CS Indica

RSP 11658

Grower: Medicinal Plant Research Institute

General Information

Accession Date
November 1, 2020
Reported Plant Sex
unknown

The strain rarity visualization shows how distant the strain is from the other cultivars in the Kannapedia database. The y-axis represents genetic distance, getting farther as you go up. The width of the visualization at any position along the y-axis shows how many strains there are in the database at that genetic distance. So, a common strain will have a more bottom-heavy shape, while uncommon and rare cultivars will have a visualization that is generally shifted towards the top.

Rarity: Rare
Most Distant Most Similar

Chemical Information

Cannabinoid and terpenoid information provided by the grower.

Cannabinoids

No information provided.

Terpenoids

No information provided.

Genetic Information

Plant Type
Type II

The bell curve in the heterozygosity visualization shows the distribution of heterozygosity levels for cannabis cultivars in the Kannapedia database. The green line shows where this particular strain fits within the distribution. Heterozygosity is associated with heterosis (aka hybrid vigor) but also leads to the production of more variable offspring. When plants have two genetically different parents, heterozygosity levels will be higher than if it has been inbred or backcrossed repeatedly.

Heterozygosity: 1.24%
Least Heterozygous Most Heterozygous

The ratio of reads mapped to Y-contigs to reads mapped to the whole Cannabis genome (Y-ratios) has been demonstrated to be strongly correlated with plant sex typing. This plot shows the distribution of Y-ratios for all samples in our database which were sequenced with the same method (panel or WGS) as this sample and where this sample falls in the distribution.

Y-Ratio Distribution: 0.0285
male female RSP11658

This chart represents the Illumina sequence coverage over the Bt/Bd allele. These are the three regions in the cannabis genome that impact THCA, CBDA, CBGA production. Coverage over the Active CBDAS gene is highly correlated with Type II and Type III plants as described by Etienne de Meijer. Coverage over the THCA gene is highly correlated with Type I and Type II plants but is anti-correlated with Type III plants. Type I plants require coverage over the inactive CBDA loci and no coverage over the Active CBDA gene. Lack of coverage over the Active CBDA and Active THCA allele are presumed to be Type IV plants (CBGA dominant). While deletions of entire THCAS and CBDAS genes are the most common Bt:Bd alleles observed, it is possible to have plants with these genes where functional expression of the enzyme is disrupted by deactivating point mutations (Kojoma et al. 2006).

Bt/Bd Allele Coverage

This chart represents the Illumina sequence coverage over the CBCA synthase gene.

CBCAS Coverage

Variants (THCAS, CBDAS, and CBCAS)

No variants to report

Variants (Select Genes of Interest)

EMF1-2

UniProt

c.710A>C p.His237Pro missense variant moderate contig885 810

IGV: Start, Jump

A/C
NGS:
0.090
C90:
0.474
EMF1-2

UniProt

c.1187T>C p.Leu396Ser missense variant moderate contig885 2073

IGV: Start, Jump

T/C
NGS:
0.026
C90:
0.000
EMF1-2

UniProt

c.2256A>T p.Lys752Asn missense variant moderate contig885 3142

IGV: Start, Jump

A/T
NGS:
0.026
C90:
0.000
PHL-2 c.575T>C p.Ile192Thr missense variant moderate contig2621 339568

IGV: Start, Jump

T/C
NGS:
0.009
C90:
0.000
PHL-2 c.841A>T p.Ser281Cys missense variant moderate contig2621 340119

IGV: Start, Jump

A/T
NGS:
0.011
C90:
0.000
PHL-2 c.1057A>G p.Arg353Gly missense variant moderate contig2621 340335

IGV: Start, Jump

A/G
NGS:
0.096
C90:
0.555
PHL-2 c.1096G>A p.Ala366Thr missense variant moderate contig2621 340374

IGV: Start, Jump

G/A
NGS:
0.090
C90:
0.531
PHL-2 c.1115T>G p.Val372Gly missense variant moderate contig2621 340393

