CS Indica

RSP 11659

Grower: Medicinal Plant Research Institute

General Information

Accession Date
November 1, 2020
Reported Plant Sex
not reported

The strain rarity visualization shows how distant the strain is from the other cultivars in the Kannapedia database. The y-axis represents genetic distance, getting farther as you go up. The width of the visualization at any position along the y-axis shows how many strains there are in the database at that genetic distance. So, a common strain will have a more bottom-heavy shape, while uncommon and rare cultivars will have a visualization that is generally shifted towards the top.

Rarity: Rare
Most Distant Most Similar

Chemical Information

Cannabinoid and terpenoid information provided by the grower.


No information provided.


No information provided.

Genetic Information

Plant Type
Type II

The bell curve in the heterozygosity visualization shows the distribution of heterozygosity levels for cannabis cultivars in the Kannapedia database. The green line shows where this particular strain fits within the distribution. Heterozygosity is associated with heterosis (aka hybrid vigor) but also leads to the production of more variable offspring. When plants have two genetically different parents, heterozygosity levels will be higher than if it has been inbred or backcrossed repeatedly.

Heterozygosity: 1.14%
Least Heterozygous Most Heterozygous

The ratio of reads mapped to Y-contigs to reads mapped to the whole Cannabis genome (Y-ratios) has been demonstrated to be strongly correlated with plant sex typing. This plot shows the distribution of Y-ratios for all samples in our database which were sequenced with the same method (panel or WGS) as this sample and where this sample falls in the distribution.

Y-Ratio Distribution: 0.0250
male female RSP11659

This chart represents the Illumina sequence coverage over the Bt/Bd allele. These are the three regions in the cannabis genome that impact THCA, CBDA, CBGA production. Coverage over the Active CBDAS gene is highly correlated with Type II and Type III plants as described by Etienne de Meijer. Coverage over the THCA gene is highly correlated with Type I and Type II plants but is anti-correlated with Type III plants. Type I plants require coverage over the inactive CBDA loci and no coverage over the Active CBDA gene. Lack of coverage over the Active CBDA and Active THCA allele are presumed to be Type IV plants (CBGA dominant). While deletions of entire THCAS and CBDAS genes are the most common Bt:Bd alleles observed, it is possible to have plants with these genes where functional expression of the enzyme is disrupted by deactivating point mutations (Kojoma et al. 2006).

Bt/Bd Allele Coverage

This chart represents the Illumina sequence coverage over the CBCA synthase gene.

CBCAS Coverage

Variants (THCAS, CBDAS, and CBCAS)

THCAS c.1229G>A p.Gly410Glu missense variant moderate contig741 4416599

IGV: Start, Jump

THCAS c.749C>A p.Ala250Asp missense variant moderate contig741 4417079

IGV: Start, Jump

THCAS c.373G>C p.Val125Leu missense variant moderate contig741 4417455

IGV: Start, Jump


Variants (Select Genes of Interest)



c.845_848delAAAG p.Glu282fs frameshift variant high contig676 169629

IGV: Start, Jump



c.896A>G p.Asn299Ser missense variant moderate contig676 169772

IGV: Start, Jump



c.710A>C p.His237Pro missense variant moderate contig885 810

IGV: Start, Jump

PHL-2 c.455A>C p.Asp152Ala missense variant moderate contig2621 339191

IGV: Start, Jump

PHL-2 c.575T>C p.Ile192Thr missense variant moderate contig2621 339568

IGV: Start, Jump

PHL-2 c.841A>T p.Ser281Cys missense variant moderate contig2621 340119

IGV: Start, Jump

PHL-2 c.1057A>G p.Arg353Gly missense variant moderate contig2621 340335

IGV: Start, Jump

PHL-2 c.1096G>A p.Ala366Thr missense variant moderate contig2621 340374

IGV: Start, Jump

PHL-2 c.1115T>G p.Val372Gly missense variant moderate contig2621 340393

IGV: Start, Jump

PHL-2 c.1166C>T p.Pro389Leu missense variant moderate contig2621 340444

IGV: Start, Jump

PHL-2 c.1577A>G p.His526Arg missense variant moderate contig2621 340855

IGV: Start, Jump

PHL-2 c.2564T>A p.Phe855Tyr missense variant moderate contig2621 342607

IGV: Start, Jump

PHL-2 c.2578T>A p.Leu860Ile missense variant moderate contig2621 342621

IGV: Start, Jump

PHL-2 c.2756A>C p.Glu919Ala missense variant moderate contig2621 342799

IGV: Start, Jump

PHL-2 c.2783G>A p.Ser928Asn missense variant moderate contig2621 342826

IGV: Start, Jump

PHL-2 c.2830A>G p.Asn944Asp missense variant moderate contig2621 342873

IGV: Start, Jump

PHL-2 c.2903_2905dupGCA p.Ser968dup disruptive inframe insertion moderate contig2621 342939

