R3

RSP 11616

Grower: Plant Genomic Laboratory, Medicinal Plant Research Institute

General Information

Sample Name
CS Sativa
Accession Date
July 20, 2020
Reported Plant Sex
unknown

The strain rarity visualization shows how distant the strain is from the other cultivars in the Kannapedia database. The y-axis represents genetic distance, getting farther as you go up. The width of the visualization at any position along the y-axis shows how many strains there are in the database at that genetic distance. So, a common strain will have a more bottom-heavy shape, while uncommon and rare cultivars will have a visualization that is generally shifted towards the top.

Rarity: Rare
Most Distant Most Similar

Chemical Information

Cannabinoid and terpenoid information provided by the grower.

Cannabinoids

No information provided.

Terpenoids

No information provided.

Genetic Information

Plant Type
Type II

The bell curve in the heterozygosity visualization shows the distribution of heterozygosity levels for cannabis cultivars in the Kannapedia database. The green line shows where this particular strain fits within the distribution. Heterozygosity is associated with heterosis (aka hybrid vigor) but also leads to the production of more variable offspring. When plants have two genetically different parents, heterozygosity levels will be higher than if it has been inbred or backcrossed repeatedly.

Heterozygosity: 1.46%
Least Heterozygous Most Heterozygous

The ratio of reads mapped to Y-contigs to reads mapped to the whole Cannabis genome (Y-ratios) has been demonstrated to be strongly correlated with plant sex typing. This plot shows the distribution of Y-ratios for all samples in our database which were sequenced with the same method (panel or WGS) as this sample and where this sample falls in the distribution.

Y-Ratio Distribution: 0.1079
male female RSP11616

This chart represents the Illumina sequence coverage over the Bt/Bd allele. These are the three regions in the cannabis genome that impact THCA, CBDA, CBGA production. Coverage over the Active CBDAS gene is highly correlated with Type II and Type III plants as described by Etienne de Meijer. Coverage over the THCA gene is highly correlated with Type I and Type II plants but is anti-correlated with Type III plants. Type I plants require coverage over the inactive CBDA loci and no coverage over the Active CBDA gene. Lack of coverage over the Active CBDA and Active THCA allele are presumed to be Type IV plants (CBGA dominant). While deletions of entire THCAS and CBDAS genes are the most common Bt:Bd alleles observed, it is possible to have plants with these genes where functional expression of the enzyme is disrupted by deactivating point mutations (Kojoma et al. 2006).

Bt/Bd Allele Coverage

This chart represents the Illumina sequence coverage over the CBCA synthase gene.

CBCAS Coverage

Variants (THCAS, CBDAS, and CBCAS)

No variants to report

Variants (Select Genes of Interest)

