Pam1 x Dosidos 18

RSP 12502

Grower: Seattle Chronic Seeds

General Information

Sample Name
PDS1801
Accession Date
December 8, 2021
Reported Plant Sex
Male

The strain rarity visualization shows how distant the strain is from the other cultivars in the Kannapedia database. The y-axis represents genetic distance, getting farther as you go up. The width of the visualization at any position along the y-axis shows how many strains there are in the database at that genetic distance. So, a common strain will have a more bottom-heavy shape, while uncommon and rare cultivars will have a visualization that is generally shifted towards the top.

Rarity: Uncommon
Most Distant Most Similar

Chemical Information

Cannabinoid and terpenoid information provided by the grower.

Cannabinoids

No information provided.

Terpenoids

No information provided.

Genetic Information

Plant Type
Type I

The bell curve in the heterozygosity visualization shows the distribution of heterozygosity levels for cannabis cultivars in the Kannapedia database. The green line shows where this particular strain fits within the distribution. Heterozygosity is associated with heterosis (aka hybrid vigor) but also leads to the production of more variable offspring. When plants have two genetically different parents, heterozygosity levels will be higher than if it has been inbred or backcrossed repeatedly.

Heterozygosity: 1.55%
Least Heterozygous Most Heterozygous

The ratio of reads mapped to Y-contigs to reads mapped to the whole Cannabis genome (Y-ratios) has been demonstrated to be strongly correlated with plant sex typing. This plot shows the distribution of Y-ratios for all samples in our database which were sequenced with the same method (panel or WGS) as this sample and where this sample falls in the distribution.

Y-Ratio Distribution: 0.0626
male female RSP12502

This chart represents the Illumina sequence coverage over the Bt/Bd allele. These are the three regions in the cannabis genome that impact THCA, CBDA, CBGA production. Coverage over the Active CBDAS gene is highly correlated with Type II and Type III plants as described by Etienne de Meijer. Coverage over the THCA gene is highly correlated with Type I and Type II plants but is anti-correlated with Type III plants. Type I plants require coverage over the inactive CBDA loci and no coverage over the Active CBDA gene. Lack of coverage over the Active CBDA and Active THCA allele are presumed to be Type IV plants (CBGA dominant). While deletions of entire THCAS and CBDAS genes are the most common Bt:Bd alleles observed, it is possible to have plants with these genes where functional expression of the enzyme is disrupted by deactivating point mutations (Kojoma et al. 2006).

Bt/Bd Allele Coverage

This chart represents the Illumina sequence coverage over the CBCA synthase gene.

CBCAS Coverage

Variants (THCAS, CBDAS, and CBCAS)

Gene HGVS.c HGVS.p Annotation Annotation Impact Contig Contig Pos Ref/Alt Var Freq
THCAS c.998C>G p.Pro333Arg missense variant moderate contig741 4416830

IGV: Start, Jump

G/C
NGS:
0.182
C90:
0.000

Variants (Select Genes of Interest)

PHL-2 c.932T>C p.Leu311Pro missense variant moderate contig2621 340210

IGV: Start, Jump

T/C
NGS:
0.039
C90:
0.268
PHL-2 c.1057A>G p.Arg353Gly missense variant moderate contig2621 340335

IGV: Start, Jump

A/G
NGS:
0.096
C90:
0.555
PHL-2 c.1096G>A p.Ala366Thr missense variant moderate contig2621 340374

IGV: Start, Jump

G/A
NGS:
0.090
C90:
0.531
PHL-2 c.2564T>A p.Phe855Tyr missense variant moderate contig2621 342607

IGV: Start, Jump

T/A
NGS:
0.064
C90:
0.732
PHL-2 c.2578T>A p.Leu860Ile missense variant moderate contig2621 342621

IGV: Start, Jump

T/A
NGS:
0.068
C90:
0.746
PHL-2 c.2624C>T p.Ser875Phe missense variant moderate contig2621 342667

IGV: Start, Jump

C/T
NGS:
0.042
C90:
0.268
PHL-2 c.2783G>A p.Ser928Asn missense variant moderate contig2621 342826

IGV: Start, Jump

G/A
NGS:
0.107
C90:
0.890
PHL-2 c.2830A>C p.Asn944His missense variant moderate contig2621 342873

IGV: Start, Jump

A/C
NGS:
0.044
C90:
0.000
PHL-2 c.2933G>T p.Arg978Leu missense variant moderate contig2621 342976

IGV: Start, Jump

G/T
NGS:
0.048
C90:
0.297
PHL-2 c.2936T>G p.Val979Gly missense variant moderate contig2621 342979

