as this sample and where this sample falls in the distribution.

Y-Ratio Distribution: 0.0525
male female RSP11335

This chart represents the Illumina sequence coverage over the Bt/Bd allele. These are the three regions in the cannabis genome that impact THCA, CBDA, CBGA production. Coverage over the Active CBDAS gene is highly correlated with Type II and Type III plants as described by Etienne de Meijer. Coverage over the THCA gene is highly correlated with Type I and Type II plants but is anti-correlated with Type III plants. Type I plants require coverage over the inactive CBDA loci and no coverage over the Active CBDA gene. Lack of coverage over the Active CBDA and Active THCA allele are presumed to be Type IV plants (CBGA dominant). While deletions of entire THCAS and CBDAS genes are the most common Bt:Bd alleles observed, it is possible to have plants with these genes where functional expression of the enzyme is disrupted by deactivating point mutations (Kojoma et al. 2006).

Bt/Bd Allele Coverage

This chart represents the Illumina sequence coverage over the CBCA synthase gene.

CBCAS Coverage

Variants (THCAS, CBDAS, and CBCAS)

CBDAS c.221C>G p.Thr74Ser missense variant moderate contig1772 2082447

IGV: Start, Jump

C/G
NGS:
0.136
C90:
0.057
CBDAS c.1420A>C p.Lys474Gln missense variant moderate contig1772 2083646

IGV: Start, Jump

A/C
NGS:
0.132
C90:
0.813

Variants (Select Genes of Interest)

