CS Indica

RSP 11658

Grower: Medicinal Plant Research Institute

General Information

Accession Date
November 1, 2020
Reported Plant Sex
not reported

The strain rarity visualization shows how distant the strain is from the other cultivars in the Kannapedia database. The y-axis represents genetic distance, getting farther as you go up. The width of the visualization at any position along the y-axis shows how many strains there are in the database at that genetic distance. So, a common strain will have a more bottom-heavy shape, while uncommon and rare cultivars will have a visualization that is generally shifted towards the top.

Rarity: Rare
Most Distant Most Similar

Chemical Information

Cannabinoid and terpenoid information provided by the grower.


No information provided.


No information provided.

Genetic Information

Plant Type
Type II

The bell curve in the heterozygosity visualization shows the distribution of heterozygosity levels for cannabis cultivars in the Kannapedia database. The green line shows where this particular strain fits within the distribution. Heterozygosity is associated with heterosis (aka hybrid vigor) but also leads to the production of more variable offspring. When plants have two genetically different parents, heterozygosity levels will be higher than if it has been inbred or backcrossed repeatedly.

Heterozygosity: 1.24%
Least Heterozygous Most Heterozygous

The ratio of reads mapped to Y-contigs to reads mapped to the whole Cannabis genome (Y-ratios) has been demonstrated to be strongly correlated with plant sex typing. This plot shows the distribution of Y-ratios for all samples in our database which were sequenced with the same method (panel or WGS) as this sample and where this sample falls in the distribution.

Y-Ratio Distribution: 0.0285
male female RSP11658

This chart represents the Illumina sequence coverage over the Bt/Bd allele. These are the three regions in the cannabis genome that impact THCA, CBDA, CBGA production. Coverage over the Active CBDAS gene is highly correlated with Type II and Type III plants as described by Etienne de Meijer. Coverage over the THCA gene is highly correlated with Type I and Type II plants but is anti-correlated with Type III plants. Type I plants require coverage over the inactive CBDA loci and no coverage over the Active CBDA gene. Lack of coverage over the Active CBDA and Active THCA allele are presumed to be Type IV plants (CBGA dominant). While deletions of entire THCAS and CBDAS genes are the most common Bt:Bd alleles observed, it is possible to have plants with these genes where functional expression of the enzyme is disrupted by deactivating point mutations (Kojoma et al. 2006).

Bt/Bd Allele Coverage

This chart represents the Illumina sequence coverage over the CBCA synthase gene.

CBCAS Coverage

Variants (THCAS, CBDAS, and CBCAS)

No variants to report

Variants (Select Genes of Interest)



c.710A>C p.His237Pro missense variant moderate contig885 810

IGV: Start, Jump



c.1187T>C p.Leu396Ser missense variant moderate contig885 2073

IGV: Start, Jump



c.2256A>T p.Lys752Asn missense variant moderate contig885 3142

IGV: Start, Jump

PHL-2 c.575T>C p.Ile192Thr missense variant moderate contig2621 339568

IGV: Start, Jump

PHL-2 c.841A>T p.Ser281Cys missense variant moderate contig2621 340119

IGV: Start, Jump

PHL-2 c.1057A>G p.Arg353Gly missense variant moderate contig2621 340335

IGV: Start, Jump

PHL-2 c.1096G>A p.Ala366Thr missense variant moderate contig2621 340374

IGV: Start, Jump

PHL-2 c.1115T>G p.Val372Gly missense variant moderate contig2621 340393

IGV: Start, Jump

PHL-2 c.1166C>T p.Pro389Leu missense variant moderate contig2621 340444

IGV: Start, Jump

PHL-2 c.1577A>G p.His526Arg missense variant moderate contig2621 340855

IGV: Start, Jump

PHL-2 c.2783G>A p.Ser928Asn missense variant moderate contig2621 342826

IGV: Start, Jump

PHL-2 c.3373A>G p.Thr1125Ala missense variant moderate contig2621 343416

IGV: Start, Jump

PHL-2 c.3556_3557delAA p.Lys1186fs frameshift variant high contig2621 343598

IGV: Start, Jump



c.1191_1193delTTA p.Tyr398del disruptive inframe deletion moderate contig700 1938600

