CS Indica

RSP 11659

Grower: Medicinal Plant Research Institute

General Information

Accession Date
November 1, 2020
Reported Plant Sex
unknown

The strain rarity visualization shows how distant the strain is from the other cultivars in the Kannapedia database. The y-axis represents genetic distance, getting farther as you go up. The width of the visualization at any position along the y-axis shows how many strains there are in the database at that genetic distance. So, a common strain will have a more bottom-heavy shape, while uncommon and rare cultivars will have a visualization that is generally shifted towards the top.

Rarity: Rare
Most Distant Most Similar

Chemical Information

Cannabinoid and terpenoid information provided by the grower.

Cannabinoids

No information provided.

Terpenoids

No information provided.

Genetic Information

Plant Type
Type II

The bell curve in the heterozygosity visualization shows the distribution of heterozygosity levels for cannabis cultivars in the Kannapedia database. The green line shows where this particular strain fits within the distribution. Heterozygosity is associated with heterosis (aka hybrid vigor) but also leads to the production of more variable offspring. When plants have two genetically different parents, heterozygosity levels will be higher than if it has been inbred or backcrossed repeatedly.

Heterozygosity: 1.14%
Least Heterozygous Most Heterozygous

The ratio of reads mapped to Y-contigs to reads mapped to the whole Cannabis genome (Y-ratios) has been demonstrated to be strongly correlated with plant sex typing. This plot shows the distribution of Y-ratios for all samples in our database which were sequenced with the same method (panel or WGS) as this sample and where this sample falls in the distribution.

Y-Ratio Distribution: 0.0250
male female RSP11659

This chart represents the Illumina sequence coverage over the Bt/Bd allele. These are the three regions in the cannabis genome that impact THCA, CBDA, CBGA production. Coverage over the Active CBDAS gene is highly correlated with Type II and Type III plants as described by Etienne de Meijer. Coverage over the THCA gene is highly correlated with Type I and Type II plants but is anti-correlated with Type III plants. Type I plants require coverage over the inactive CBDA loci and no coverage over the Active CBDA gene. Lack of coverage over the Active CBDA and Active THCA allele are presumed to be Type IV plants (CBGA dominant). While deletions of entire THCAS and CBDAS genes are the most common Bt:Bd alleles observed, it is possible to have plants with these genes where functional expression of the enzyme is disrupted by deactivating point mutations (Kojoma et al. 2006).

Bt/Bd Allele Coverage

This chart represents the Illumina sequence coverage over the CBCA synthase gene.

CBCAS Coverage

Variants (THCAS, CBDAS, and CBCAS)

THCAS c.1229G>A p.Gly410Glu missense variant moderate contig741 4416599

IGV: Start, Jump

C/T
NGS:
0.039
C90:
0.000
THCAS c.749C>A p.Ala250Asp missense variant moderate contig741 4417079

IGV: Start, Jump

G/T
NGS:
0.127
C90:
0.632
THCAS c.373G>C p.Val125Leu missense variant moderate contig741 4417455

IGV: Start, Jump

C/G
NGS:
0.050
C90:
0.000

Variants (Select Genes of Interest)

GPPs1

UniProt

c.845_848delAAAG p.Glu282fs frameshift variant high contig676 169629

IGV: Start, Jump

TGAAA/T
NGS:
0.118
C90:
0.000
GPPs1

UniProt

c.896A>G p.Asn299Ser missense variant moderate contig676 169772

IGV: Start, Jump

A/G
NGS:
0.046
C90:
0.000
EMF1-2

UniProt

c.710A>C p.His237Pro missense variant moderate contig885 810

IGV: Start, Jump

A/C
NGS:
0.090
C90:
0.474
PHL-2 c.455A>C p.Asp152Ala missense variant moderate contig2621 339191

IGV: Start, Jump

A/C
NGS:
0.018
C90:
0.507
PHL-2 c.575T>C p.Ile192Thr missense variant moderate contig2621 339568

