wo wo

RSP 11417

Grower: Hope Springs Memorial Farm LLC

General Information

Sample Name
wFw otto F2 #7 55:1
Accession Date
January 6, 2020
Reported Plant Sex
Female

The strain rarity visualization shows how distant the strain is from the other cultivars in the Kannapedia database. The y-axis represents genetic distance, getting farther as you go up. The width of the visualization at any position along the y-axis shows how many strains there are in the database at that genetic distance. So, a common strain will have a more bottom-heavy shape, while uncommon and rare cultivars will have a visualization that is generally shifted towards the top.

Rarity: Rare
Most Distant Most Similar

Chemical Information

Cannabinoid and terpenoid information provided by the grower.

Cannabinoids

No information provided.

Terpenoids

No information provided.

Genetic Information

Plant Type
Type III

The bell curve in the heterozygosity visualization shows the distribution of heterozygosity levels for cannabis cultivars in the Kannapedia database. The green line shows where this particular strain fits within the distribution. Heterozygosity is associated with heterosis (aka hybrid vigor) but also leads to the production of more variable offspring. When plants have two genetically different parents, heterozygosity levels will be higher than if it has been inbred or backcrossed repeatedly.

Heterozygosity: 1.15%
Least Heterozygous Most Heterozygous

The ratio of reads mapped to Y-contigs to reads mapped to the whole Cannabis genome (Y-ratios) has been demonstrated to be strongly correlated with plant sex typing. This plot shows the distribution of Y-ratios for all samples in our database which were sequenced with the same method (panel or WGS) as this sample and where this sample falls in the distribution.

Y-Ratio Distribution: 0.0434
male female RSP11417

This chart represents the Illumina sequence coverage over the Bt/Bd allele. These are the three regions in the cannabis genome that impact THCA, CBDA, CBGA production. Coverage over the Active CBDAS gene is highly correlated with Type II and Type III plants as described by Etienne de Meijer. Coverage over the THCA gene is highly correlated with Type I and Type II plants but is anti-correlated with Type III plants. Type I plants require coverage over the inactive CBDA loci and no coverage over the Active CBDA gene. Lack of coverage over the Active CBDA and Active THCA allele are presumed to be Type IV plants (CBGA dominant). While deletions of entire THCAS and CBDAS genes are the most common Bt:Bd alleles observed, it is possible to have plants with these genes where functional expression of the enzyme is disrupted by deactivating point mutations (Kojoma et al. 2006).

Bt/Bd Allele Coverage

This chart represents the Illumina sequence coverage over the CBCA synthase gene.

CBCAS Coverage

Variants (THCAS, CBDAS, and CBCAS)

CBDAS c.8G>A p.Cys3Tyr missense variant moderate contig1772 2082234

IGV: Start, Jump

G/A
NGS:
0.057
C90:
0.000
CBDAS c.221C>G p.Thr74Ser missense variant moderate contig1772 2082447

IGV: Start, Jump

C/G
NGS:
0.136
C90:
0.057
CBDAS c.503A>G p.Asn168Ser missense variant moderate contig1772 2082729

IGV: Start, Jump

A/G
NGS:
0.024
C90:
0.062
CBDAS c.1420A>C p.Lys474Gln missense variant moderate contig1772 2083646

IGV: Start, Jump

A/C
NGS:
0.132
C90:
0.813

Variants (Select Genes of Interest)

PKSG-4a

UniProt

c.493G>A p.Gly165Ser missense variant moderate contig700 1937904

IGV: Start, Jump

G/A
NGS:
0.103
C90:
0.000
PKSG-4a

UniProt

c.1191_1193delTTA p.Tyr398del disruptive inframe deletion moderate contig700 1938600