IGV: Start, Jump

T/G
NGS:
0.048
C90:
0.000
PHL-2 c.3209A>G p.Gln1070Arg missense variant moderate contig2621 343252

IGV: Start, Jump

A/G
NGS:
0.103
C90:
0.885
PHL-2 c.3467A>G p.Gln1156Arg missense variant moderate contig2621 343510

IGV: Start, Jump

A/G
NGS:
0.064
C90:
0.713
PKSG-2b

UniProt

c.774G>A p.Met258Ile missense variant moderate contig700 1950864

IGV: Start, Jump

C/T
NGS:
0.366
C90:
0.947
PKSG-2b

UniProt

c.-2_1dupATA start lost & conservative inframe insertion high contig700 1951880

IGV: Start, Jump

A/ATAT
NGS:
0.410
C90:
0.000
DXR-2

UniProt

c.1319T>C p.Ile440Thr missense variant moderate contig380 285250

IGV: Start, Jump

A/G
NGS:
0.480
C90:
0.000
DXR-2

UniProt

c.431C>G p.Ala144Gly missense variant moderate contig380 287760

IGV: Start, Jump

G/C
NGS:
0.182
C90:
0.550
FAD2-2

UniProt

c.164A>G p.His55Arg missense variant moderate contig83 1803205

IGV: Start, Jump

T/C
NGS:
0.037
C90:
0.000
FAD2-2

UniProt

c.161T>A p.Leu54His missense variant moderate contig83 1803208

IGV: Start, Jump

A/T
NGS:
0.156
C90:
0.000
FAD2-2

UniProt

c.153G>T p.Arg51Ser missense variant moderate contig83 1803216

IGV: Start, Jump

C/A
NGS:
0.007
C90:
0.000
FAD2-2

UniProt

c.64G>T p.Ala22Ser missense variant moderate contig83 1803305

IGV: Start, Jump

C/A
NGS:
0.048
C90:
0.000
FAD2-2

UniProt

c.58C>T p.His20Tyr missense variant moderate contig83 1803311

IGV: Start, Jump

G/A
NGS:
0.013
C90:
0.000
ELF3

UniProt

c.358G>A p.Gly120Arg missense variant moderate contig97 242064

IGV: Start, Jump

G/A
NGS:
0.099
C90:
0.493
ELF3

UniProt

c.520A>C p.Asn174His missense variant moderate contig97 242226

IGV: Start, Jump

A/C
NGS:
0.094
C90:
0.502
ELF3

UniProt

c.772A>G p.Ser258Gly missense variant moderate contig97 242478

IGV: Start, Jump

A/G
NGS:
0.112
C90:
0.000
ELF3

UniProt

c.812G>C p.Gly271Ala missense variant moderate contig97 242518

IGV: Start, Jump

G/C
NGS:
0.114
C90:
0.938
ELF3

UniProt

c.1230-2_1230-1delAG splice acceptor variant & intron variant high contig97 243676

IGV: Start, Jump

TAG/T
NGS:
0.088
C90:
0.450
ELF3

UniProt

c.1466G>A p.Ser489Asn missense variant moderate contig97 244297

IGV: Start, Jump

G/A
NGS:
0.123
C90:
0.000
ELF3

UniProt

c.1630A>G p.Thr544Ala missense variant moderate contig97 244461

IGV: Start, Jump

A/G
NGS:
0.103
C90:
0.545
ELF3

UniProt

c.1803_1805delTCA p.His601del disruptive inframe deletion moderate contig97 244625

IGV: Start, Jump

ACAT/A
NGS:
0.092
C90:
0.000
ELF3

UniProt

c.1966C>G p.Pro656Ala missense variant moderate contig97 244797

IGV: Start, Jump

C/G
NGS:
0.123
C90:
0.632
ELF3

UniProt

c.2141C>G p.Pro714Arg missense variant moderate contig97 244972

IGV: Start, Jump

C/G
NGS:
0.088
C90:
0.335
ELF3

UniProt

c.2198G>T p.Arg733Leu missense variant moderate contig97 245029

IGV: Start, Jump

G/T
NGS:
0.125
C90:
0.531
aPT4

UniProt

c.153A>C p.Lys51Asn missense variant moderate contig121 2828809

IGV: Start, Jump

A/C
NGS:
0.375
C90:
0.000
aPT1

UniProt

c.406A>G p.Ile136Val missense variant moderate contig121 2839605

IGV: Start, Jump

A/G
NGS:
0.579
C90:
0.761
aPT1

UniProt

c.629C>T p.Thr210Ile missense variant moderate contig121 2840237

IGV: Start, Jump

C/T
NGS:
0.561
C90:
0.598
aPT1

UniProt

c.727G>T p.Glu243* stop gained high contig121 2841362

IGV: Start, Jump

G/T
NGS:
0.127
C90:
0.100
aPT1

UniProt

c.864C>G p.Asn288Lys missense variant moderate contig121 2842407

IGV: Start, Jump

C/G
NGS:
0.075
C90:
0.062
HDS-2

UniProt

c.82_93delGTAACCGGAACT p.Val28_Thr31del conservative inframe deletion moderate contig95 1989748