IGV: Start, Jump

T/C
NGS:
0.009
C90:
0.000
PHL-2 c.841A>T p.Ser281Cys missense variant moderate contig2621 340119

IGV: Start, Jump

A/T
NGS:
0.011
C90:
0.000
PHL-2 c.1057A>G p.Arg353Gly missense variant moderate contig2621 340335

IGV: Start, Jump

A/G
NGS:
0.096
C90:
0.555
PHL-2 c.1096G>A p.Ala366Thr missense variant moderate contig2621 340374

IGV: Start, Jump

G/A
NGS:
0.090
C90:
0.531
PHL-2 c.1115T>G p.Val372Gly missense variant moderate contig2621 340393

IGV: Start, Jump

T/G
NGS:
0.007
C90:
0.000
PHL-2 c.1166C>T p.Pro389Leu missense variant moderate contig2621 340444

IGV: Start, Jump

C/T
NGS:
0.011
C90:
0.057
PHL-2 c.1577A>G p.His526Arg missense variant moderate contig2621 340855

IGV: Start, Jump

A/G
NGS:
0.009
C90:
0.000
PHL-2 c.2564T>A p.Phe855Tyr missense variant moderate contig2621 342607

IGV: Start, Jump

T/A
NGS:
0.064
C90:
0.732
PHL-2 c.2578T>A p.Leu860Ile missense variant moderate contig2621 342621

IGV: Start, Jump

T/A
NGS:
0.068
C90:
0.746
PHL-2 c.2756A>C p.Glu919Ala missense variant moderate contig2621 342799

IGV: Start, Jump

A/C
NGS:
0.064
C90:
0.675
PHL-2 c.2783G>A p.Ser928Asn missense variant moderate contig2621 342826

IGV: Start, Jump

G/A
NGS:
0.107
C90:
0.890
PHL-2 c.2830A>G p.Asn944Asp missense variant moderate contig2621 342873

IGV: Start, Jump

A/G
NGS:
0.018
C90:
0.000
PHL-2 c.2903_2905dupGCA p.Ser968dup disruptive inframe insertion moderate contig2621 342939

IGV: Start, Jump

T/TGCA
NGS:
0.018
C90:
0.522
PHL-2 c.3209A>G p.Gln1070Arg missense variant moderate contig2621 343252

IGV: Start, Jump

A/G
NGS:
0.103
C90:
0.885
PHL-2 c.3373A>G p.Thr1125Ala missense variant moderate contig2621 343416

IGV: Start, Jump

A/G
NGS:
0.009
C90:
0.110
PHL-2 c.3467A>G p.Gln1156Arg missense variant moderate contig2621 343510

IGV: Start, Jump

A/G
NGS:
0.064
C90:
0.713
PHL-2 c.3552delG p.Lys1185fs frameshift variant high contig2621 343593

IGV: Start, Jump

CG/C
NGS:
0.004
C90:
0.000
PHL-2 c.3556_3557delAA p.Lys1186fs frameshift variant high contig2621 343598