IGV: Start, Jump

PHL-2 c.3209A>G p.Gln1070Arg missense variant moderate contig2621 343252

IGV: Start, Jump

PHL-2 c.3373A>G p.Thr1125Ala missense variant moderate contig2621 343416

IGV: Start, Jump

PHL-2 c.3467A>G p.Gln1156Arg missense variant moderate contig2621 343510

IGV: Start, Jump

PHL-2 c.3552delG p.Lys1185fs frameshift variant high contig2621 343593

IGV: Start, Jump

PHL-2 c.3556_3557delAA p.Lys1186fs frameshift variant high contig2621 343598

IGV: Start, Jump



c.774G>A p.Met258Ile missense variant moderate contig700 1944616

IGV: Start, Jump



c.67T>A p.Phe23Ile missense variant moderate contig700 1945567

IGV: Start, Jump



c.1152T>A p.Asn384Lys missense variant moderate contig700 1950486

IGV: Start, Jump



c.1132C>G p.Leu378Val missense variant moderate contig700 1950506

IGV: Start, Jump



c.1117A>G p.Ile373Val missense variant moderate contig700 1950521

IGV: Start, Jump



c.948T>G p.Asp316Glu missense variant moderate contig700 1950690

IGV: Start, Jump



c.945T>G p.Ser315Arg missense variant moderate contig700 1950693

IGV: Start, Jump



c.944G>A p.Ser315Asn missense variant moderate contig700 1950694

IGV: Start, Jump



c.934C>G p.His312Asp missense variant moderate contig700 1950704

IGV: Start, Jump



c.774G>A p.Met258Ile missense variant moderate contig700 1950864

IGV: Start, Jump



c.31A>T p.Thr11Ser missense variant moderate contig700 1951851

IGV: Start, Jump



c.-2_1dupATA start lost & conservative inframe insertion high contig700 1951880

IGV: Start, Jump



c.496A>G p.Lys166Glu missense variant moderate contig700 2721177

IGV: Start, Jump



c.489delT p.Phe163fs frameshift variant high contig700 2721183

IGV: Start, Jump



c.485A>G p.Lys162Arg missense variant moderate contig700 2721188

IGV: Start, Jump



c.431T>G p.Val144Gly missense variant moderate contig700 2721242

IGV: Start, Jump



c.419A>G p.Asp140Gly missense variant moderate contig700 2721254

IGV: Start, Jump



c.352_355delACAG p.Thr118fs frameshift variant high contig700 2721317

IGV: Start, Jump



c.323A>G p.Glu108Gly missense variant moderate contig700 2721350

IGV: Start, Jump



c.316+2T>A splice donor variant & intron variant high contig700 2723818

IGV: Start, Jump



c.238T>C p.Phe80Leu missense variant moderate contig700 2724197

IGV: Start, Jump



c.229G>A p.Gly77Ser missense variant moderate contig700 2724206

IGV: Start, Jump



c.216G>C p.Leu72Phe missense variant moderate contig700 2724219

IGV: Start, Jump



c.206T>C p.Leu69Ser missense variant moderate contig700 2724229

IGV: Start, Jump



c.1319T>C p.Ile440Thr missense variant moderate contig380 285250

IGV: Start, Jump



c.260C>G p.Ser87Cys missense variant moderate contig931 109979

IGV: Start, Jump



c.260C>G p.Ser87Cys missense variant moderate contig931 118104

IGV: Start, Jump



c.220A>G p.Ile74Val missense variant moderate contig931 118144

IGV: Start, Jump



c.185C>T p.Thr62Ile missense variant moderate contig931 118179

IGV: Start, Jump



c.574A>G p.Asn192Asp missense variant moderate contig97 242280

IGV: Start, Jump



c.772A>G p.Ser258Gly missense variant moderate contig97 242478

IGV: Start, Jump



c.812G>C p.Gly271Ala missense variant moderate contig97 242518

IGV: Start, Jump



c.1466G>A p.Ser489Asn missense variant moderate contig97 244297

IGV: Start, Jump



c.1630A>G p.Thr544Ala missense variant moderate contig97 244461

IGV: Start, Jump



c.1803_1805delTCA p.His601del disruptive inframe deletion moderate contig97 244625