IGV: Start, Jump

AATT/A
NGS:
0.167
C90:
0.000
PKSG-2a

UniProt

c.1152T>A p.Asn384Lys missense variant moderate contig700 1944238

IGV: Start, Jump

A/T
NGS:
0.009
C90:
0.880
PKSG-2a

UniProt

c.1132C>G p.Leu378Val missense variant moderate contig700 1944258

IGV: Start, Jump

G/C
NGS:
0.009
C90:
0.000
PKSG-2a

UniProt

c.1117A>G p.Ile373Val missense variant moderate contig700 1944273

IGV: Start, Jump

T/C
NGS:
0.101
C90:
0.967
PKSG-2a

UniProt

c.774G>A p.Met258Ile missense variant moderate contig700 1944616

IGV: Start, Jump

C/T
NGS:
0.123
C90:
0.000
PKSG-2a

UniProt

c.241G>A p.Val81Met missense variant moderate contig700 1945149

IGV: Start, Jump

C/T
NGS:
0.136
C90:
0.000
PKSG-2a

UniProt

c.240T>G p.Asp80Glu missense variant moderate contig700 1945150

IGV: Start, Jump

A/C
NGS:
0.136
C90:
0.000
PKSG-2a

UniProt

c.224A>G p.Lys75Arg missense variant moderate contig700 1945166

IGV: Start, Jump

T/C
NGS:
0.143
C90:
0.962
PKSG-2a

UniProt

c.188T>G p.Ile63Ser missense variant moderate contig700 1945202

IGV: Start, Jump

A/C
NGS:
0.101
C90:
0.000
PKSG-2a

UniProt

c.187A>T p.Ile63Phe missense variant moderate contig700 1945203

IGV: Start, Jump

T/A
NGS:
0.101
C90:
0.000
PKSG-2a

UniProt

c.167C>G p.Thr56Ser missense variant moderate contig700 1945223

IGV: Start, Jump

G/C
NGS:
0.075
C90:
0.000
PKSG-2a

UniProt

c.67T>A p.Phe23Ile missense variant moderate contig700 1945567

IGV: Start, Jump

A/T
NGS:
0.825
C90:
0.904
PKSG-2a

UniProt

c.31A>T p.Thr11Ser missense variant moderate contig700 1945603

IGV: Start, Jump

T/A
NGS:
0.763
C90:
0.876
PKSG-2a

UniProt

c.-22_2delTAAAAATTATAATAATAATAATAT p.Met1del start lost & conservative inframe deletion high contig700 1945631

IGV: Start, Jump

CATATTATTATTATTATAATTTTTA/C
NGS:
0.013
C90:
0.000
PKSG-2b

UniProt

c.1152T>A p.Asn384Lys missense variant moderate contig700 1950486

IGV: Start, Jump

A/T
NGS:
0.715
C90:
0.895
PKSG-2b

UniProt

c.1132C>G p.Leu378Val missense variant moderate contig700 1950506

IGV: Start, Jump

G/C
NGS:
0.717
C90:
0.000
PKSG-2b

UniProt

c.1117A>G p.Ile373Val missense variant moderate contig700 1950521

IGV: Start, Jump

T/C
NGS:
0.807
C90:
0.981
PKSG-2b

UniProt

c.718T>A p.Phe240Ile missense variant moderate contig700 1950920

IGV: Start, Jump

A/T
NGS:
0.114
C90:
0.000
PKSG-2b

UniProt

c.31A>T p.Thr11Ser missense variant moderate contig700 1951851

IGV: Start, Jump

T/A
NGS:
0.844
C90:
0.880
PKSG-2b

UniProt

c.-5_1delATAATA p.Met1del start lost & conservative inframe deletion high contig700 1951880