PKSG-2a

UniProt

c.67T>A p.Phe23Ile missense variant moderate contig700 1945567

IGV: Start, Jump

A/T
NGS:
0.825
C90:
0.904
PKSG-2a

UniProt

c.31A>T p.Thr11Ser missense variant moderate contig700 1945603

IGV: Start, Jump

T/A
NGS:
0.763
C90:
0.876
PKSG-2b

UniProt

c.1152T>A p.Asn384Lys missense variant moderate contig700 1950486

IGV: Start, Jump

A/T
NGS:
0.715
C90:
0.895
PKSG-2b

UniProt

c.1132C>G p.Leu378Val missense variant moderate contig700 1950506

IGV: Start, Jump

G/C
NGS:
0.717
C90:
0.000
PKSG-2b

UniProt

c.1117A>G p.Ile373Val missense variant moderate contig700 1950521

IGV: Start, Jump

T/C
NGS:
0.807
C90:
0.981
PKSG-2b

UniProt

c.774G>A p.Met258Ile missense variant moderate contig700 1950864

IGV: Start, Jump

C/T
NGS:
0.366
C90:
0.947
PKSG-2b

UniProt

c.31A>T p.Thr11Ser missense variant moderate contig700 1951851

IGV: Start, Jump

T/A
NGS:
0.844
C90:
0.880
PKSG-4b

UniProt

c.496A>G p.Lys166Glu missense variant moderate contig700 2721177

IGV: Start, Jump

T/C
NGS:
0.651
C90:
0.684
PKSG-4b

UniProt

c.489delT p.Phe163fs frameshift variant high contig700 2721183

IGV: Start, Jump

CA/C
NGS:
0.792
C90:
0.761
PKSG-4b

UniProt

c.485A>G p.Lys162Arg missense variant moderate contig700 2721188

IGV: Start, Jump

T/C
NGS:
0.643
C90:
0.301
PKSG-4b

UniProt

c.431T>G p.Val144Gly missense variant moderate contig700 2721242

IGV: Start, Jump

A/C
NGS:
0.575
C90:
0.679
PKSG-4b

UniProt

c.419A>G p.Asp140Gly missense variant moderate contig700 2721254

IGV: Start, Jump

T/C
NGS:
0.430
C90:
0.440
PKSG-4b

UniProt

c.352_355delACAG p.Thr118fs frameshift variant high contig700 2721317

IGV: Start, Jump

CCTGT/C
NGS:
0.529
C90:
0.000
PKSG-4b

UniProt

c.323A>G p.Glu108Gly missense variant moderate contig700 2721350

IGV: Start, Jump

T/C
NGS:
0.469
C90:
0.000
DXR-2

UniProt

c.1319T>C p.Ile440Thr missense variant moderate contig380 285250

IGV: Start, Jump

A/G
NGS:
0.480
C90:
0.000
FAD2-2

UniProt

c.62C>T p.Pro21Leu missense variant moderate contig83 1803307

IGV: Start, Jump

G/A
NGS:
0.042
C90:
0.000
FAD2-2

UniProt

c.47_57delTGAATCATACT p.Leu16fs frameshift variant high contig83 1803311

IGV: Start, Jump

GAGTATGATTCA/G
NGS:
0.018
C90:
0.000
aPT4

UniProt

c.97T>C p.Tyr33His missense variant moderate contig121 2828753

IGV: Start, Jump

T/C
NGS:
0.439
C90:
0.000
aPT4

UniProt

c.153A>C p.Lys51Asn missense variant moderate contig121 2828809

IGV: Start, Jump

A/C
NGS:
0.375
C90:
0.000
aPT4

UniProt

c.235_236delGT p.Val79fs frameshift variant high contig121 2829030

IGV: Start, Jump

ATG/A
NGS:
0.417
C90:
0.000
aPT4

UniProt

c.238delT p.Ser80fs frameshift variant high contig121 2829034

IGV: Start, Jump

AT/A
NGS:
0.421
C90:
0.000
aPT4

UniProt

c.302A>G p.Asn101Ser missense variant moderate contig121 2829099

IGV: Start, Jump

A/G
NGS:
0.349
C90:
0.000
aPT4

UniProt

c.744+1_744+19delGTAATTTATTTTATTATAA splice donor variant & splice region variant & intron variant high contig121 2831022

IGV: Start, Jump

GGTAATTTATTTTATTATAA/G
NGS:
0.096
C90:
0.000
HDS-2

UniProt

c.82_93delGTAACCGGAACT p.Val28_Thr31del conservative inframe deletion moderate contig95 1989748

IGV: Start, Jump

CGTAACCGGAACT/C
NGS:
0.805
C90:
0.000
HDS-2

UniProt

c.127T>G p.Ser43Ala missense variant moderate contig95 1989794

IGV: Start, Jump

T/G
NGS:
0.721
C90:
0.000

Nearest genetic relatives (All Samples)

0 0.067 0.133 0.200 0.267
clone distance sibling distance more distant
  1. 0.000 Cherry Blossom (RSP11308)
  2. 0.168 Cherry Blossom (RSP11321)
  3. 0.176 Unknown- Cherry Wine - 004 (RSP11271)
  4. 0.184 Cherry Blossom (RSP11334)
  5. 0.192 Cherry Blossom (RSP11332)
  6. 0.199 Unknown- Cherry Wine - 005 (RSP11272)
  7. 0.203 Cherry Blossom (RSP11302)
  8. 0.205 Cherry Blossom (RSP11316)
  9. 0.206 Unknown- Cherry Wine - 002 (RSP11269)
  10. 0.207 Cherry Blossom (RSP11327)
  11. 0.209 Cherry Blossom (RSP11320)
  12. 0.211 Cherry Blossom (RSP11311)
  13. 0.221 Cherry Wine (RSP11267)
  14. 0.224 Cherry Blossom (RSP11299)
  15. 0.224 Cherry Blossom (RSP11317)
  16. 0.229 Cherry Blossom (RSP11326)
  17. 0.233 Unknown- Cherry Wine - 001 (RSP11268)
  18. 0.235 Unknown- Cherry Wine - 003 (RSP11270)
  19. 0.235 Cherry Blossom (RSP11304)
  20. 0.240 Cherry Blossom (RSP11324)

Nearest genetic relatives (Base Tree)