IGV: Start, Jump



c.1966C>G p.Pro656Ala missense variant moderate contig97 244797

IGV: Start, Jump



c.2198G>T p.Arg733Leu missense variant moderate contig97 245029

IGV: Start, Jump



c.2216A>G p.His739Arg missense variant moderate contig97 245047

IGV: Start, Jump



c.80A>G p.Lys27Arg missense variant moderate contig121 2828736

IGV: Start, Jump



c.202T>A p.Leu68Ile missense variant moderate contig121 2828858

IGV: Start, Jump



c.406A>G p.Ile136Val missense variant moderate contig121 2839605

IGV: Start, Jump



c.151G>T p.Ala51Ser missense variant moderate contig95 1989818

IGV: Start, Jump



c.331A>G p.Asn111Asp missense variant moderate contig81 209293

IGV: Start, Jump



c.948_949insA p.Asp317fs frameshift variant high contig81 209910

IGV: Start, Jump



c.952delC p.Gln318fs frameshift variant high contig81 209912

IGV: Start, Jump



c.953A>G p.Gln318Arg missense variant moderate contig81 209915

IGV: Start, Jump



c.955C>T p.Arg319Cys missense variant moderate contig81 209917

IGV: Start, Jump



c.1006A>G p.Lys336Glu missense variant moderate contig81 209968

IGV: Start, Jump



c.1102C>A p.His368Asn missense variant moderate contig81 210064

IGV: Start, Jump



c.1415G>A p.Ser472Asn missense variant moderate contig81 210377

IGV: Start, Jump



c.1417A>G p.Thr473Ala missense variant moderate contig81 210379

IGV: Start, Jump



c.1434G>T p.Glu478Asp missense variant moderate contig81 210396

IGV: Start, Jump



c.1541T>C p.Val514Ala missense variant moderate contig81 210503

IGV: Start, Jump



c.3003_3020delACAGCAACAGCAGCAGCA p.Gln1002_Gln1007del disruptive inframe deletion moderate contig1439 1486776

IGV: Start, Jump



c.2623A>G p.Thr875Ala missense variant moderate contig1439 1487174

IGV: Start, Jump



c.2551A>G p.Thr851Ala missense variant moderate contig1439 1487246

IGV: Start, Jump



c.1387A>G p.Thr463Ala missense variant moderate contig1439 1489811

IGV: Start, Jump



c.16T>C p.Ser6Pro missense variant moderate contig850 3065274

IGV: Start, Jump



c.2141G>C p.Gly714Ala missense variant moderate contig1891 884225

IGV: Start, Jump



c.1618A>G p.Ile540Val missense variant moderate contig1891 885936

IGV: Start, Jump



c.1378G>A p.Val460Ile missense variant moderate contig1891 886370

IGV: Start, Jump



c.56C>G p.Ala19Gly missense variant moderate contig1891 889336

IGV: Start, Jump



c.-108+1_-108+2insG splice donor variant & intron variant high contig1891 889975

IGV: Start, Jump



c.1115G>T p.Gly372Val missense variant moderate contig1460 1083145

IGV: Start, Jump



c.6653A>G p.Asn2218Ser missense variant moderate contig1460 1184434

IGV: Start, Jump



c.5932A>G p.Ile1978Val missense variant moderate contig1460 1185552

IGV: Start, Jump



c.1872T>A p.Asp624Glu missense variant moderate contig1460 1190252

IGV: Start, Jump



c.1656T>G p.Asn552Lys missense variant moderate contig1460 1191574

IGV: Start, Jump



c.1630G>C p.Ala544Pro missense variant moderate contig1460 1191600

IGV: Start, Jump



c.710C>T p.Pro237Leu missense variant moderate contig1460 1193804

IGV: Start, Jump



c.706T>C p.Tyr236His missense variant moderate contig1460 1193808

IGV: Start, Jump



c.665+2T>A splice donor variant & intron variant high contig1460 1194391

IGV: Start, Jump



c.637T>A p.Ser213Thr missense variant moderate contig1460 1194421

IGV: Start, Jump



c.434C>T p.Ser145Phe missense variant moderate contig954 3049270

IGV: Start, Jump



c.1772A>G p.Gln591Arg missense variant moderate contig954 3059929

IGV: Start, Jump



c.13C>G p.Leu5Val missense variant moderate contig1561 3124437

IGV: Start, Jump



c.35_43dupATAATAATA p.Asn12_Asn14dup disruptive inframe insertion moderate contig1561 3124441