IGV: Start, Jump

GAA/G
NGS:
0.013
C90:
0.096
PKSG-2a

UniProt

c.774G>A p.Met258Ile missense variant moderate contig700 1944616

IGV: Start, Jump

C/T
NGS:
0.123
C90:
0.000
PKSG-2a

UniProt

c.67T>A p.Phe23Ile missense variant moderate contig700 1945567

IGV: Start, Jump

A/T
NGS:
0.825
C90:
0.904
PKSG-2b

UniProt

c.1152T>A p.Asn384Lys missense variant moderate contig700 1950486

IGV: Start, Jump

A/T
NGS:
0.715
C90:
0.895
PKSG-2b

UniProt

c.1132C>G p.Leu378Val missense variant moderate contig700 1950506

IGV: Start, Jump

G/C
NGS:
0.717
C90:
0.000
PKSG-2b

UniProt

c.1117A>G p.Ile373Val missense variant moderate contig700 1950521

IGV: Start, Jump

T/C
NGS:
0.807
C90:
0.981
PKSG-2b

UniProt

c.948T>G p.Asp316Glu missense variant moderate contig700 1950690

IGV: Start, Jump

A/C
NGS:
0.456
C90:
0.000
PKSG-2b

UniProt

c.945T>G p.Ser315Arg missense variant moderate contig700 1950693

IGV: Start, Jump

A/C
NGS:
0.454
C90:
0.000
PKSG-2b

UniProt

c.944G>A p.Ser315Asn missense variant moderate contig700 1950694

IGV: Start, Jump

C/T
NGS:
0.445
C90:
0.000
PKSG-2b

UniProt

c.934C>G p.His312Asp missense variant moderate contig700 1950704

IGV: Start, Jump

G/C
NGS:
0.410
C90:
0.000
PKSG-2b

UniProt

c.774G>A p.Met258Ile missense variant moderate contig700 1950864

IGV: Start, Jump

C/T
NGS:
0.366
C90:
0.947
PKSG-2b

UniProt

c.31A>T p.Thr11Ser missense variant moderate contig700 1951851

IGV: Start, Jump

T/A
NGS:
0.844
C90:
0.880
PKSG-2b

UniProt

c.-2_1dupATA start lost & conservative inframe insertion high contig700 1951880

IGV: Start, Jump

A/ATAT
NGS:
0.410
C90:
0.000
PKSG-4b

UniProt

c.496A>G p.Lys166Glu missense variant moderate contig700 2721177

IGV: Start, Jump

T/C
NGS:
0.651
C90:
0.684
PKSG-4b

UniProt

c.489delT p.Phe163fs frameshift variant high contig700 2721183

IGV: Start, Jump

CA/C
NGS:
0.792
C90:
0.761
PKSG-4b

UniProt

c.485A>G p.Lys162Arg missense variant moderate contig700 2721188

IGV: Start, Jump

T/C
NGS:
0.643
C90:
0.301
PKSG-4b

UniProt

c.431T>G p.Val144Gly missense variant moderate contig700 2721242

IGV: Start, Jump

A/C
NGS:
0.575
C90:
0.679
PKSG-4b

UniProt

c.419A>G p.Asp140Gly missense variant moderate contig700 2721254

IGV: Start, Jump

T/C
NGS:
0.430
C90:
0.440