IGV: Start, Jump

ATATTAT/A
NGS:
0.007
C90:
0.000
PKSG-4b

UniProt

c.496A>G p.Lys166Glu missense variant moderate contig700 2721177

IGV: Start, Jump

T/C
NGS:
0.651
C90:
0.684
PKSG-4b

UniProt

c.489delT p.Phe163fs frameshift variant high contig700 2721183

IGV: Start, Jump

CA/C
NGS:
0.792
C90:
0.761
PKSG-4b

UniProt

c.485A>G p.Lys162Arg missense variant moderate contig700 2721188

IGV: Start, Jump

T/C
NGS:
0.643
C90:
0.301
PKSG-4b

UniProt

c.431T>G p.Val144Gly missense variant moderate contig700 2721242

IGV: Start, Jump

A/C
NGS:
0.575
C90:
0.679
PKSG-4b

UniProt

c.419A>G p.Asp140Gly missense variant moderate contig700 2721254

IGV: Start, Jump

T/C
NGS:
0.430
C90:
0.440
PKSG-4b

UniProt

c.352_355delACAG p.Thr118fs frameshift variant high contig700 2721317

IGV: Start, Jump

CCTGT/C
NGS:
0.529
C90:
0.000
PKSG-4b

UniProt

c.324A>C p.Glu108Asp missense variant moderate contig700 2721349

IGV: Start, Jump

T/G
NGS:
0.094
C90:
0.000
PKSG-4b

UniProt

c.323A>G p.Glu108Gly missense variant moderate contig700 2721350

IGV: Start, Jump

T/C
NGS:
0.469
C90:
0.000
DXR-2

UniProt

c.1319T>C p.Ile440Thr missense variant moderate contig380 285250

IGV: Start, Jump

A/G
NGS:
0.480
C90:
0.000
aPT4

UniProt

c.16G>A p.Val6Ile missense variant moderate contig121 2828672

IGV: Start, Jump

G/A
NGS:
0.158
C90:
0.000
aPT4

UniProt

c.97T>C p.Tyr33His missense variant moderate contig121 2828753

IGV: Start, Jump

T/C
NGS:
0.439
C90:
0.000
aPT4

UniProt

c.153A>C p.Lys51Asn missense variant moderate contig121 2828809

IGV: Start, Jump

A/C
NGS:
0.375
C90:
0.000
aPT4

UniProt

c.235_236delGT p.Val79fs frameshift variant high contig121 2829030

IGV: Start, Jump

ATG/A
NGS:
0.417
C90:
0.000
aPT4

UniProt

c.238delT p.Ser80fs frameshift variant high contig121 2829034

IGV: Start, Jump

AT/A
NGS:
0.421
C90:
0.000
aPT4

UniProt

c.302A>G p.Asn101Ser missense variant moderate contig121 2829099

IGV: Start, Jump

A/G
NGS:
0.349
C90:
0.000
aPT4

UniProt

c.775delT p.Tyr259fs frameshift variant high contig121 2831380

IGV: Start, Jump

AT/A
NGS:
0.224
C90:
0.000
aPT4

UniProt

c.1168T>C p.Tyr390His missense variant moderate contig121 2833503

IGV: Start, Jump

T/C
NGS:
0.546
C90:
0.000
aPT1

UniProt

c.406A>G p.Ile136Val missense variant moderate contig121 2839605

IGV: Start, Jump

A/G
NGS:
0.579
C90:
0.761
aPT1

UniProt

c.629C>T p.Thr210Ile missense variant moderate contig121 2840237

IGV: Start, Jump

C/T
NGS:
0.561
C90:
0.598
HDS-2

UniProt

c.82_93delGTAACCGGAACT p.Val28_Thr31del conservative inframe deletion moderate contig95 1989748

IGV: Start, Jump

CGTAACCGGAACT/C
NGS:
0.805
C90:
0.000
HDS-2

UniProt

c.127T>G p.Ser43Ala missense variant moderate contig95 1989794

IGV: Start, Jump

T/G
NGS:
0.721
C90:
0.000
HDS-1

UniProt

c.-108+1_-108+2insG splice donor variant & intron variant high contig1891 889975

IGV: Start, Jump

A/AC
NGS:
0.217
C90:
0.000

Nearest genetic relatives (All Samples)

0 0.075 0.150 0.225 0.300
clone distance sibling distance more distant
  1. 0.252 Rest (RSP11377)
  2. 0.254 Stormy (RSP11454)
  3. 0.256 Serious Happiness (RSP10763)
  4. 0.260 Electra (RSP11366)
  5. 0.266 Joy (RSP11380)
  6. 0.268 Doug s Varin (RSP11243)
  7. 0.268 Lift (RSP11378)
  8. 0.270 Blueberry Cheesecake (RSP10684)
  9. 0.273 Pie Hoe (RSP11073)
  10. 0.275 Domnesia (RSP11184)
  11. 0.276 Liberty Haze (RSP11000)
  12. 0.277 Durban Poison #1 (RSP11013)
  13. 0.277 Super Blue Dream (RSP11011)
  14. 0.279 Queen Dream CBG (RSP11277)
  15. 0.279 CBG-#40 (RSP11444)
  16. 0.280 CBG Berry (RSP11445)
  17. 0.280 SourD (RSP12092)
  18. 0.281 Trump x Trump (RSP11466)
  19. 0.281 CBG Fiber (RSP11440)
  20. 0.282 Eran Almog 05MAY2017 (RSP10937)

Nearest genetic relatives (Base Tree)