IGV: Start, Jump



c.948T>G p.Asp316Glu missense variant moderate contig700 1944442

IGV: Start, Jump



c.945T>G p.Ser315Arg missense variant moderate contig700 1944445

IGV: Start, Jump



c.944G>A p.Ser315Asn missense variant moderate contig700 1944446

IGV: Start, Jump



c.934C>G p.His312Asp missense variant moderate contig700 1944456

IGV: Start, Jump



c.1136G>A p.Arg379His missense variant moderate contig700 1950502

IGV: Start, Jump



c.496A>G p.Lys166Glu missense variant moderate contig700 2721177

IGV: Start, Jump



c.489delT p.Phe163fs frameshift variant high contig700 2721183

IGV: Start, Jump



c.485A>G p.Lys162Arg missense variant moderate contig700 2721188

IGV: Start, Jump



c.431T>G p.Val144Gly missense variant moderate contig700 2721242

IGV: Start, Jump



c.352_355delACAG p.Thr118fs frameshift variant high contig700 2721317

IGV: Start, Jump



c.323A>G p.Glu108Gly missense variant moderate contig700 2721350

IGV: Start, Jump



c.316+2T>A splice donor variant & intron variant high contig700 2723818

IGV: Start, Jump



c.229G>A p.Gly77Ser missense variant moderate contig700 2724206

IGV: Start, Jump



c.216G>C p.Leu72Phe missense variant moderate contig700 2724219

IGV: Start, Jump



c.206T>C p.Leu69Ser missense variant moderate contig700 2724229

IGV: Start, Jump



c.1319T>C p.Ile440Thr missense variant moderate contig380 285250

IGV: Start, Jump



c.260C>G p.Ser87Cys missense variant moderate contig931 118104

IGV: Start, Jump



c.220A>G p.Ile74Val missense variant moderate contig931 118144

IGV: Start, Jump



c.161T>A p.Leu54His missense variant moderate contig83 1803208

IGV: Start, Jump



c.1466G>A p.Ser489Asn missense variant moderate contig97 244297

IGV: Start, Jump



c.1630A>G p.Thr544Ala missense variant moderate contig97 244461

IGV: Start, Jump



c.1803_1805delTCA p.His601del disruptive inframe deletion moderate contig97 244625

IGV: Start, Jump



c.1966C>G p.Pro656Ala missense variant moderate contig97 244797

IGV: Start, Jump



c.2198G>T p.Arg733Leu missense variant moderate contig97 245029

IGV: Start, Jump



c.2216A>G p.His739Arg missense variant moderate contig97 245047

IGV: Start, Jump



c.439T>A p.Ser147Thr missense variant moderate contig121 2830634

IGV: Start, Jump



c.1168T>C p.Tyr390His missense variant moderate contig121 2833503

IGV: Start, Jump



c.220A>G p.Ile74Val missense variant moderate contig121 2835927

IGV: Start, Jump



c.82_93delGTAACCGGAACT p.Val28_Thr31del conservative inframe deletion moderate contig95 1989748