PKSG-4b

UniProt

c.352_355delACAG p.Thr118fs frameshift variant high contig700 2721317

IGV: Start, Jump

CCTGT/C
NGS:
0.529
C90:
0.000
PKSG-4b

UniProt

c.323A>G p.Glu108Gly missense variant moderate contig700 2721350

IGV: Start, Jump

T/C
NGS:
0.469
C90:
0.000
PKSG-4b

UniProt

c.316+2T>A splice donor variant & intron variant high contig700 2723818

IGV: Start, Jump

A/T
NGS:
0.070
C90:
0.689
PKSG-4b

UniProt

c.238T>C p.Phe80Leu missense variant moderate contig700 2724197

IGV: Start, Jump

A/G
NGS:
0.013
C90:
0.000
PKSG-4b

UniProt

c.229G>A p.Gly77Ser missense variant moderate contig700 2724206

IGV: Start, Jump

C/T
NGS:
0.042
C90:
0.000
PKSG-4b

UniProt

c.216G>C p.Leu72Phe missense variant moderate contig700 2724219

IGV: Start, Jump

C/G
NGS:
0.044
C90:
0.000
PKSG-4b

UniProt

c.206T>C p.Leu69Ser missense variant moderate contig700 2724229

IGV: Start, Jump

A/G
NGS:
0.044
C90:
0.000
DXR-2

UniProt

c.1319T>C p.Ile440Thr missense variant moderate contig380 285250

IGV: Start, Jump

A/G
NGS:
0.480
C90:
0.000
OAC-2

UniProt

c.260C>G p.Ser87Cys missense variant moderate contig931 109979

IGV: Start, Jump

G/C
NGS:
0.070
C90:
0.000
OAC-1

UniProt

c.260C>G p.Ser87Cys missense variant moderate contig931 118104

IGV: Start, Jump

G/C
NGS:
0.053
C90:
0.000
OAC-1

UniProt

c.220A>G p.Ile74Val missense variant moderate contig931 118144

IGV: Start, Jump

T/C
NGS:
0.033
C90:
0.670
OAC-1

UniProt

c.185C>T p.Thr62Ile missense variant moderate contig931 118179

IGV: Start, Jump

G/A
NGS:
0.039
C90:
0.000
ELF3

UniProt

c.574A>G p.Asn192Asp missense variant moderate contig97 242280

IGV: Start, Jump

A/G
NGS:
0.042
C90:
0.579
ELF3

UniProt

c.772A>G p.Ser258Gly missense variant moderate contig97 242478

IGV: Start, Jump

A/G
NGS:
0.112
C90:
0.000
ELF3

UniProt

c.812G>C p.Gly271Ala missense variant moderate contig97 242518

IGV: Start, Jump

G/C
NGS:
0.114
C90:
0.938
ELF3

UniProt

c.1466G>A p.Ser489Asn missense variant moderate contig97 244297

IGV: Start, Jump

G/A
NGS:
0.123
C90:
0.000
ELF3

UniProt

c.1630A>G p.Thr544Ala missense variant moderate contig97 244461

IGV: Start, Jump

A/G
NGS:
0.103
C90:
0.545
ELF3

UniProt

c.1803_1805delTCA p.His601del disruptive inframe deletion moderate contig97 244625