IGV: Start, Jump

CGTAACCGGAACT/C
NGS:
0.805
C90:
0.000
HDS-2

UniProt

c.127T>G p.Ser43Ala missense variant moderate contig95 1989794

IGV: Start, Jump

T/G
NGS:
0.721
C90:
0.000
AAE1-2

UniProt

c.1006A>G p.Lys336Glu missense variant moderate contig81 209968

IGV: Start, Jump

A/G
NGS:
0.116
C90:
0.000
AAE1-2

UniProt

c.1118C>G p.Thr373Ser missense variant moderate contig81 210080

IGV: Start, Jump

C/G
NGS:
0.026
C90:
0.000
AAE1-2

UniProt

c.1541T>C p.Val514Ala missense variant moderate contig81 210503

IGV: Start, Jump

T/C
NGS:
0.050
C90:
0.000
PHL-1

UniProt

c.2623A>G p.Thr875Ala missense variant moderate contig1439 1487174

IGV: Start, Jump

T/C
NGS:
0.123
C90:
0.000
PHL-1

UniProt

c.2551A>G p.Thr851Ala missense variant moderate contig1439 1487246

IGV: Start, Jump

T/C
NGS:
0.116
C90:
0.890
PHL-1

UniProt

c.1387A>G p.Thr463Ala missense variant moderate contig1439 1489811

IGV: Start, Jump

T/C
NGS:
0.107
C90:
0.904
Edestin

UniProt

c.16T>C p.Ser6Pro missense variant moderate contig850 3065274

IGV: Start, Jump

A/G
NGS:
0.059
C90:
0.000
TFL1

UniProt

c.302-1G>A splice acceptor variant & intron variant high contig1636 520616

IGV: Start, Jump

C/T
NGS:
0.103
C90:
0.794
FAD4

UniProt

c.121G>T p.Val41Phe missense variant moderate contig784 1690873

IGV: Start, Jump

G/T
NGS:
0.044
C90:
0.000
FAD4

UniProt

c.220C>G p.Arg74Gly missense variant moderate contig784 1690972

IGV: Start, Jump

C/G
NGS:
0.026
C90:
0.000
HDS-1

UniProt

c.1618A>G p.Ile540Val missense variant moderate contig1891 885936

IGV: Start, Jump

T/C
NGS:
0.099
C90:
0.861
HDS-1

UniProt

c.1378G>A p.Val460Ile missense variant moderate contig1891 886370

IGV: Start, Jump

C/T
NGS:
0.167
C90:
0.000
HDS-1

UniProt

c.56C>G p.Ala19Gly missense variant moderate contig1891 889336

IGV: Start, Jump

G/C
NGS:
0.125
C90:
0.943
HDS-1

UniProt

c.35G>A p.Cys12Tyr missense variant moderate contig1891 889357

IGV: Start, Jump

C/T
NGS:
0.094
C90:
0.646
PIE1-2

UniProt

c.6653A>G p.Asn2218Ser missense variant moderate contig1460 1184434

IGV: Start, Jump

T/C
NGS:
0.059
C90:
0.928
PIE1-2

UniProt

c.5932A>G p.Ile1978Val missense variant moderate contig1460 1185552

IGV: Start, Jump

T/C
NGS:
0.061
C90:
0.268
PIE1-2

UniProt

c.1872T>A p.Asp624Glu missense variant moderate contig1460 1190252

IGV: Start, Jump

A/T
NGS:
0.086
C90:
0.990
PIE1-2

UniProt

c.1656T>G p.Asn552Lys missense variant moderate contig1460 1191574

IGV: Start, Jump

A/C
NGS:
0.009
C90:
0.043
PIE1-2

UniProt

c.1630G>C p.Ala544Pro missense variant moderate contig1460 1191600

IGV: Start, Jump

C/G
NGS:
0.070
C90:
0.933
PIE1-2

UniProt

c.1289A>G p.Asp430Gly missense variant moderate contig1460 1192109

IGV: Start, Jump

T/C
NGS:
0.079
C90:
0.000
PIE1-2

UniProt

c.710C>T p.Pro237Leu missense variant moderate contig1460 1193804

IGV: Start, Jump

G/A
NGS:
0.072
C90:
0.866
PIE1-2