IGV: Start, Jump



c.2981T>C p.Met994Thr missense variant moderate contig1450 2044012

IGV: Start, Jump



c.2962G>A p.Asp988Asn missense variant moderate contig1450 2044031

IGV: Start, Jump



c.2840A>G p.Asn947Ser missense variant moderate contig1450 2044192

IGV: Start, Jump



c.2585G>A p.Arg862Gln missense variant moderate contig1450 2045075

IGV: Start, Jump



c.722G>A p.Arg241Lys missense variant moderate contig976 1083132

IGV: Start, Jump



c.667G>A p.Val223Ile missense variant moderate contig976 1083187

IGV: Start, Jump



c.659G>A p.Arg220Gln missense variant moderate contig976 1083195

IGV: Start, Jump



c.634G>C p.Gly212Arg missense variant moderate contig976 1083220

IGV: Start, Jump



c.475G>A p.Gly159Arg missense variant moderate contig976 1083550

IGV: Start, Jump



c.416T>C p.Leu139Pro missense variant moderate contig976 1083609

IGV: Start, Jump



c.382T>C p.Tyr128His missense variant moderate contig976 1083643

IGV: Start, Jump



c.296C>T p.Pro99Leu missense variant moderate contig976 1083729

IGV: Start, Jump



c.293A>G p.Asp98Gly missense variant moderate contig976 1083732

IGV: Start, Jump



c.284A>T p.Glu95Val missense variant moderate contig976 1083741

IGV: Start, Jump



c.199A>G p.Asn67Asp missense variant moderate contig976 1083876

IGV: Start, Jump



c.188A>G p.Asn63Ser missense variant moderate contig976 1083887

IGV: Start, Jump



c.181G>A p.Val61Ile missense variant moderate contig976 1083894

IGV: Start, Jump



c.167A>G p.Glu56Gly missense variant moderate contig976 1083908

IGV: Start, Jump



c.125A>G p.Glu42Gly missense variant moderate contig976 1083950

IGV: Start, Jump



c.79A>G p.Thr27Ala missense variant moderate contig976 1083996

IGV: Start, Jump



c.52G>A p.Gly18Ser missense variant moderate contig976 1084023

IGV: Start, Jump



c.3G>A p.Met1? start lost high contig976 1084072

IGV: Start, Jump



c.*340_*343-6delTATATATATATATATATAGA splice donor variant & splice region variant & 3 prime UTR variant & intron variant high contig510 71467

IGV: Start, Jump



c.1124_1153dupATGTGGGTGAACCAACCCAGATGGAGGATA p.Asn375_Asp384dup disruptive inframe insertion moderate contig1225 2281360

IGV: Start, Jump



c.1222C>G p.Gln408Glu missense variant moderate contig1225 2281482

IGV: Start, Jump



c.1758T>G p.Asn586Lys missense variant moderate contig1225 2282186

IGV: Start, Jump



c.704A>T p.His235Leu missense variant moderate contig2282 549696

IGV: Start, Jump



c.1652A>G p.Glu551Gly missense variant moderate contig93 3339759

IGV: Start, Jump


Nearest genetic relatives (All Samples)

0 0.067 0.133 0.200 0.267
clone distance sibling distance more distant
  1. 0.228 Doug s Varin (RSP11243)
  2. 0.231 Electra (RSP11366)
  3. 0.236 Lift (RSP11378)
  4. 0.241 Serious Happiness (RSP10763)
  5. 0.245 Domnesia (RSP11184)
  6. 0.247 Durban Poison #1 (RSP11013)
  7. 0.249 Durban Poison #1 (RSP10996)
  8. 0.249 Recon (RSP10755)
  9. 0.250 Black Jack (RSP10603)
  10. 0.250 RKM-2018-027 (RSP11119)
  11. 0.251 Durban Poison (RSP11014)
  12. 0.252 Lifter (RSP11365)
  13. 0.253 Durban Poison (RSP10998)
  14. 0.253 Blueberry Cheesecake (RSP10684)
  15. 0.253 Suver Haze (RSP11364)
  16. 0.259 BLACK JACK (RSP11346)
  17. 0.259 RKM-2018-016 (RSP11108)
  18. 0.260 RKM-2018-025 (RSP11117)
  19. 0.261 Sour Tsunami (RSP11187)
  20. 0.261 Joy (RSP11380)

Nearest genetic relatives (Base Tree)