IGV: Start, Jump

ACAT/A
NGS:
0.092
C90:
0.000
ELF3

UniProt

c.1966C>G p.Pro656Ala missense variant moderate contig97 244797

IGV: Start, Jump

C/G
NGS:
0.123
C90:
0.632
ELF3

UniProt

c.2198G>T p.Arg733Leu missense variant moderate contig97 245029

IGV: Start, Jump

G/T
NGS:
0.125
C90:
0.531
ELF3

UniProt

c.2216A>G p.His739Arg missense variant moderate contig97 245047

IGV: Start, Jump

A/G
NGS:
0.020
C90:
0.182
aPT4

UniProt

c.80A>G p.Lys27Arg missense variant moderate contig121 2828736

IGV: Start, Jump

A/G
NGS:
0.061
C90:
0.000
aPT4

UniProt

c.202T>A p.Leu68Ile missense variant moderate contig121 2828858

IGV: Start, Jump

T/A
NGS:
0.068
C90:
0.000
aPT1

UniProt

c.406A>G p.Ile136Val missense variant moderate contig121 2839605

IGV: Start, Jump

A/G
NGS:
0.579
C90:
0.761
HDS-2

UniProt

c.151G>T p.Ala51Ser missense variant moderate contig95 1989818

IGV: Start, Jump

G/T
NGS:
0.011
C90:
0.000
AAE1-2

UniProt

c.331A>G p.Asn111Asp missense variant moderate contig81 209293

IGV: Start, Jump

A/G
NGS:
0.123
C90:
0.000
AAE1-2

UniProt

c.948_949insA p.Asp317fs frameshift variant high contig81 209910

IGV: Start, Jump

C/CA
NGS:
0.050
C90:
0.000
AAE1-2

UniProt

c.952delC p.Gln318fs frameshift variant high contig81 209912

IGV: Start, Jump

AC/A
NGS:
0.050
C90:
0.000
AAE1-2

UniProt

c.953A>G p.Gln318Arg missense variant moderate contig81 209915

IGV: Start, Jump

A/G
NGS:
0.050
C90:
0.000
AAE1-2

UniProt

c.955C>T p.Arg319Cys missense variant moderate contig81 209917

IGV: Start, Jump

C/T
NGS:
0.050
C90:
0.000
AAE1-2

UniProt

c.1006A>G p.Lys336Glu missense variant moderate contig81 209968

IGV: Start, Jump

A/G
NGS:
0.116
C90:
0.000
AAE1-2

UniProt

c.1102C>A p.His368Asn missense variant moderate contig81 210064

IGV: Start, Jump

C/A
NGS:
0.033
C90:
0.000
AAE1-2

UniProt

c.1415G>A p.Ser472Asn missense variant moderate contig81 210377

IGV: Start, Jump

G/A
NGS:
0.070
C90:
0.000
AAE1-2

UniProt

c.1417A>G p.Thr473Ala missense variant moderate contig81 210379

IGV: Start, Jump

A/G
NGS:
0.070
C90:
0.000
AAE1-2

UniProt

c.1434G>T p.Glu478Asp missense variant moderate contig81 210396

IGV: Start, Jump

G/T
NGS:
0.075
C90:
0.000
AAE1-2

UniProt

c.1541T>C p.Val514Ala missense variant moderate contig81 210503

IGV: Start, Jump

T/C
NGS:
0.050
C90:
0.000
PHL-1

UniProt

c.3003_3020delACAGCAACAGCAGCAGCA p.Gln1002_Gln1007del disruptive inframe deletion moderate contig1439 1486776