IGV: Start, Jump

T/G
NGS:
0.007
C90:
0.000
PHL-2 c.1166C>T p.Pro389Leu missense variant moderate contig2621 340444

IGV: Start, Jump

C/T
NGS:
0.011
C90:
0.057
PHL-2 c.1577A>G p.His526Arg missense variant moderate contig2621 340855

IGV: Start, Jump

A/G
NGS:
0.009
C90:
0.000
PHL-2 c.2783G>A p.Ser928Asn missense variant moderate contig2621 342826

IGV: Start, Jump

G/A
NGS:
0.107
C90:
0.890
PHL-2 c.3373A>G p.Thr1125Ala missense variant moderate contig2621 343416

IGV: Start, Jump

A/G
NGS:
0.009
C90:
0.110
PHL-2 c.3556_3557delAA p.Lys1186fs frameshift variant high contig2621 343598

IGV: Start, Jump

GAA/G
NGS:
0.013
C90:
0.096
PKSG-4a

UniProt

c.1191_1193delTTA p.Tyr398del disruptive inframe deletion moderate contig700 1938600

IGV: Start, Jump

AATT/A
NGS:
0.167
C90:
0.000
PKSG-2a

UniProt

c.948T>G p.Asp316Glu missense variant moderate contig700 1944442

IGV: Start, Jump

A/C
NGS:
0.079
C90:
0.000
PKSG-2a

UniProt

c.945T>G p.Ser315Arg missense variant moderate contig700 1944445

IGV: Start, Jump

A/C
NGS:
0.079
C90:
0.000
PKSG-2a

UniProt

c.944G>A p.Ser315Asn missense variant moderate contig700 1944446

IGV: Start, Jump

C/T
NGS:
0.079
C90:
0.000
PKSG-2a

UniProt

c.934C>G p.His312Asp missense variant moderate contig700 1944456

IGV: Start, Jump

G/C
NGS:
0.070
C90:
0.000
PKSG-2b

UniProt

c.1136G>A p.Arg379His missense variant moderate contig700 1950502

IGV: Start, Jump

C/T
NGS:
0.002
C90:
0.000
PKSG-4b

UniProt

c.496A>G p.Lys166Glu missense variant moderate contig700 2721177

IGV: Start, Jump

T/C
NGS:
0.651
C90:
0.684
PKSG-4b

UniProt

c.489delT p.Phe163fs frameshift variant high contig700 2721183

IGV: Start, Jump

CA/C
NGS:
0.792
C90:
0.761
PKSG-4b

UniProt

c.485A>G p.Lys162Arg missense variant moderate contig700 2721188

IGV: Start, Jump

T/C
NGS:
0.643
C90:
0.301
PKSG-4b

UniProt

c.431T>G p.Val144Gly missense variant moderate contig700 2721242

IGV: Start, Jump

A/C
NGS:
0.575
C90:
0.679
PKSG-4b

UniProt

c.352_355delACAG p.Thr118fs frameshift variant high contig700 2721317

IGV: Start, Jump

CCTGT/C
NGS:
0.529
C90:
0.000
PKSG-4b

UniProt

c.323A>G p.Glu108Gly missense variant moderate contig700 2721350

IGV: Start, Jump

T/C
NGS:
0.469
C90:
0.000
PKSG-4b

UniProt