IGV: Start, Jump



c.133T>A p.Phe45Ile missense variant moderate contig81 209095

IGV: Start, Jump



c.311A>G p.Asn104Ser missense variant moderate contig81 209273

IGV: Start, Jump



c.331A>G p.Asn111Asp missense variant moderate contig81 209293

IGV: Start, Jump



c.368A>C p.His123Pro missense variant moderate contig81 209330

IGV: Start, Jump



c.374A>G p.His125Arg missense variant moderate contig81 209336

IGV: Start, Jump



c.1006A>G p.Lys336Glu missense variant moderate contig81 209968

IGV: Start, Jump



c.1090A>G p.Lys364Glu missense variant moderate contig81 210052

IGV: Start, Jump



c.1102C>A p.His368Asn missense variant moderate contig81 210064

IGV: Start, Jump



c.1118C>G p.Thr373Ser missense variant moderate contig81 210080

IGV: Start, Jump



c.1205C>T p.Ala402Val missense variant moderate contig81 210167

IGV: Start, Jump



c.1415G>A p.Ser472Asn missense variant moderate contig81 210377

IGV: Start, Jump



c.1417A>G p.Thr473Ala missense variant moderate contig81 210379

IGV: Start, Jump



c.1434G>T p.Glu478Asp missense variant moderate contig81 210396

IGV: Start, Jump



c.1451A>T p.Lys484Met missense variant moderate contig81 210413

IGV: Start, Jump



c.1541T>C p.Val514Ala missense variant moderate contig81 210503

IGV: Start, Jump



c.2978A>G p.Asn993Ser missense variant moderate contig1439 1486819

IGV: Start, Jump



c.2623A>G p.Thr875Ala missense variant moderate contig1439 1487174

IGV: Start, Jump



c.2551A>G p.Thr851Ala missense variant moderate contig1439 1487246

IGV: Start, Jump



c.1387A>G p.Thr463Ala missense variant moderate contig1439 1489811

IGV: Start, Jump



c.432T>A p.Asp144Glu missense variant moderate contig1439 1491416

IGV: Start, Jump



c.407G>A p.Arg136Gln missense variant moderate contig1439 1491441

IGV: Start, Jump



c.176G>A p.Gly59Glu missense variant moderate contig1439 1492817

IGV: Start, Jump



c.175G>A p.Gly59Arg missense variant moderate contig1439 1492818

IGV: Start, Jump



c.16T>C p.Ser6Pro missense variant moderate contig850 3065274

IGV: Start, Jump



c.1618A>G p.Ile540Val missense variant moderate contig1891 885936

IGV: Start, Jump



c.1378G>A p.Val460Ile missense variant moderate contig1891 886370

IGV: Start, Jump



c.136G>A p.Val46Ile missense variant moderate contig1891 889256

IGV: Start, Jump



c.56C>G p.Ala19Gly missense variant moderate contig1891 889336

IGV: Start, Jump



c.-108+1_-108+2insG splice donor variant & intron variant high contig1891 889975

IGV: Start, Jump



c.6623C>T p.Ala2208Val missense variant moderate contig1460 1184464

IGV: Start, Jump



c.5932A>G p.Ile1978Val missense variant moderate contig1460 1185552

IGV: Start, Jump



c.1872T>A p.Asp624Glu missense variant moderate contig1460 1190252

IGV: Start, Jump



c.1696G>A p.Val566Met missense variant moderate contig1460 1191534

IGV: Start, Jump



c.1683A>T p.Leu561Phe missense variant moderate contig1460 1191547

IGV: Start, Jump



c.1630G>C p.Ala544Pro missense variant moderate contig1460 1191600

IGV: Start, Jump



c.1318A>G p.Asn440Asp missense variant moderate contig1460 1192080

IGV: Start, Jump



c.1294G>A p.Asp432Asn missense variant moderate contig1460 1192104

IGV: Start, Jump



c.1289A>G p.Asp430Gly missense variant moderate contig1460 1192109

IGV: Start, Jump



c.1279G>A p.Val427Ile missense variant moderate contig1460 1192119

IGV: Start, Jump



c.710C>T p.Pro237Leu missense variant moderate contig1460 1193804

IGV: Start, Jump



c.706T>C p.Tyr236His missense variant moderate contig1460 1193808

IGV: Start, Jump



c.665+2T>A splice donor variant & intron variant high contig1460 1194391

IGV: Start, Jump



c.637T>A p.Ser213Thr missense variant moderate contig1460 1194421

IGV: Start, Jump



c.1772A>G p.Gln591Arg missense variant moderate contig954 3059929

IGV: Start, Jump



c.242A>G p.Lys81Arg missense variant moderate contig883 269731

IGV: Start, Jump



c.32_43dupATAATAATAATA p.Asn11_Asn14dup disruptive inframe insertion moderate contig1561 3124441

IGV: Start, Jump



c.20_43dupATAATAATAATAATAATAATAATA p.Asn7_Asn14dup disruptive inframe insertion moderate contig1561 3124441

IGV: Start, Jump



c.240C>G p.Asn80Lys missense variant moderate contig1561 3124664

IGV: Start, Jump



c.2981T>C p.Met994Thr missense variant moderate contig1450 2044012

IGV: Start, Jump



c.2962G>A p.Asp988Asn missense variant moderate contig1450 2044031

IGV: Start, Jump



c.2840A>G p.Asn947Ser missense variant moderate contig1450 2044192

IGV: Start, Jump



c.2585G>A p.Arg862Gln missense variant moderate contig1450 2045075

IGV: Start, Jump



c.729G>T p.Lys243Asn missense variant moderate contig976 1083125

IGV: Start, Jump



c.634G>C p.Gly212Arg missense variant moderate contig976 1083220

IGV: Start, Jump



c.487A>T p.Met163Leu missense variant moderate contig976 1083538

IGV: Start, Jump



c.467T>C p.Met156Thr missense variant moderate contig976 1083558

IGV: Start, Jump



c.416T>C p.Leu139Pro missense variant moderate contig976 1083609

IGV: Start, Jump



c.388G>A p.Gly130Ser missense variant moderate contig976 1083637

IGV: Start, Jump



c.382T>C p.Tyr128His missense variant moderate contig976 1083643

IGV: Start, Jump



c.327G>T p.Trp109Cys missense variant moderate contig976 1083698

IGV: Start, Jump



c.301A>T p.Thr101Ser missense variant moderate contig976 1083724

IGV: Start, Jump



c.293A>G p.Asp98Gly missense variant moderate contig976 1083732

IGV: Start, Jump



c.235A>C p.Lys79Gln missense variant & splice region variant moderate contig976 1083840