IGV: Start, Jump

CTGCTGCTGCTGTTGCTGT/C
NGS:
0.007
C90:
0.000
PHL-1

UniProt

c.2623A>G p.Thr875Ala missense variant moderate contig1439 1487174

IGV: Start, Jump

T/C
NGS:
0.123
C90:
0.000
PHL-1

UniProt

c.2551A>G p.Thr851Ala missense variant moderate contig1439 1487246

IGV: Start, Jump

T/C
NGS:
0.116
C90:
0.890
PHL-1

UniProt

c.1387A>G p.Thr463Ala missense variant moderate contig1439 1489811

IGV: Start, Jump

T/C
NGS:
0.107
C90:
0.904
Edestin

UniProt

c.16T>C p.Ser6Pro missense variant moderate contig850 3065274

IGV: Start, Jump

A/G
NGS:
0.059
C90:
0.000
HDS-1

UniProt

c.2141G>C p.Gly714Ala missense variant moderate contig1891 884225

IGV: Start, Jump

C/G
NGS:
0.018
C90:
0.000
HDS-1

UniProt

c.1618A>G p.Ile540Val missense variant moderate contig1891 885936

IGV: Start, Jump

T/C
NGS:
0.099
C90:
0.861
HDS-1

UniProt

c.1378G>A p.Val460Ile missense variant moderate contig1891 886370

IGV: Start, Jump

C/T
NGS:
0.167
C90:
0.000
HDS-1

UniProt

c.56C>G p.Ala19Gly missense variant moderate contig1891 889336

IGV: Start, Jump

G/C
NGS:
0.125
C90:
0.943
HDS-1

UniProt

c.-108+1_-108+2insG splice donor variant & intron variant high contig1891 889975

IGV: Start, Jump

A/AC
NGS:
0.217
C90:
0.000
FAD2

UniProt

c.1115G>T p.Gly372Val missense variant moderate contig1460 1083145

IGV: Start, Jump

C/A
NGS:
0.004
C90:
0.000
PIE1-2

UniProt

c.6653A>G p.Asn2218Ser missense variant moderate contig1460 1184434

IGV: Start, Jump

T/C
NGS:
0.059
C90:
0.928
PIE1-2

UniProt

c.5932A>G p.Ile1978Val missense variant moderate contig1460 1185552

IGV: Start, Jump

T/C
NGS:
0.061
C90:
0.268
PIE1-2

UniProt

c.1872T>A p.Asp624Glu missense variant moderate contig1460 1190252

IGV: Start, Jump

A/T
NGS:
0.086
C90:
0.990
PIE1-2

UniProt

c.1656T>G p.Asn552Lys missense variant moderate contig1460 1191574

IGV: Start, Jump

A/C
NGS:
0.009
C90:
0.043
PIE1-2

UniProt

c.1630G>C p.Ala544Pro missense variant moderate contig1460 1191600

IGV: Start, Jump

C/G
NGS:
0.070
C90:
0.933
PIE1-2

UniProt

c.710C>T p.Pro237Leu missense variant moderate contig1460 1193804

IGV: Start, Jump

G/A
NGS:
0.072
C90:
0.866
PIE1-2

UniProt

c.706T>C p.Tyr236His missense variant moderate contig1460 1193808

IGV: Start, Jump

A/G
NGS:
0.059
C90:
0.737
PIE1-2

UniProt

c.665+2T>A splice donor variant & intron variant high contig1460 1194391

IGV: Start, Jump

A/T
NGS:
0.009
C90:
0.000
PIE1-2

UniProt

c.637T>A p.Ser213Thr missense variant moderate contig1460 1194421

IGV: Start, Jump

A/T
NGS:
0.079
C90:
0.885
EMF2

UniProt

c.434C>T p.Ser145Phe missense variant moderate contig954 3049270

IGV: Start, Jump

C/T
NGS:
0.018
C90:
0.057
EMF2

UniProt

c.1772A>G p.Gln591Arg missense variant moderate contig954 3059929

IGV: Start, Jump

A/G
NGS:
0.092
C90:
0.876
FT

UniProt

c.13C>G p.Leu5Val missense variant moderate contig1561 3124437

IGV: Start, Jump

C/G
NGS:
0.031
C90:
0.153
FT

UniProt

c.35_43dupATAATAATA p.Asn12_Asn14dup disruptive inframe insertion moderate contig1561 3124441