c.316+2T>A splice donor variant & intron variant high contig700 2723818

IGV: Start, Jump

A/T
NGS:
0.070
C90:
0.689
PKSG-4b

UniProt

c.229G>A p.Gly77Ser missense variant moderate contig700 2724206

IGV: Start, Jump

C/T
NGS:
0.042
C90:
0.000
PKSG-4b

UniProt

c.216G>C p.Leu72Phe missense variant moderate contig700 2724219

IGV: Start, Jump

C/G
NGS:
0.044
C90:
0.000
PKSG-4b

UniProt

c.206T>C p.Leu69Ser missense variant moderate contig700 2724229

IGV: Start, Jump

A/G
NGS:
0.044
C90:
0.000
DXR-2

UniProt

c.1319T>C p.Ile440Thr missense variant moderate contig380 285250

IGV: Start, Jump

A/G
NGS:
0.480
C90:
0.000
OAC-1

UniProt

c.260C>G p.Ser87Cys missense variant moderate contig931 118104

IGV: Start, Jump

G/C
NGS:
0.053
C90:
0.000
OAC-1

UniProt

c.220A>G p.Ile74Val missense variant moderate contig931 118144

IGV: Start, Jump

T/C
NGS:
0.033
C90:
0.670
FAD2-2

UniProt

c.161T>A p.Leu54His missense variant moderate contig83 1803208

IGV: Start, Jump

A/T
NGS:
0.156
C90:
0.000
ELF3

UniProt

c.1466G>A p.Ser489Asn missense variant moderate contig97 244297

IGV: Start, Jump

G/A
NGS:
0.123
C90:
0.000
ELF3

UniProt

c.1630A>G p.Thr544Ala missense variant moderate contig97 244461

IGV: Start, Jump

A/G
NGS:
0.103
C90:
0.545
ELF3

UniProt

c.1803_1805delTCA p.His601del disruptive inframe deletion moderate contig97 244625

IGV: Start, Jump

ACAT/A
NGS:
0.092
C90:
0.000
ELF3

UniProt

c.1966C>G p.Pro656Ala missense variant moderate contig97 244797

IGV: Start, Jump

C/G
NGS:
0.123
C90:
0.632
ELF3

UniProt

c.2198G>T p.Arg733Leu missense variant moderate contig97 245029

IGV: Start, Jump

G/T
NGS:
0.125
C90:
0.531
ELF3

UniProt

c.2216A>G p.His739Arg missense variant moderate contig97 245047

IGV: Start, Jump

A/G
NGS:
0.020
C90:
0.182
aPT4

UniProt

c.439T>A p.Ser147Thr missense variant moderate contig121 2830634

IGV: Start, Jump

T/A
NGS:
0.015
C90:
0.000
aPT4

UniProt

c.1168T>C p.Tyr390His missense variant moderate contig121 2833503

IGV: Start, Jump

T/C
NGS:
0.546
C90:
0.000
aPT1

UniProt

c.220A>G p.Ile74Val missense variant moderate contig121 2835927

IGV: Start, Jump

A/G
NGS:
0.018
C90:
0.019
HDS-2

UniProt

c.82_93delGTAACCGGAACT p.Val28_Thr31del conservative inframe deletion moderate contig95 1989748