0 0.083 0.167 0.250 0.333
clone distance sibling distance more distant
  1. 0.269 Pie Hoe (RSP11073)
  2. 0.269 Blueberry Cheesecake (RSP10684)
  3. 0.275 Liberty Haze (RSP11000)
  4. 0.284 Skywalker OG (RSP10837)
  5. 0.286 Cherry (RSP11142)
  6. 0.288 Recon (RSP10755)
  7. 0.295 Tygra (RSP10667)
  8. 0.299 RKM-2018-026 (RSP11118)
  9. 0.300 Kimbo Slice (RSP10997)
  10. 0.304 Durban Poison (RSP11014)
  11. 0.305 RKM-2018-020 (RSP11112)
  12. 0.305 UP Sunrise (RSP10989)
  13. 0.309 The Gift (RSP10988)
  14. 0.311 RKM-2018-029 (RSP11121)
  15. 0.315 Cbot-2019-006 (RSP11134)
  16. 0.315 RKM-2018-004 (RSP11096)
  17. 0.317 Hermaphrodite ResearchSample2 (RSP11050)
  18. 0.320 Gold Cracker (RSP11048)
  19. 0.321 Tisza (RSP10659)
  20. 0.323 CST (RSP11002)

Most genetically distant strains (All Samples)

0 0.125 0.250 0.375 0.500
clone distance sibling distance more distant
  1. 0.480 Cherry Blossom (RSP11318)
  2. 0.452 Unknown--Cherry Wine---001- (RSP11268)
  3. 0.450 Cherry Blossom (RSP11325)
  4. 0.450 Tanao Sri -46- (RSP11486)
  5. 0.450 Wife (RSP11148)
  6. 0.440 Cherry Blossom (RSP11300)
  7. 0.435 Cherry Blossom (RSP11312)
  8. 0.433 Chematonic -Cannatonic x Chemdawg- (RSP11394)
  9. 0.432 Northern Lights (RSP11501)
  10. 0.429 Cherry Blossom (RSP11323)
  11. 0.429 JL yellow (RSP11075)
  12. 0.425 Unknown--Cherry Wine---003- (RSP11270)
  13. 0.425 JL 3rd Gen Mother (RSP11214)
  14. 0.423 Unknown--Cherry Wine---002- (RSP11269)
  15. 0.422 Cherry Blossom (RSP11328)
  16. 0.419 JL 3rd Gen Mother (RSP11197)
  17. 0.418 JL 4th Gen 2 (RSP11194)
  18. 0.417 Brunswick High (RSP11164)
  19. 0.416 CS (RSP11208)
  20. 0.416 Cherry Blossom (RSP11301)

Most genetically distant strains (Base Tree)

0 0.108 0.217 0.325 0.433
clone distance sibling distance more distant
  1. 0.426 JL yellow (RSP11075)
  2. 0.403 Cbot-2019-004 (RSP11132)
  3. 0.393 Cbot-2019-005 (RSP11133)
  4. 0.393 Black Beauty (RSP11035)
  5. 0.393 Carmagnola (RSP11037)
  6. 0.392 RKM-2018-006 (RSP11097)
  7. 0.385 RKM-2018-018 (RSP11110)
  8. 0.384 RKM-2018-028 (RSP11120)
  9. 0.381 Feral (RSP10890)
  10. 0.380 Cbot-2019-001 (RSP11129)
  11. 0.375 RKM-2018-003 (RSP11094)
  12. 0.368 Ivory (RSP10668)
  13. 0.364 Monoica (RSP10241)
  14. 0.363 Italian Kiss (RSP11034)
  15. 0.363 Carmagnola (RSP10979)
  16. 0.362 RKM-2018-009 (RSP11100)
  17. 0.362 USO 31 (RSP10981)
  18. 0.361 Fedora 17 (RSP10661)
  19. 0.360 Futura 75 (RSP10664)
  20. 0.359 RKM-2018-002 (RSP11093)

Nearest genetic relative in Phylos dataset

Phylos Strain SRR8347004
Overlapping SNPs:
70
Concordance:
43

Nearest genetic relative in Lynch dataset

Lynch Strain SRR3495303
Overlapping SNPs:
3
Concordance:
3

Blockchain Registration Information

Transaction ID
09199beb960f09dffc20c31a94886c1979c1d608e20e878584ff8098e447e5ba
Stamping Certificate
Download PDF (39.8 KB)
SHASUM Hash
554e5539a234bb96f5ca83615b9f1f36039dadb19691be1386f7308c249f0245
QR code for RSP11417

Kannapedia uses cookies

By clicking Allow All, you agree to the storing of cookies on your device to enhance site navigation, analyze site usage, and assist in our marketing efforts.

Customize Settings