IGV: Start, Jump

T/TTAATAATAA
NGS:
0.048
C90:
0.000
FLD

UniProt

c.2981T>C p.Met994Thr missense variant moderate contig1450 2044012

IGV: Start, Jump

A/G
NGS:
0.064
C90:
0.478
FLD

UniProt

c.2962G>A p.Asp988Asn missense variant moderate contig1450 2044031

IGV: Start, Jump

C/T
NGS:
0.009
C90:
0.000
FLD

UniProt

c.2840A>G p.Asn947Ser missense variant moderate contig1450 2044192

IGV: Start, Jump

T/C
NGS:
0.007
C90:
0.000
FLD

UniProt

c.2585G>A p.Arg862Gln missense variant moderate contig1450 2045075

IGV: Start, Jump

C/T
NGS:
0.007
C90:
0.000
AAE1-3

UniProt

c.722G>A p.Arg241Lys missense variant moderate contig976 1083132

IGV: Start, Jump

C/T
NGS:
0.070
C90:
0.000
AAE1-3

UniProt

c.667G>A p.Val223Ile missense variant moderate contig976 1083187

IGV: Start, Jump

C/T
NGS:
0.048
C90:
0.000
AAE1-3

UniProt

c.659G>A p.Arg220Gln missense variant moderate contig976 1083195

IGV: Start, Jump

C/T
NGS:
0.077
C90:
0.000
AAE1-3

UniProt

c.634G>C p.Gly212Arg missense variant moderate contig976 1083220

IGV: Start, Jump

C/G
NGS:
0.116
C90:
0.000
AAE1-3

UniProt

c.475G>A p.Gly159Arg missense variant moderate contig976 1083550

IGV: Start, Jump

C/T
NGS:
0.048
C90:
0.000
AAE1-3

UniProt

c.416T>C p.Leu139Pro missense variant moderate contig976 1083609

IGV: Start, Jump

A/G
NGS:
0.061
C90:
0.000
AAE1-3

UniProt

c.382T>C p.Tyr128His missense variant moderate contig976 1083643

IGV: Start, Jump

A/G
NGS:
0.072
C90:
0.000
AAE1-3

UniProt

c.296C>T p.Pro99Leu missense variant moderate contig976 1083729

IGV: Start, Jump

G/A
NGS:
0.046
C90:
0.000
AAE1-3

UniProt

c.293A>G p.Asp98Gly missense variant moderate contig976 1083732

IGV: Start, Jump

T/C
NGS:
0.068
C90:
0.000
AAE1-3

UniProt

c.284A>T p.Glu95Val missense variant moderate contig976 1083741

IGV: Start, Jump

T/A
NGS:
0.053
C90:
0.000
AAE1-3

UniProt

c.199A>G p.Asn67Asp missense variant moderate contig976 1083876

IGV: Start, Jump

T/C
NGS:
0.079
C90:
0.000
AAE1-3

UniProt

c.188A>G p.Asn63Ser missense variant moderate contig976 1083887

IGV: Start, Jump

T/C
NGS:
0.077
C90:
0.000
AAE1-3

UniProt

c.181G>A p.Val61Ile missense variant moderate contig976 1083894

IGV: Start, Jump

C/T
NGS:
0.055
C90:
0.000
AAE1-3

UniProt

c.167A>G p.Glu56Gly missense variant moderate contig976 1083908

IGV: Start, Jump

T/C
NGS:
0.070
C90:
0.000
AAE1-3

UniProt

c.125A>G p.Glu42Gly missense variant moderate contig976 1083950

IGV: Start, Jump

T/C
NGS:
0.064
C90:
0.000
AAE1-3

UniProt

c.79A>G p.Thr27Ala missense variant moderate contig976 1083996

IGV: Start, Jump

T/C
NGS:
0.068
C90:
0.000
AAE1-3

UniProt

c.52G>A p.Gly18Ser missense variant moderate contig976 1084023

IGV: Start, Jump

C/T
NGS:
0.064
C90:
0.000
AAE1-3

UniProt

c.3G>A p.Met1? start lost high contig976 1084072

IGV: Start, Jump

C/T
NGS:
0.046
C90:
0.416
FAD7A-1

UniProt

c.*340_*343-6delTATATATATATATATATAGA splice donor variant & splice region variant & 3 prime UTR variant & intron variant high contig510 71467

IGV: Start, Jump

CTATATATATATATATATAGA/C
NGS:
0.004
C90:
0.000
PIE1-1

UniProt

c.1124_1153dupATGTGGGTGAACCAACCCAGATGGAGGATA p.Asn375_Asp384dup disruptive inframe insertion moderate contig1225 2281360

IGV: Start, Jump

A/ATGAACCAACCCAGATGGAGGATAATGTGGG
NGS:
0.011
C90:
0.000
PIE1-1

UniProt

c.1222C>G p.Gln408Glu missense variant moderate contig1225 2281482

IGV: Start, Jump

C/G
NGS:
0.096
C90:
0.852
PIE1-1

UniProt

c.1758T>G p.Asn586Lys missense variant moderate contig1225 2282186

IGV: Start, Jump

T/G
NGS:
0.007
C90:
0.043
GGR

UniProt

c.704A>T p.His235Leu missense variant moderate contig2282 549696

IGV: Start, Jump

A/T
NGS:
0.121
C90:
0.000
PKSB-3

UniProt

c.1652A>G p.Glu551Gly missense variant moderate contig93 3339759

IGV: Start, Jump

A/G
NGS:
0.088
C90:
0.000

Nearest genetic relative in Phylos dataset

Phylos Strain SRR8347163
Overlapping SNPs:
34
Concordance:
22

Nearest genetic relative in Lynch dataset

Lynch Strain SRR3495226
Overlapping SNPs:
2
Concordance:
2

Blockchain Registration Information

SHASUM Hash
01e5e5303c6944a7fe935044e9988d5a9a03e082c75efcc61014d7d6a5f8b5f8
QR code for RSP11659

Kannapedia uses cookies

By clicking Allow All, you agree to the storing of cookies on your device to enhance site navigation, analyze site usage, and assist in our marketing efforts.

Customize Settings