IGV: Start, Jump

CGTAACCGGAACT/C
NGS:
0.805
C90:
0.000
AAE1-2

UniProt

c.133T>A p.Phe45Ile missense variant moderate contig81 209095

IGV: Start, Jump

T/A
NGS:
0.004
C90:
0.000
AAE1-2

UniProt

c.311A>G p.Asn104Ser missense variant moderate contig81 209273

IGV: Start, Jump

A/G
NGS:
0.004
C90:
0.000
AAE1-2

UniProt

c.331A>G p.Asn111Asp missense variant moderate contig81 209293

IGV: Start, Jump

A/G
NGS:
0.123
C90:
0.000
AAE1-2

UniProt

c.368A>C p.His123Pro missense variant moderate contig81 209330

IGV: Start, Jump

A/C
NGS:
0.002
C90:
0.000
AAE1-2

UniProt

c.374A>G p.His125Arg missense variant moderate contig81 209336

IGV: Start, Jump

A/G
NGS:
0.026
C90:
0.000
AAE1-2

UniProt

c.1006A>G p.Lys336Glu missense variant moderate contig81 209968

IGV: Start, Jump

A/G
NGS:
0.116
C90:
0.000
AAE1-2

UniProt

c.1090A>G p.Lys364Glu missense variant moderate contig81 210052

IGV: Start, Jump

A/G
NGS:
0.007
C90:
0.000
AAE1-2

UniProt

c.1102C>A p.His368Asn missense variant moderate contig81 210064

IGV: Start, Jump

C/A
NGS:
0.033
C90:
0.000
AAE1-2

UniProt

c.1118C>G p.Thr373Ser missense variant moderate contig81 210080

IGV: Start, Jump

C/G
NGS:
0.026
C90:
0.000
AAE1-2

UniProt

c.1205C>T p.Ala402Val missense variant moderate contig81 210167

IGV: Start, Jump

C/T
NGS:
0.009
C90:
0.000
AAE1-2

UniProt

c.1415G>A p.Ser472Asn missense variant moderate contig81 210377

IGV: Start, Jump

G/A
NGS:
0.070
C90:
0.000
AAE1-2

UniProt

c.1417A>G p.Thr473Ala missense variant moderate contig81 210379

IGV: Start, Jump

A/G
NGS:
0.070
C90:
0.000
AAE1-2

UniProt

c.1434G>T p.Glu478Asp missense variant moderate contig81 210396

IGV: Start, Jump

G/T
NGS:
0.075
C90:
0.000
AAE1-2

UniProt

c.1451A>T p.Lys484Met missense variant moderate contig81 210413

IGV: Start, Jump

A/T
NGS:
0.002
C90:
0.000
AAE1-2

UniProt

c.1541T>C p.Val514Ala missense variant moderate contig81 210503

IGV: Start, Jump

T/C
NGS:
0.050
C90:
0.000
PHL-1

UniProt

c.2978A>G p.Asn993Ser missense variant moderate contig1439 1486819

IGV: Start, Jump

T/C
NGS:
0.002
C90:
0.000
PHL-1

UniProt

c.2623A>G p.Thr875Ala missense variant moderate contig1439 1487174

IGV: Start, Jump

T/C
NGS:
0.123
C90:
0.000
PHL-1

UniProt

c.2551A>G p.Thr851Ala missense variant moderate contig1439 1487246

IGV: Start, Jump

T/C
NGS:
0.116
C90:
0.890
PHL-1

UniProt

c.1387A>G p.Thr463Ala missense variant moderate contig1439 1489811

IGV: Start, Jump

T/C
NGS:
0.107
C90:
0.904
PHL-1

UniProt

c.432T>A p.Asp144Glu missense variant moderate contig1439 1491416

IGV: Start, Jump

A/T
NGS:
0.002
C90:
0.000
PHL-1

UniProt

c.407G>A p.Arg136Gln missense variant moderate contig1439 1491441

IGV: Start, Jump

C/T
NGS:
0.024
C90:
0.139
PHL-1

UniProt

c.176G>A p.Gly59Glu missense variant moderate contig1439 1492817

IGV: Start, Jump

C/T
NGS:
0.024
C90:
0.000
PHL-1

UniProt

c.175G>A p.Gly59Arg missense variant moderate contig1439 1492818

IGV: Start, Jump

C/T
NGS:
0.024
C90:
0.144
Edestin

UniProt

c.16T>C p.Ser6Pro missense variant moderate contig850 3065274