IGV: Start, Jump



c.218G>A p.Arg73Gln missense variant moderate contig976 1083857

IGV: Start, Jump



c.167A>G p.Glu56Gly missense variant moderate contig976 1083908

IGV: Start, Jump



c.158C>A p.Thr53Asn missense variant moderate contig976 1083917

IGV: Start, Jump



c.147G>T p.Gln49His missense variant moderate contig976 1083928

IGV: Start, Jump



c.127A>G p.Ile43Val missense variant moderate contig976 1083948

IGV: Start, Jump



c.125A>G p.Glu42Gly missense variant moderate contig976 1083950

IGV: Start, Jump



c.80C>T p.Thr27Ile missense variant moderate contig976 1083995

IGV: Start, Jump



c.79A>G p.Thr27Ala missense variant moderate contig976 1083996

IGV: Start, Jump



c.52G>A p.Gly18Ser missense variant moderate contig976 1084023

IGV: Start, Jump



c.48C>A p.Cys16* stop gained high contig976 1084027

IGV: Start, Jump



c.14C>T p.Ala5Val missense variant moderate contig976 1084061

IGV: Start, Jump



c.*340_*343-6delTATATATATATATATATAGA splice donor variant & splice region variant & 3 prime UTR variant & intron variant high contig510 71467

IGV: Start, Jump



c.418C>A p.Leu140Met missense variant moderate contig1225 2278688

IGV: Start, Jump



c.1066C>T p.Arg356Trp missense variant moderate contig1225 2281326

IGV: Start, Jump



c.1120G>A p.Asp374Asn missense variant moderate contig1225 2281380

IGV: Start, Jump



c.1222C>G p.Gln408Glu missense variant moderate contig1225 2281482

IGV: Start, Jump



c.1249G>T p.Val417Leu missense variant moderate contig1225 2281509

IGV: Start, Jump



c.1785A>T p.Leu595Phe missense variant moderate contig1225 2282213

IGV: Start, Jump



c.53A>G p.Asn18Ser missense variant moderate contig2282 549045

IGV: Start, Jump



c.376G>C p.Glu126Gln missense variant moderate contig2282 549368

IGV: Start, Jump



c.382C>T p.Leu128Phe missense variant moderate contig2282 549374

IGV: Start, Jump



c.456T>A p.His152Gln missense variant moderate contig2282 549448

IGV: Start, Jump



c.460G>A p.Asp154Asn missense variant moderate contig2282 549452

IGV: Start, Jump



c.704A>T p.His235Leu missense variant moderate contig2282 549696

IGV: Start, Jump



c.727T>C p.Tyr243His missense variant moderate contig2282 549719

IGV: Start, Jump



c.1946C>T p.Pro649Leu missense variant moderate contig93 3340053

IGV: Start, Jump


Nearest genetic relatives (All Samples)

0 0.092 0.183 0.275 0.367
clone distance sibling distance more distant
  1. 0.190 Tiger Tail 78 (RSP11619)
  2. 0.224 Squirrel Tail 31 (RSP11485)
  3. 0.230 Squirrel Tail 81 (RSP11622)
  4. 0.249 Tanao Sri-white 80 (RSP11621)
  5. 0.257 Tiger Tail 30 (RSP11484)
  6. 0.270 Tanao Sri-white 79 (RSP11620)
  7. 0.293 Tanao Sri 46 (RSP11486)
  8. 0.307 Rest (RSP11377)
  9. 0.320 Noetic OG (RSP11455)
  10. 0.323 Liberty Haze (RSP11000)
  11. 0.327 Recon (RSP10755)
  12. 0.327 Blueberry Cheesecake (RSP10684)
  13. 0.328 Lift (RSP11378)
  14. 0.331 Trump x Trump (RSP11466)
  15. 0.331 Queen Dream (RSP11291)
  16. 0.333 LEMONCAKE (RSP11340)
  17. 0.334 Doug s Varin (RSP11243)
  18. 0.334 Carmagnola (RSP10982)
  19. 0.335 80E (RSP11212)
  20. 0.336 Blue Dream (RSP11010)