0 0.083 0.167 0.250 0.333
clone distance sibling distance more distant
  1. 0.258 Recon (RSP10755)
  2. 0.263 RKM-2018-027 (RSP11119)
  3. 0.268 Durban Poison (RSP11014)
  4. 0.272 Blueberry Cheesecake (RSP10684)
  5. 0.282 CST (RSP11002)
  6. 0.289 Gold Cracker (RSP11048)
  7. 0.289 Liberty Haze (RSP11000)
  8. 0.300 Golden Goat 2 (RSP10991)
  9. 0.304 RKM-2018-006 (RSP11097)
  10. 0.306 RKM-2018-020 (RSP11112)
  11. 0.307 RKM-2018-003 (RSP11094)
  12. 0.313 UP Sunrise (RSP10989)
  13. 0.315 Kimbo Slice (RSP10997)
  14. 0.315 Blue Dream (RSP11033)
  15. 0.316 RKM-2018-023 (RSP11115)
  16. 0.318 RKM-2018-022 (RSP11114)
  17. 0.320 RKM-2018-031 (RSP11123)
  18. 0.320 Pie Hoe (RSP11073)
  19. 0.325 Cbot-2019-004 (RSP11132)
  20. 0.326 Hermaphrodite Research Sample1 (RSP11049)

Most genetically distant strains (All Samples)

0 0.117 0.233 0.350 0.467
clone distance sibling distance more distant
  1. 0.447 Cherry Blossom (RSP11323)
  2. 0.446 JL 4th Gen 5 (RSP11199)
  3. 0.428 Cherry Blossom (RSP11301)
  4. 0.425 JL 3rd Gen Father (RSP11196)
  5. 0.424 JL yellow (RSP11075)
  6. 0.418 JL 4th Gen 4 (RSP11198)
  7. 0.418 Unknown--Cherry Wine---001- (RSP11268)
  8. 0.417 Danny Noonan (RSP11070)
  9. 0.416 Cherry Blossom (RSP11318)
  10. 0.407 Cherry Blossom (RSP11328)
  11. 0.407 AVIDEKEL 2 0 (RSP11174)
  12. 0.405 JL 4th Gen 6 (RSP11200)
  13. 0.405 JL 3rd Gen Mother (RSP11214)
  14. 0.402 JL 3rd Gen Mother (RSP11197)
  15. 0.399 JL 4th Gen 3 (RSP11195)
  16. 0.394 Northern Skunk (RSP11456)
  17. 0.392 OG BSR (RSP12105)
  18. 0.391 Chematonic -Cannatonic x Chemdawg- (RSP11394)
  19. 0.391 Chem 91 (RSP11185)
  20. 0.390 JL 4th Gen 2 (RSP11194)

Most genetically distant strains (Base Tree)

0 0.108 0.217 0.325 0.433
clone distance sibling distance more distant
  1. 0.417 JL yellow (RSP11075)
  2. 0.400 Kush Hemp E1 (RSP11128)
  3. 0.383 Cbot-2019-005 (RSP11133)
  4. 0.383 Cbot-2019-001 (RSP11129)
  5. 0.381 Sour Raspberry (RSP10551)
  6. 0.381 RKM-2018-002 (RSP11093)
  7. 0.377 RKM-2018-028 (RSP11120)
  8. 0.377 Feral (RSP10890)
  9. 0.370 RKM-2018-026 (RSP11118)
  10. 0.369 Fedora 17 (RSP10661)
  11. 0.369 RKM-2018-033 (RSP11125)
  12. 0.365 RKM-2018-004 (RSP11096)
  13. 0.364 Ivory (RSP10668)
  14. 0.364 Kyrgyz Gold (RSP11054)
  15. 0.364 KYRG-11 (RSP11051)
  16. 0.364 Black Beauty (RSP11035)
  17. 0.361 Blueberry Cheesecake (RSP10672)
  18. 0.360 Cbot-2019-006 (RSP11134)
  19. 0.360 RKM-2018-029 (RSP11121)
  20. 0.359 RKM-2018-019 (RSP11111)

Nearest genetic relative in Phylos dataset

Phylos Strain SRR8347163
Overlapping SNPs:

Nearest genetic relative in Lynch dataset

Lynch Strain SRR3495226
Overlapping SNPs:

Blockchain Registration Information

QR code for RSP11659

Kannapedia uses cookies

By clicking Allow All, you agree to the storing of cookies on your device to enhance site navigation, analyze site usage, and assist in our marketing efforts.

Customize Settings