IGV: Start, Jump

A/G
NGS:
0.059
C90:
0.000
HDS-1

UniProt

c.1618A>G p.Ile540Val missense variant moderate contig1891 885936

IGV: Start, Jump

T/C
NGS:
0.099
C90:
0.861
HDS-1

UniProt

c.1378G>A p.Val460Ile missense variant moderate contig1891 886370

IGV: Start, Jump

C/T
NGS:
0.167
C90:
0.000
HDS-1

UniProt

c.136G>A p.Val46Ile missense variant moderate contig1891 889256

IGV: Start, Jump

C/T
NGS:
0.088
C90:
0.593
HDS-1

UniProt

c.56C>G p.Ala19Gly missense variant moderate contig1891 889336

IGV: Start, Jump

G/C
NGS:
0.125
C90:
0.943
HDS-1

UniProt

c.-108+1_-108+2insG splice donor variant & intron variant high contig1891 889975

IGV: Start, Jump

A/AC
NGS:
0.217
C90:
0.000
PIE1-2

UniProt

c.6623C>T p.Ala2208Val missense variant moderate contig1460 1184464

IGV: Start, Jump

G/A
NGS:
0.044
C90:
0.689
PIE1-2

UniProt

c.5932A>G p.Ile1978Val missense variant moderate contig1460 1185552

IGV: Start, Jump

T/C
NGS:
0.061
C90:
0.268
PIE1-2

UniProt

c.1872T>A p.Asp624Glu missense variant moderate contig1460 1190252

IGV: Start, Jump

A/T
NGS:
0.086
C90:
0.990
PIE1-2

UniProt

c.1696G>A p.Val566Met missense variant moderate contig1460 1191534

IGV: Start, Jump

C/T
NGS:
0.018
C90:
0.000
PIE1-2

UniProt

c.1683A>T p.Leu561Phe missense variant moderate contig1460 1191547

IGV: Start, Jump

T/A
NGS:
0.018
C90:
0.000
PIE1-2

UniProt

c.1630G>C p.Ala544Pro missense variant moderate contig1460 1191600

IGV: Start, Jump

C/G
NGS:
0.070
C90:
0.933
PIE1-2

UniProt

c.1318A>G p.Asn440Asp missense variant moderate contig1460 1192080

IGV: Start, Jump

T/C
NGS:
0.018
C90:
0.100
PIE1-2

UniProt

c.1294G>A p.Asp432Asn missense variant moderate contig1460 1192104

IGV: Start, Jump

C/T
NGS:
0.018
C90:
0.100
PIE1-2

UniProt

c.1289A>G p.Asp430Gly missense variant moderate contig1460 1192109

IGV: Start, Jump

T/C
NGS:
0.079
C90:
0.000
PIE1-2

UniProt

c.1279G>A p.Val427Ile missense variant moderate contig1460 1192119

IGV: Start, Jump

C/T
NGS:
0.018
C90:
0.105
PIE1-2

UniProt

c.710C>T p.Pro237Leu missense variant moderate contig1460 1193804

IGV: Start, Jump

G/A
NGS:
0.072
C90:
0.866
PIE1-2

UniProt

c.706T>C p.Tyr236His missense variant moderate contig1460 1193808

IGV: Start, Jump

A/G
NGS:
0.059
C90:
0.737
PIE1-2

UniProt

c.665+2T>A splice donor variant & intron variant high contig1460 1194391

IGV: Start, Jump

A/T
NGS:
0.009
C90:
0.000
PIE1-2

UniProt

c.637T>A p.Ser213Thr missense variant moderate contig1460 1194421

IGV: Start, Jump

A/T
NGS:
0.079
C90:
0.885
EMF2

UniProt

c.1772A>G p.Gln591Arg missense variant moderate contig954 3059929

IGV: Start, Jump

A/G
NGS:
0.092
C90:
0.876
EMF1-1

UniProt

c.242A>G p.Lys81Arg missense variant moderate contig883 269731

IGV: Start, Jump

A/G
NGS:
0.022
C90:
0.053
FT

UniProt

c.32_43dupATAATAATAATA p.Asn11_Asn14dup disruptive inframe insertion moderate contig1561 3124441

IGV: Start, Jump

T/TTAATAATAATAA
NGS:
0.066
C90:
0.000
FT

UniProt

c.20_43dupATAATAATAATAATAATAATAATA p.Asn7_Asn14dup disruptive inframe insertion moderate contig1561 3124441