UniProt

c.706T>C p.Tyr236His missense variant moderate contig1460 1193808

IGV: Start, Jump

A/G
NGS:
0.059
C90:
0.737
PIE1-2

UniProt

c.637T>A p.Ser213Thr missense variant moderate contig1460 1194421

IGV: Start, Jump

A/T
NGS:
0.079
C90:
0.885
EMF2

UniProt

c.1772A>G p.Gln591Arg missense variant moderate contig954 3059929

IGV: Start, Jump

A/G
NGS:
0.092
C90:
0.876
FT

UniProt

c.240C>G p.Asn80Lys missense variant moderate contig1561 3124664

IGV: Start, Jump

C/G
NGS:
0.075
C90:
0.000
FLD

UniProt

c.2981T>C p.Met994Thr missense variant moderate contig1450 2044012

IGV: Start, Jump

A/G
NGS:
0.064
C90:
0.478
FLD

UniProt

c.2964C>A p.Asp988Glu missense variant moderate contig1450 2044029

IGV: Start, Jump

G/T
NGS:
0.057
C90:
0.464
FLD

UniProt

c.2929T>C p.Phe977Leu missense variant moderate contig1450 2044103

IGV: Start, Jump

A/G
NGS:
0.026
C90:
0.349
FLD

UniProt

c.125G>A p.Ser42Asn missense variant moderate contig1450 2047909

IGV: Start, Jump

C/T
NGS:
0.037
C90:
0.388
PIE1-1

UniProt

c.1124_1153dupATGTGGGTGAACCAACCCAGATGGAGGATA p.Asn375_Asp384dup disruptive inframe insertion moderate contig1225 2281360

IGV: Start, Jump

A/ATGAACCAACCCAGATGGAGGATAATGTGGG
NGS:
0.011
C90:
0.000
PIE1-1

UniProt

c.1222C>G p.Gln408Glu missense variant moderate contig1225 2281482

IGV: Start, Jump

C/G
NGS:
0.096
C90:
0.852
GGR

UniProt

c.212G>T p.Cys71Phe missense variant moderate contig2282 549204

IGV: Start, Jump

G/T
NGS:
0.011
C90:
0.062
GGR

UniProt

c.704A>T p.His235Leu missense variant moderate contig2282 549696

IGV: Start, Jump

A/T
NGS:
0.121
C90:
0.000
PKSB-3

UniProt

c.1652A>G p.Glu551Gly missense variant moderate contig93 3339759

IGV: Start, Jump

A/G
NGS:
0.088
C90:
0.000
PKSB-3

UniProt

c.1850_1852dupTGA p.Met617dup disruptive inframe insertion moderate contig93 3339945

IGV: Start, Jump

A/AGAT
NGS:
0.031
C90:
0.000
PKSB-3

UniProt

c.1901C>G p.Ala634Gly missense variant moderate contig93 3340008

IGV: Start, Jump

C/G
NGS:
0.059
C90:
0.000

Nearest genetic relatives (All Samples)

0 0.050 0.100 0.150 0.200
clone distance sibling distance more distant
  1. 0.115 B52 (SRR14708255)
  2. 0.120 PCL1 (SRR14708246)
  3. 0.121 Cream Sugar (RSP12487)
  4. 0.123 Pie Scream (RSP12482)
  5. 0.129 Kompolti (SRR14708277)
  6. 0.136 VIR 483 (SRR14708238)
  7. 0.160 Hawaii Maui Waui (SRR14708262)
  8. 0.163 Juicy Gummy x Royal Kush (RSP12484)
  9. 0.164 Cherry Lime Runtz (RSP12486)
  10. 0.167 Northern Light (SRR14708265)
  11. 0.171 Peach Cresendo (RSP12483)
  12. 0.175 VIR 483 (SRR14708239)
  13. 0.175 Alpine Rocket (SRR14708266)
  14. 0.179 Lift (RSP11378)
  15. 0.185 Triangle Kush x Square Wave BX (RSP12100)
  16. 0.191 QHI (SRR14708202)
  17. 0.192 Hindu Kush (SRR14708261)
  18. 0.197 Liberty Haze (RSP11000)
  19. 0.197 Rest (RSP11377)
  20. 0.197 Doug s Varin (RSP11243)

Nearest genetic relatives (Base Tree)