Nearest genetic relatives (Base Tree)

0 0.100 0.200 0.300 0.400
clone distance sibling distance more distant
  1. 0.347 Liberty Haze (RSP11000)
  2. 0.347 KYRG-11 (RSP11051)
  3. 0.347 Jiangji (RSP10653)
  4. 0.349 Blueberry Cheesecake (RSP10684)
  5. 0.350 Tisza (RSP11044)
  6. 0.355 Kyrgyz Gold (RSP11054)
  7. 0.363 Carmagnola (RSP11037)
  8. 0.364 Tygra (RSP10667)
  9. 0.364 Feral (RSP10890)
  10. 0.370 Recon (RSP10755)
  11. 0.371 Tisza (RSP10659)
  12. 0.372 RKM-2018-031 (RSP11123)
  13. 0.374 Kimbo Slice (RSP10997)
  14. 0.376 Fedora 17 (RSP10661)
  15. 0.378 USO 31 (RSP10981)
  16. 0.380 Lovrin (RSP10658)
  17. 0.382 Monoica (RSP10241)
  18. 0.386 QUEEN JESUS (RSP10105)
  19. 0.387 Futura 75 (RSP10664)
  20. 0.392 Santhica27 (RSP11047)

Most genetically distant strains (All Samples)

0 0.158 0.317 0.475 0.633
clone distance sibling distance more distant
  1. 0.620 JL 4th Gen 2 (RSP11194)
  2. 0.588 JL 4th Gen 5 (RSP11199)
  3. 0.583 JL 3rd Gen Father (RSP11196)
  4. 0.567 JL 4th Gen 4 (RSP11198)
  5. 0.566 JL 4th Gen 1 (RSP11193)
  6. 0.553 JL 3rd Gen Mother (RSP11214)
  7. 0.539 JL yellow (RSP11075)
  8. 0.534 JL Compost (RSP11657)
  9. 0.511 JL 2 (RSP11076)
  10. 0.505 JL 3rd Gen Mother (RSP11197)
  11. 0.502 JL 4th Gen 3 (RSP11195)
  12. 0.502 JL 4th Gen 6 (RSP11200)
  13. 0.499 RKM-2018-023 (RSP11115)
  14. 0.496 Dave Pineapple (RSP11626)
  15. 0.492 Skunk 18 (RSP11030)
  16. 0.489 BlueBerry Cheesecake x JL Male (RSP11201)
  17. 0.485 Skunk 18 (RSP11038)
  18. 0.478 JL Tent 2 (RSP11489)
  19. 0.475 RKM-2018-007 (RSP11098)
  20. 0.474 Ringo s Gift Katie s Cut (RSP11624)

Most genetically distant strains (Base Tree)

0 0.142 0.283 0.425 0.567
clone distance sibling distance more distant
  1. 0.548 JL yellow (RSP11075)
  2. 0.517 Skunk 18 (RSP11038)
  3. 0.487 RKM-2018-023 (RSP11115)
  4. 0.484 Blueberry Cheesecake (RSP10672)
  5. 0.474 Cbot-2019-005 (RSP11133)
  6. 0.472 RKM-2018-006 (RSP11097)
  7. 0.471 RKM-2018-027 (RSP11119)
  8. 0.456 Kush Hemp E1 (RSP11128)
  9. 0.447 Blue Dream (RSP11033)
  10. 0.447 Golden Goat 2 (RSP10991)
  11. 0.446 RKM-2018-009 (RSP11100)
  12. 0.444 Sour Raspberry (RSP10551)
  13. 0.444 RKM-2018-022 (RSP11114)
  14. 0.442 Cherry (RSP11143)
  15. 0.441 RKM-2018-033 (RSP11125)
  16. 0.439 Blueberry Cheesecake (RSP10680)
  17. 0.439 Ivory (RSP10668)
  18. 0.438 RKM-2018-005 (RSP11096)
  19. 0.438 Cherry (RSP11142)
  20. 0.436 RKM-2018-018 (RSP11110)

Nearest genetic relative in Phylos dataset

Phylos Strain SRR4448688
Overlapping SNPs:

Nearest genetic relative in Lynch dataset

Lynch Strain SRR3495193
Overlapping SNPs:

Blockchain Registration Information

QR code for RSP11658

Kannapedia uses cookies

By clicking Allow All, you agree to the storing of cookies on your device to enhance site navigation, analyze site usage, and assist in our marketing efforts.

Customize Settings