IGV: Start, Jump

T/TTAATAATAATAATAATAATAATAA
NGS:
0.002
C90:
0.000
FT

UniProt

c.240C>G p.Asn80Lys missense variant moderate contig1561 3124664

IGV: Start, Jump

C/G
NGS:
0.075
C90:
0.000
FLD

UniProt

c.2981T>C p.Met994Thr missense variant moderate contig1450 2044012

IGV: Start, Jump

A/G
NGS:
0.064
C90:
0.478
FLD

UniProt

c.2962G>A p.Asp988Asn missense variant moderate contig1450 2044031

IGV: Start, Jump

C/T
NGS:
0.009
C90:
0.000
FLD

UniProt

c.2840A>G p.Asn947Ser missense variant moderate contig1450 2044192

IGV: Start, Jump

T/C
NGS:
0.007
C90:
0.000
FLD

UniProt

c.2585G>A p.Arg862Gln missense variant moderate contig1450 2045075

IGV: Start, Jump

C/T
NGS:
0.007
C90:
0.000
AAE1-3

UniProt

c.729G>T p.Lys243Asn missense variant moderate contig976 1083125

IGV: Start, Jump

C/A
NGS:
0.007
C90:
0.000
AAE1-3

UniProt

c.634G>C p.Gly212Arg missense variant moderate contig976 1083220

IGV: Start, Jump

C/G
NGS:
0.116
C90:
0.000
AAE1-3

UniProt

c.487A>T p.Met163Leu missense variant moderate contig976 1083538

IGV: Start, Jump

T/A
NGS:
0.002
C90:
0.000
AAE1-3

UniProt

c.467T>C p.Met156Thr missense variant moderate contig976 1083558

IGV: Start, Jump

A/G
NGS:
0.002
C90:
0.000
AAE1-3

UniProt

c.416T>C p.Leu139Pro missense variant moderate contig976 1083609

IGV: Start, Jump

A/G
NGS:
0.061
C90:
0.000
AAE1-3

UniProt

c.388G>A p.Gly130Ser missense variant moderate contig976 1083637

IGV: Start, Jump

C/T
NGS:
0.007
C90:
0.000
AAE1-3

UniProt

c.382T>C p.Tyr128His missense variant moderate contig976 1083643

IGV: Start, Jump

A/G
NGS:
0.072
C90:
0.000
AAE1-3

UniProt

c.327G>T p.Trp109Cys missense variant moderate contig976 1083698

IGV: Start, Jump

C/A
NGS:
0.002
C90:
0.000
AAE1-3

UniProt

c.301A>T p.Thr101Ser missense variant moderate contig976 1083724

IGV: Start, Jump

T/A
NGS:
0.002
C90:
0.000
AAE1-3

UniProt

c.293A>G p.Asp98Gly missense variant moderate contig976 1083732

IGV: Start, Jump

T/C
NGS:
0.068
C90:
0.000
AAE1-3

UniProt

c.235A>C p.Lys79Gln missense variant & splice region variant moderate contig976 1083840