0 0.083 0.167 0.250 0.333
clone distance sibling distance more distant
  1. 0.198 Liberty Haze (RSP11000)
  2. 0.198 Blueberry Cheesecake (RSP10684)
  3. 0.254 Pie Hoe (RSP11073)
  4. 0.262 Golden Goat 2 (RSP10991)
  5. 0.270 RKM-2018-031 (RSP11123)
  6. 0.277 Tisza (RSP10659)
  7. 0.277 Recon (RSP10755)
  8. 0.279 Tygra (RSP10667)
  9. 0.281 Durban Poison (RSP11014)
  10. 0.283 UP Sunrise (RSP10989)
  11. 0.288 RKM-2018-029 (RSP11121)
  12. 0.295 QUEEN JESUS (RSP10105)
  13. 0.297 Blueberry Cheesecake (RSP10680)
  14. 0.298 RKM-2018-034 (RSP11126)
  15. 0.299 Blueberry Cheesecake (RSP10672)
  16. 0.302 CST (RSP11002)
  17. 0.303 Jiangji (RSP10653)
  18. 0.308 KYRG-11 (RSP11051)
  19. 0.308 Gold Cracker (RSP11048)
  20. 0.311 Kimbo Slice (RSP10997)

Most genetically distant strains (All Samples)

0 0.117 0.233 0.350 0.467
clone distance sibling distance more distant
  1. 0.437 Kush Hemp E1 (RSP11128)
  2. 0.407 Danny Noonan (RSP11070)
  3. 0.403 Northern Lights (RSP11501)
  4. 0.403 Chem 91 (RSP11185)
  5. 0.398 JL 3rd Gen Father (RSP11196)
  6. 0.398 White Label 1 (RSP11336)
  7. 0.398 GG4 (RSP11978)
  8. 0.396 80E (RSP11213)
  9. 0.396 JL yellow (RSP11075)
  10. 0.394 Cherry Blossom (RSP11328)
  11. 0.390 AVIDEKEL 2 0 (RSP11174)
  12. 0.387 Skunk 18 (RSP11038)
  13. 0.383 Cherry Blossom (RSP11301)
  14. 0.382 RKM-2018-012 (RSP11103)
  15. 0.381 JL 4th Gen 5 (RSP11199)
  16. 0.381 Cbot-2019-005 (RSP11133)
  17. 0.380 80E (RSP11211)
  18. 0.379 JL 4th Gen 2 (RSP11194)
  19. 0.373 Cbot-2019-004 (RSP11132)
  20. 0.373 Cherry Blossom (RSP11323)

Most genetically distant strains (Base Tree)

0 0.108 0.217 0.325 0.433
clone distance sibling distance more distant
  1. 0.412 Kush Hemp E1 (RSP11128)
  2. 0.403 JL yellow (RSP11075)
  3. 0.390 RKM-2018-026 (RSP11118)
  4. 0.379 Cbot-2019-005 (RSP11133)
  5. 0.379 Skunk 18 (RSP11038)
  6. 0.366 Feral (RSP10890)
  7. 0.365 Cbot-2019-004 (RSP11132)
  8. 0.364 Black Beauty (RSP11035)
  9. 0.363 RKM-2018-002 (RSP11093)
  10. 0.362 Sour Raspberry (RSP10551)
  11. 0.360 RKM-2018-003 (RSP11094)
  12. 0.355 Cherry (RSP11142)
  13. 0.354 Ivory (RSP10668)
  14. 0.349 Carmagnola (RSP11037)
  15. 0.348 RKM-2018-006 (RSP11097)
  16. 0.347 RKM-2018-028 (RSP11120)
  17. 0.344 RKM-2018-027 (RSP11119)
  18. 0.342 Fedora 17 (RSP10661)
  19. 0.341 Blue Dream (RSP11033)
  20. 0.341 Monoica (RSP10241)

Nearest genetic relative in Phylos dataset

Phylos Strain SRR4450138
Overlapping SNPs:
2
Concordance:
2

Nearest genetic relative in Lynch dataset

Lynch Strain SRR3495313
Overlapping SNPs:
2
Concordance:
2

Blockchain Registration Information

Transaction ID
b8361fd67fa95351e749441198f993038ef9de2439655c1ce283a1d75e00a242
Stamping Certificate
Download PDF (39.6 KB)
SHASUM Hash
12cf8ca1271c48f4b0b4be1ae86c8715475961f70accaa9dbb7731bc0954e515
QR code for RSP12502

Kannapedia uses cookies

By clicking Allow All, you agree to the storing of cookies on your device to enhance site navigation, analyze site usage, and assist in our marketing efforts.

Customize Settings