0 0.100 0.200 0.300 0.400
clone distance sibling distance more distant
  1. 0.303 Blueberry Cheesecake (RSP10684)
  2. 0.322 Liberty Haze (RSP11000)
  3. 0.323 UP Sunrise (RSP10989)
  4. 0.324 RKM-2018-019 (RSP11111)
  5. 0.328 Cherry (RSP11142)
  6. 0.344 Cherry (RSP11143)
  7. 0.344 Durban Poison (RSP11014)
  8. 0.352 QUEEN JESUS (RSP10105)
  9. 0.353 Recon (RSP10755)
  10. 0.355 Blueberry Cheesecake (RSP10672)
  11. 0.367 RKM-2018-034 (RSP11126)
  12. 0.370 The Gift (RSP10988)
  13. 0.374 KYRG-11 (RSP11051)
  14. 0.382 Hermaphrodite ResearchSample2 (RSP11050)
  15. 0.383 RKM-2018-022 (RSP11114)
  16. 0.385 Tisza (RSP10659)
  17. 0.385 Tygra (RSP10667)
  18. 0.386 Golden Goat 2 (RSP10991)
  19. 0.386 RKM-2018-003 (RSP11094)
  20. 0.388 Kimbo Slice (RSP10997)

Most genetically distant strains (All Samples)

0 0.133 0.267 0.400 0.533
clone distance sibling distance more distant
  1. 0.519 JL yellow (RSP11075)
  2. 0.496 JL 3rd Gen Mother (RSP11214)
  3. 0.487 JL 4th Gen 5 (RSP11199)
  4. 0.486 JL 3rd Gen Mother (RSP11197)
  5. 0.485 JL 4th Gen 2 (RSP11194)
  6. 0.468 80E (RSP11213)
  7. 0.467 JL 4th Gen 6 (RSP11200)
  8. 0.466 RKM-2018-002 (RSP11093)
  9. 0.465 JL 4th Gen 1 (RSP11193)
  10. 0.463 Chem 91 (RSP11185)
  11. 0.459 JL 4th Gen 4 (RSP11198)
  12. 0.458 Skunk 18 (RSP11038)
  13. 0.458 RKM-2018-009 (RSP11100)
  14. 0.458 RKM-2018-024 (RSP11116)
  15. 0.456 Sour Raspberry (RSP10551)
  16. 0.451 Jacks Cleaner (RSP11347)
  17. 0.451 RKM-2018-010 (RSP11101)
  18. 0.447 501st OG (RSP11241)
  19. 0.445 Abacus (RSP11266)
  20. 0.445 80E (RSP11211)

Most genetically distant strains (Base Tree)

0 0.133 0.267 0.400 0.533
clone distance sibling distance more distant
  1. 0.526 JL yellow (RSP11075)
  2. 0.467 RKM-2018-002 (RSP11093)
  3. 0.466 Skunk 18 (RSP11038)
  4. 0.460 RKM-2018-009 (RSP11100)
  5. 0.459 Sour Raspberry (RSP10551)
  6. 0.450 Italian Kiss (RSP11034)
  7. 0.448 RKM-2018-006 (RSP11097)
  8. 0.442 RKM-2018-033 (RSP11125)
  9. 0.439 Carmagnola (RSP10979)
  10. 0.435 RKM-2018-018 (RSP11110)
  11. 0.435 RKM-2018-023 (RSP11115)
  12. 0.434 Blue Dream (RSP11033)
  13. 0.433 Hermaphrodite Research Sample1 (RSP11049)
  14. 0.431 Black Beauty (RSP11035)
  15. 0.431 Kush Hemp E1 (RSP11128)
  16. 0.431 Feral (RSP10890)
  17. 0.428 RKM-2018-031 (RSP11123)
  18. 0.426 Jiangji (RSP10653)
  19. 0.426 RKM-2018-032 (RSP11124)
  20. 0.425 Carmagnola (RSP11037)

Nearest genetic relative in Phylos dataset

Phylos Strain SRR8349070
Overlapping SNPs:
65
Concordance:
39

Nearest genetic relative in Lynch dataset

Lynch Strain SRR3495216
Overlapping SNPs:
4
Concordance:
4

Blockchain Registration Information

Transaction ID
587e67d202e5fdc14ef75c489299ee362a122eaa93cab8f1248b41364da9bf55
Stamping Certificate
Download PDF (856.1 KB)
SHASUM Hash
1d47e686ae280503586fd32257f2be2055120b09eef6438d450dc1aa44e89ebb
QR code for RSP11335

Kannapedia uses cookies

By clicking Allow All, you agree to the storing of cookies on your device to enhance site navigation, analyze site usage, and assist in our marketing efforts.

Customize Settings