GPPs1

UniProt

c.845_848delAAAG p.Glu282fs frameshift variant high contig676 169629

IGV: Start, Jump

TGAAA/T
NGS:
0.118
C90:
0.000
PKSG-2a

UniProt

c.241G>A p.Val81Met missense variant moderate contig700 1945149

IGV: Start, Jump

C/T
NGS:
0.136
C90:
0.000
PKSG-2a

UniProt

c.240T>G p.Asp80Glu missense variant moderate contig700 1945150

IGV: Start, Jump

A/C
NGS:
0.136
C90:
0.000
PKSG-2a

UniProt

c.230T>C p.Val77Ala missense variant moderate contig700 1945160

IGV: Start, Jump

A/G
NGS:
0.114
C90:
0.000
PKSG-2a

UniProt

c.224A>G p.Lys75Arg missense variant moderate contig700 1945166

IGV: Start, Jump

T/C
NGS:
0.143
C90:
0.962
PKSG-2a

UniProt

c.67T>A p.Phe23Ile missense variant moderate contig700 1945567

IGV: Start, Jump

A/T
NGS:
0.825
C90:
0.904
PKSG-2a

UniProt

c.31A>T p.Thr11Ser missense variant moderate contig700 1945603

IGV: Start, Jump

T/A
NGS:
0.763
C90:
0.876
PKSG-2b

UniProt

c.1152T>A p.Asn384Lys missense variant moderate contig700 1950486

IGV: Start, Jump

A/T
NGS:
0.715
C90:
0.895
PKSG-2b

UniProt

c.1132C>G p.Leu378Val missense variant moderate contig700 1950506

IGV: Start, Jump

G/C
NGS:
0.717
C90:
0.000
PKSG-2b

UniProt

c.1117A>G p.Ile373Val missense variant moderate contig700 1950521

IGV: Start, Jump

T/C
NGS:
0.807
C90:
0.981
PKSG-2b

UniProt

c.948T>G p.Asp316Glu missense variant moderate contig700 1950690

IGV: Start, Jump

A/C
NGS:
0.456
C90:
0.000
PKSG-2b

UniProt

c.945T>G p.Ser315Arg missense variant moderate contig700 1950693

IGV: Start, Jump

A/C
NGS:
0.454
C90:
0.000
PKSG-2b

UniProt

c.944G>A p.Ser315Asn missense variant moderate contig700 1950694

IGV: Start, Jump

C/T
NGS:
0.445
C90:
0.000
PKSG-2b

UniProt

c.934C>G p.His312Asp missense variant moderate contig700 1950704

IGV: Start, Jump

G/C
NGS:
0.410
C90:
0.000
PKSG-2b

UniProt

c.774G>A p.Met258Ile missense variant moderate contig700 1950864

IGV: Start, Jump

C/T
NGS:
0.366
C90:
0.947
PKSG-2b

UniProt

c.31A>T p.Thr11Ser missense variant moderate contig700 1951851

IGV: Start, Jump

T/A
NGS:
0.844
C90:
0.880
PKSG-2b

UniProt

c.-2_1dupATA start lost & conservative inframe insertion high contig700 1951880

IGV: Start, Jump

A/ATAT
NGS:
0.410
C90:
0.000
PKSG-4b

UniProt

c.557+2T>C splice donor variant & intron variant high contig700 2721114

IGV: Start, Jump

A/G
NGS:
0.011
C90:
0.000
PKSG-4b

UniProt

c.535_545delATTGGAGTGGG p.Ile179fs frameshift variant high contig700 2721127

IGV: Start, Jump

CCCCACTCCAAT/C
NGS:
0.105
C90:
0.000
PKSG-4b

UniProt

c.523C>T p.His175Tyr missense variant moderate contig700 2721150

IGV: Start, Jump

G/A
NGS:
0.112
C90:
0.325
PKSG-4b

UniProt

c.509_510insTATTTTTGTAAAAATTAACCCAAATTTCAATATTTTTGTAAGTTTCCC p.Gly170_Lys171insIlePheValLysIleAsnProAsnPheAsnIlePheValSerPhePro disruptive inframe insertion moderate contig700 2721163

IGV: Start, Jump

T/TGGGAAACTTACAAAAATATTGAAATTTGGGTTAATTTTTACAAAAATA
NGS:
0.002
C90:
0.000
PKSG-4b

UniProt

c.489delT p.Phe163fs frameshift variant high contig700 2721183

IGV: Start, Jump

CA/C
NGS:
0.792
C90:
0.761
PKSG-4b

UniProt

c.352_355delACAG p.Thr118fs frameshift variant high contig700 2721317

IGV: Start, Jump

CCTGT/C
NGS:
0.529
C90:
0.000
PKSG-4b

UniProt

c.324A>C p.Glu108Asp missense variant moderate contig700 2721349

IGV: Start, Jump

T/G
NGS:
0.094
C90:
0.000
PKSG-4b

UniProt

c.323A>G p.Glu108Gly missense variant moderate contig700 2721350

IGV: Start, Jump

T/C
NGS:
0.469
C90:
0.000
DXR-2

UniProt

c.1319T>C p.Ile440Thr missense variant moderate contig380 285250

IGV: Start, Jump

A/G
NGS:
0.480
C90:
0.000
aPT4

UniProt

c.97T>C p.Tyr33His missense variant moderate contig121 2828753

IGV: Start, Jump

T/C
NGS:
0.439
C90:
0.000
aPT4

UniProt

c.202T>A p.Leu68Ile missense variant moderate contig121 2828858

IGV: Start, Jump

T/A
NGS:
0.068
C90:
0.000
aPT4

UniProt

c.218A>G p.Asn73Ser missense variant moderate contig121 2828874

IGV: Start, Jump

A/G
NGS:
0.018
C90:
0.000
aPT4

UniProt

c.235_236delGT p.Val79fs frameshift variant high contig121 2829030

IGV: Start, Jump

ATG/A
NGS:
0.417
C90:
0.000
aPT4

UniProt

c.238delT p.Ser80fs frameshift variant high contig121 2829034

IGV: Start, Jump

AT/A
NGS:
0.421
C90:
0.000
aPT4

UniProt

c.626A>G p.Asn209Ser missense variant moderate contig121 2830904

IGV: Start, Jump

A/G
NGS:
0.035
C90:
0.000
aPT4

UniProt

c.1127C>A p.Pro376Gln missense variant & splice region variant moderate contig121 2833312

IGV: Start, Jump

C/A
NGS:
0.018
C90:
0.000
aPT1

UniProt

c.160A>C p.Thr54Pro missense variant moderate contig121 2835867

IGV: Start, Jump

A/C
NGS:
0.086
C90:
0.048
aPT1

UniProt

c.670T>A p.Ser224Thr missense variant moderate contig121 2840278

IGV: Start, Jump

T/A
NGS:
0.077
C90:
0.000
aPT1

UniProt

c.727G>T p.Glu243* stop gained high contig121 2841362

IGV: Start, Jump

G/T
NGS:
0.127
C90:
0.100
aPT1

UniProt

c.864C>G p.Asn288Lys missense variant moderate contig121 2842407

IGV: Start, Jump

C/G
NGS:
0.075
C90:
0.062
HDS-2

UniProt

c.151G>T p.Ala51Ser missense variant moderate contig95 1989818

IGV: Start, Jump

G/T
NGS:
0.011
C90:
0.000

Nearest genetic relative in Phylos dataset

Phylos Strain SRR4448587
Overlapping SNPs:
76
Concordance:
50

Nearest genetic relative in Lynch dataset

Lynch Strain SRR3495314
Overlapping SNPs:
2
Concordance:
2

Blockchain Registration Information

SHASUM Hash
cab3445ca1f245ebe5cefb68dca63f8978aac71ff4dbae63406ab757a2504083
QR code for RSP11616

Kannapedia uses cookies

By clicking Allow All, you agree to the storing of cookies on your device to enhance site navigation, analyze site usage, and assist in our marketing efforts.

Customize Settings