IGV: Start, Jump

T/G
NGS:
0.007
C90:
0.000
AAE1-3

UniProt

c.218G>A p.Arg73Gln missense variant moderate contig976 1083857

IGV: Start, Jump

C/T
NGS:
0.002
C90:
0.000
AAE1-3

UniProt

c.167A>G p.Glu56Gly missense variant moderate contig976 1083908

IGV: Start, Jump

T/C
NGS:
0.070
C90:
0.000
AAE1-3

UniProt

c.158C>A p.Thr53Asn missense variant moderate contig976 1083917

IGV: Start, Jump

G/T
NGS:
0.002
C90:
0.000
AAE1-3

UniProt

c.147G>T p.Gln49His missense variant moderate contig976 1083928

IGV: Start, Jump

C/A
NGS:
0.002
C90:
0.000
AAE1-3

UniProt

c.127A>G p.Ile43Val missense variant moderate contig976 1083948

IGV: Start, Jump

T/C
NGS:
0.007
C90:
0.000
AAE1-3

UniProt

c.125A>G p.Glu42Gly missense variant moderate contig976 1083950

IGV: Start, Jump

T/C
NGS:
0.064
C90:
0.000
AAE1-3

UniProt

c.80C>T p.Thr27Ile missense variant moderate contig976 1083995

IGV: Start, Jump

G/A
NGS:
0.002
C90:
0.000
AAE1-3

UniProt

c.79A>G p.Thr27Ala missense variant moderate contig976 1083996

IGV: Start, Jump

T/C
NGS:
0.068
C90:
0.000
AAE1-3

UniProt

c.52G>A p.Gly18Ser missense variant moderate contig976 1084023

IGV: Start, Jump

C/T
NGS:
0.064
C90:
0.000
AAE1-3

UniProt

c.48C>A p.Cys16* stop gained high contig976 1084027

IGV: Start, Jump

G/T
NGS:
0.002
C90:
0.000
AAE1-3

UniProt

c.14C>T p.Ala5Val missense variant moderate contig976 1084061

IGV: Start, Jump

G/A
NGS:
0.004
C90:
0.000
FAD7A-1

UniProt

c.*340_*343-6delTATATATATATATATATAGA splice donor variant & splice region variant & 3 prime UTR variant & intron variant high contig510 71467

IGV: Start, Jump

CTATATATATATATATATAGA/C
NGS:
0.004
C90:
0.000
PIE1-1

UniProt

c.418C>A p.Leu140Met missense variant moderate contig1225 2278688

IGV: Start, Jump

C/A
NGS:
0.002
C90:
0.000
PIE1-1

UniProt

c.1066C>T p.Arg356Trp missense variant moderate contig1225 2281326

IGV: Start, Jump

C/T
NGS:
0.015
C90:
0.105
PIE1-1

UniProt

c.1120G>A p.Asp374Asn missense variant moderate contig1225 2281380

IGV: Start, Jump

G/A
NGS:
0.015
C90:
0.000
PIE1-1

UniProt

c.1222C>G p.Gln408Glu missense variant moderate contig1225 2281482

IGV: Start, Jump

C/G
NGS:
0.096
C90:
0.852
PIE1-1

UniProt

c.1249G>T p.Val417Leu missense variant moderate contig1225 2281509

IGV: Start, Jump

G/T
NGS:
0.020
C90:
0.096
PIE1-1

UniProt

c.1785A>T p.Leu595Phe missense variant moderate contig1225 2282213

IGV: Start, Jump

A/T
NGS:
0.011
C90:
0.100
GGR

UniProt

c.53A>G p.Asn18Ser missense variant moderate contig2282 549045

IGV: Start, Jump

A/G
NGS:
0.002
C90:
0.000
GGR

UniProt

c.376G>C p.Glu126Gln missense variant moderate contig2282 549368

IGV: Start, Jump

G/C
NGS:
0.015
C90:
0.110
GGR

UniProt

c.382C>T p.Leu128Phe missense variant moderate contig2282 549374

IGV: Start, Jump

C/T
NGS:
0.024
C90:
0.000
GGR

UniProt

c.456T>A p.His152Gln missense variant moderate contig2282 549448

IGV: Start, Jump

T/A
NGS:
0.068
C90:
0.000
GGR

UniProt

c.460G>A p.Asp154Asn missense variant moderate contig2282 549452

IGV: Start, Jump

G/A
NGS:
0.070
C90:
0.000
GGR

UniProt

c.704A>T p.His235Leu missense variant moderate contig2282 549696

IGV: Start, Jump

A/T
NGS:
0.121
C90:
0.000
GGR

UniProt

c.727T>C p.Tyr243His missense variant moderate contig2282 549719

IGV: Start, Jump

T/C
NGS:
0.002
C90:
0.000
PKSB-3

UniProt

c.1946C>T p.Pro649Leu missense variant moderate contig93 3340053

IGV: Start, Jump

C/T
NGS:
0.009
C90:
0.000

Nearest genetic relative in Phylos dataset

Phylos Strain SRR4448688
Overlapping SNPs:
33
Concordance:
26

Nearest genetic relative in Lynch dataset

Lynch Strain SRR3495193
Overlapping SNPs:
5
Concordance:
5

Blockchain Registration Information

SHASUM Hash
aa39c43de0bc2aa792148a693b91eb5397f41c1a1bdf68fef589b6458f175f47
QR code for RSP11658

Kannapedia uses cookies

By clicking Allow All, you agree to the storing of cookies on your device to enhance site navigation, analyze site usage, and assist in our marketing efforts.

Customize Settings